Use of mettl1 overexpression agent in preparation of anti-mycobacterium tuberculosis drugs

By constructing a METTL1 overexpression agent using lentiviral vector technology, the problem of Mycobacterium tuberculosis remaining latent in macrophages was solved, enabling targeted therapy for tuberculosis and enhancing the clearance capacity of macrophages.

CN120459329BActive Publication Date: 2026-02-13南昌大学第一附属医院
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510777572.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-11
Publication Date
2026-02-13
Estimated Expiration
2045-06-11

AI Technical Summary

Technical Problem

Current technologies have not effectively utilized the METTL1 gene in the treatment of tuberculosis. Mycobacterium tuberculosis can remain dormant in macrophages through immune escape strategies, resulting in poor efficacy of traditional drug treatments.

Method used

METTL1 overexpression agents were constructed using lentiviral vector technology to promote the overexpression of METTL1 in macrophages and enhance autophagy to clear Mycobacterium tuberculosis.

Benefits of technology

It significantly enhances the ability of macrophages to clear Mycobacterium tuberculosis, providing a novel targeted therapy drug that improves the treatment effect of tuberculosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120459329B_ABST
    Figure CN120459329B_ABST
Patent Text Reader

Abstract

The application discloses application of a METTL1 overexpression agent in preparation of an anti-mycobacterium tuberculosis drug, wherein the METTL1 overexpression agent is a METTL1 overexpression lentivirus, the sequence of the METTL1 overexpression lentivirus has a login number of NM_005371.6 in a NCBI database, and the anti-mycobacterium tuberculosis drug refers to a drug capable of improving the autophagy level of mycobacterium tuberculosis infected macrophages and enhancing the clearance capacity of the macrophages on intracellular mycobacterium tuberculosis. The METTL1 overexpression agent provided by the application can overexpress the METTL1 gene through cell experiments, and has remarkable effects in promoting the autophagy of mycobacterium tuberculosis infected macrophages and enhancing the bactericidal capacity and the like, thereby providing a new targeted therapeutic drug for clinical treatment of anti-mycobacterium tuberculosis infection.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the field of biotechnology, and particularly relates to application of a METTL1 overexpression agent in preparation of an anti-Mycobacterium tuberculosis drug. BACKGROUND

[0002] Tuberculosis is a chronic infectious disease caused by Mycobacterium tuberculosis (Mtb) infection, which still seriously endangers human health. According to the World Health Organization (WHO), the estimated global incidence of tuberculosis in 2023 was 10.8 million cases, the incidence rate was 134 / 100,000, and the number of deaths worldwide due to tuberculosis in 2023 was 1.25 million, tuberculosis returned to the top of the list of single infectious disease causes of death worldwide, and the number of deaths was almost twice that of HIV / AIDS. The estimated incidence of tuberculosis in China was 741,000 cases, the incidence rate was 52 / 100,000, and China ranked third among countries with high tuberculosis burden and was one of the countries with the most multidrug-resistant tuberculosis cases. At the same time, China has a large population of Mycobacterium tuberculosis latent infection (LTBI), and the estimated Mycobacterium tuberculosis latent infection rate of people aged 5 and above in China is 18.1%. Due to the special latent characteristics and the emergence and prevalence of drug-resistant tuberculosis, the prevention and control of tuberculosis is facing great challenges. Therefore, exploring new targets for anti-tuberculosis infection and developing new anti-tuberculosis drugs have become the most concerned issues.

[0003] Mycobacterium tuberculosis is a typical intracellular parasite that mainly parasitizes in macrophages after infecting the body. Macrophages are immune cells widely present in various tissues and body fluids of the human body, have strong phagocytic ability, and are the first line of defense against Mycobacterium tuberculosis invasion. On the one hand, after Mycobacterium tuberculosis infects macrophages, the proteins, phospholipids and other antigens of Mycobacterium tuberculosis are recognized by various receptors of macrophages, and the corresponding antibacterial response of macrophages is caused, such as autophagy, apoptosis, production of free radicals ROS, RNS and other reactions for clearance; on the other hand, Mycobacterium tuberculosis has evolved complex immune escape strategies to antagonize autophagic killing, such as after being phagocytosed into the phagosome of macrophages, Mycobacterium tuberculosis can successfully prevent the fusion of the phagosome and the lysosome, inhibit the maturation of the phagolysosome, and thus prevent itself from being degraded by the lysosome, and at the same time, the macrophage can be used as a shelter for Mycobacterium tuberculosis, so that Mycobacterium tuberculosis can be latent and even proliferate under certain conditions.

[0004] Studies have shown that autophagy plays an important role in the process of macrophages resisting Mycobacterium tuberculosis infection, and enhancing the autophagy of macrophages can reduce the survival rate of Mycobacterium tuberculosis in cells. The main mechanism may be that the activation of autophagy can increase the co-localization of autophagy proteins and phagosomes, promote the transformation of phagosomes containing Mycobacterium tuberculosis into mature phagolysosomes, and then promote the clearance of Mycobacterium tuberculosis in macrophages through the autolysosome pathway. Identifying and analyzing the functional genes related to the invasion of Mycobacterium tuberculosis into host macrophages, especially the genes regulating the autophagy of macrophages, can provide important target sites for the design and screening of anti-tuberculosis drugs.

[0005] N 7 - methylguanosine (N 7 -methylguanosine, m 7 G) is a ubiquitous and evolutionarily conserved RNA methylation modification. m 7 G widely affects mRNA stability, translation fidelity and non-coding RNA function by regulating RNA splicing, nuclear transport and translation initiation complex assembly. Methyltransferase-like 1 (METTL1) is a classic m 7 G methyltransferase that forms a stable methyltransferase complex with WDR4 and specifically catalyzes the methylation modification of guanosine N 7 site. Studies have shown that METTL1 can affect the mRNA stability and translation efficiency of target genes through the m 7 G modification pathway, regulate target gene expression, and play an important role in the occurrence and development of various human diseases including malignant tumors, cardiovascular diseases and infectious diseases. However, so far, there has been no public disclosure of the application of METTL1 gene in the treatment of tuberculosis. SUMMARY

[0006] In view of the problems existing in the prior art, the purpose of the present application is to provide the application of METTL1 overexpression agent in tuberculosis. The present inventors first found that METTL1 is significantly down-regulated in the peripheral blood mononuclear cells of patients with pulmonary tuberculosis. The present application designs and synthesizes a specific METTL1 overexpression agent by using lentiviral vector technology. The above-mentioned METTL1 overexpression agent can specifically promote the expression of METTL1, thereby promoting the autophagy level of Mycobacterium tuberculosis infected macrophages and enhancing the clearance of intracellular Mycobacterium tuberculosis by macrophages. The present application can be used for the development of tuberculosis treatment reagents by constructing METTL1 overexpression agent. METTL1 overexpression agent will play an important role in the field of tuberculosis gene therapy and molecular targeted therapy, and provide a new targeted therapeutic drug for the clinical treatment of tuberculosis.

[0007] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows.

[0008] A METTL1 overexpression agent is constructed by using a lentiviral vector and a METTL1 gene.

[0009] According to a first aspect of the present application, a METTL1 overexpression agent is provided, wherein the METTL1 overexpression agent is a lentivirus for overexpression of METTL1, and a sequence of the lentivirus for overexpression of METTL1 has an accession number of NM_005371.6 in a NCBI database.

[0010] In some embodiments, the METTL1 overexpression agent comprises a nucleotide sequence shown in SEQ ID NO. 1, and the sequence is as follows:

[0011] ATGGCAGCCGAGACTCGGAACGTGGCCGGAGCAGAGGCCCCACCGCCCCAGAAGCGCTACTACCGGCAACGTGCTCACTCCAACCCCATGGCGGACCACACGCTGCGCTACCCTGTGAAGCCAGAGGAGATGGACTGGTCTGAGCTATACCCAGAGTTCTTCGCTCCACTCACTCAAAATCAGAGCCACGATGACCCAAAGGATAAGAAAGAAAAGAGAGCTCAGGCCCAAGTGGAGTTTGCAGACATAGGCTGTGGCTATGGTGGCCTGTTAGTGGAACTGTCACCGCTGTTCCCAGACACACTTATTCTGGGTCTGGAGATCCGGGTGAAGGTCTCAGACTATGTACAAGACCGGATTCGGGCCCTACGCGCAGCTCCTGCAGGTGGCTTCCAGAACATCGCCTGTCTCCGTAGCAATGCCATGAAGCACCTTCCTAACTTCTTCTACAAGGGCCAGCTGACAAAGATGTTCTTCCTCTTCCCCGACCCACATTTCAAGCGGACAAAGCACAAGTGGCGAATCATCAGTCCCACCCTGCTAGCAGAATATGCCTACGTGCTAAGAGTTGGGGGGCTGGTGTATACCATAACCGATGTGCTGGAGCTACACGACTGGATGTGCACTCATTTCGAAGAGCACCCACTGTTTGAGCGTGTGCCTCTGGAGGACCTGAGTGAAGACCCCGTTGTGGGACATCTAGGCACCTCAACTGAGGAGGGGAAGAAAGTTCTACGTAATGGAGGGAAGAATTTCCCAGCCATCTTCCGAAGAATACAAGATCCCGTCCTCCAGGCAGTGACCTCCCAAACCAGCCTGCCTGGTCAC- (SEQ ID NO. 1)

[0012] According to a second aspect of the present application, there is provided a use of a METTL1 overexpression agent in the preparation of an anti-Mycobacterium tuberculosis drug.

[0013] In some embodiments, the anti-Mycobacterium tuberculosis drug refers to a drug capable of improving the autophagy level of Mycobacterium tuberculosis infected macrophages and enhancing the clearance ability of macrophages to intracellular Mycobacterium tuberculosis.

[0014] In some embodiments, the drug takes METTL1 overexpression agent as an active ingredient, and is prepared into a pharmaceutically acceptable dosage form with a pharmaceutically acceptable carrier.

[0015] In some embodiments, the carrier is solid, liquid or semi-solid.

[0016] In some embodiments, the dosage form includes tablets, capsules, injections and drops.

[0017] The present application has the following beneficial effects:

[0018] 1. The present application first proposes to develop a reagent targeting overexpression of METTL1 gene by using lentiviral vector technology, which can significantly promote the autophagy level of Mycobacterium tuberculosis infected macrophages and enhance the clearance of intracellular Mycobacterium tuberculosis by macrophages, and is a new type of targeted drug preparation for treating tuberculosis, which has significant specificity compared with traditional therapeutic drugs.

[0019] 2. The METTL1 overexpression agent provided by the present application is proved by experiments to effectively promote the expression of METTL1 gene, has significant effects in promoting the autophagy level of Mycobacterium tuberculosis infected macrophages and enhancing the clearance of intracellular Mycobacterium tuberculosis by macrophages, and plays a role in gene therapy for tuberculosis, thereby providing a new targeted therapeutic drug for the clinical treatment of tuberculosis. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following will briefly introduce the drawings needed to be used in the embodiments. It should be understood that the following drawings only show some embodiments of the present application, and therefore should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can also be obtained without creative labor on the basis of these drawings.

[0021] Figure 1 METTL1 expression levels in peripheral blood mononuclear cells (PBMC) of the pulmonary tuberculosis patient group and the healthy control group in Example 1 of the present application, wherein Figure A is the mRNA expression level of each group detected by RT-qPCR, and Figure B is the protein expression level of each group detected by Western blot;

[0022] Figure 2 METTL1 expression in macrophages in pulmonary tuberculosis granuloma and control lung tissue of the pulmonary tuberculosis patient in Example 1 of the present application;

[0023] Figure 3 The cell METTL1 expression of the THP-1 cell receiving the METTL1 overexpression agent treatment group (oe-METTL1) and the blank control group (oe-NC) in Example 2 of the present application is shown. Figure A is the RT-qPCR detection of the mRNA expression level of METTL1 in each group, and Figure B is the Western blot detection of the protein expression level of METTL1 in each group;

[0024] Figure 4 The Western blot detection of the influence of METTL1 on the autophagy function of macrophages after infection with Mycobacterium tuberculosis in Example 3 of the present application is shown.

[0025] Figure 5 The cell immunofluorescence detection of the influence of METTL1 on the autophagy function of macrophages after infection with Mycobacterium tuberculosis in Example 3 of the present application is shown.

[0026] Figure 6 The transmission electron microscope detection of the influence of METTL1 on the autophagy function of macrophages after infection with Mycobacterium tuberculosis in Example 3 of the present application is shown.

[0027] Figure 7 The colony forming unit (CFU) experiment detection of the influence of METTL1 on the clearance of intracellular Mycobacterium tuberculosis by macrophages in Example 3 of the present application is shown.

[0028] Figures 1-7 There is a statistically significant difference between each group. DETAILED DESCRIPTION

[0029] In order to make the purpose, technical scheme and advantages of the embodiments of the present application clearer, the technical scheme of the embodiments of the present application will be described clearly and completely below. If the specific conditions are not indicated in the embodiments, the conventional conditions or the conditions suggested by the manufacturer are used. If the manufacturers of the reagents or instruments are not indicated, the conventional products that can be purchased in the market are used.

[0030] The present application will be further described below in conjunction with the embodiments.

[0031] Example 1: METTL1 expression analysis of active tuberculosis patients

[0032] I. Subjects and methods

[0033] 1. Subjects: 53 patients with active pulmonary tuberculosis admitted to Jiangxi Chest Hospital and the First Affiliated Hospital of Nanchang University. The diagnosis of active pulmonary tuberculosis was based on the national health commission's diagnostic criteria for pulmonary tuberculosis (WS288-2017). All patients with active pulmonary tuberculosis did not receive any anti-tuberculosis treatment, and the mycobacterium tuberculosis liquid culture method and sputum smear acid-fast staining were positive. 50 healthy controls were recruited from the health management center of the First Affiliated Hospital of Nanchang University. The control group was matched by age (± 3 years), gender (1:1), and body mass index (± 10%). There were no abnormalities in chest X-ray and no recent contact with tuberculosis history. The T-SPOT test result was negative. All subjects were excluded from patients with tumor, hypertension, diabetes, autoimmune disease and taking immunosuppressive drugs; exclude HBV, HCV, HIV infection or (and) AIDS patients; exclude pregnant or lactating women.

[0034] 2. Methods

[0035] (1) Extraction of peripheral blood mononuclear cells (PBMC):

[0036] 5 mL of fasting venous blood was collected in the morning, and EDTA-K2 was used for anticoagulation. The anticoagulated blood was mixed with an equal amount of Hanks solution to obtain a mixture; another centrifuge tube was added with an equal amount of lymphocyte separation medium; the mixture was slowly added to the lymphocyte separation medium along the wall of the centrifuge tube with a pipette, and the liquid level was kept clear; 2000 rpm centrifugation for 20 min, carefully pipette the middle white membrane layer into a new centrifuge tube, add 5 times the volume of Hanks solution, centrifuge the cells twice at 1500 rpm for 10 min, remove the supernatant, add RPMI1640 containing 10% (v / v) fetal bovine serum, resuspend the cells, and take 10 μL for each sample for counting.

[0037] (2) Extraction of total RNA:

[0038] Trizol method was used to extract total RNA from peripheral blood mononuclear cells (PBMC) of the subjects: 500 μL of TRIzol lysis buffer was added to the extracted PBMC, and vortexed immediately; 200 μL of chloroform was added after 5 min, vortexed immediately, and stood for 10 min; centrifuged at 16000g for 20 min at 4°C; 450 μL of supernatant was added to 800 μL of isopropanol, gently inverted and mixed, and precipitated overnight; after centrifugation at 16000g for 20 min at 4°C, the supernatant was discarded, 1 mL of 75% ethanol was added and gently shaken, and then centrifuged at 16000g for 15 min at 4°C; the supernatant was discarded, 75% anhydrous ethanol (DEPC water) 500 μL was added, gently mixed, and centrifuged at 10000g for 5 min at 4°C; the supernatant was discarded, and the RNA was dissolved with 30 μL of DEPC water for standby.

[0039] (3) RT-qPCR detection of mRNA expression:

[0040] 1) The expression of METTL1 mRNA in each group was quantitatively detected by real-time fluorescence quantitative PCR method. The total RNA of PBMC from each group was extracted by Trizol method. The purity and concentration of total RNA were determined and stored for later use.

[0041] 2) Synthesis of template DNA (cDNA): The total RNA prepared was subjected to reverse transcription according to the instructions of Takara reverse transcription reaction kit. The amplification product was the template cDNA, which was stored at -20℃ for later use.

[0042] 3) SYBR Green RT-qPCR detection:

[0043] ① METTL1 primers and internal reference gene GAPDH primers were synthesized by Huada Gene Company and dissolved in nuclease-free water to 10 nmol / mL for later use;

[0044] ② The RT-qPCR reaction system was prepared according to the Takara fluorescence quantitative kit as follows:

[0045] Ingredients Amount SYBR® Premix Ex Taq™ II (2x) 10.0 μL Forward Primer (10 μM) 1.0 μL Reverse Primer (10 μM) 1.0 μL ROX Reference Dye (50x) 0.4 μL cDNA 2.0 μL ddH2O Add to 20 μL

[0046] ③ Reaction conditions: first 95℃ for 30s, then 95℃ for 5s, 60℃ for 34s for 40 cycles, and finally 95℃ for 15s, 60℃ for 60s, 95℃ for 15s;

[0047] ④ To reduce experimental errors, each sample was subjected to three repeated tests.

[0048] ⑤ Analysis results: the amplification effect was judged by combining the amplification curve and the melting curve, and the expression of the target gene was calculated by 2-ΔΔCt method.

[0049] (4) Western blot detection of protein expression: The cells in each group were collected, washed with PBS, and the total protein was extracted by RIPA lysis method. The total protein concentration was detected by BCA method. 40 μg of protein was dissolved in 6x SDS loading buffer, boiled at 100℃ for 10 min, and then the above samples were subjected to 10% SDS-PAGE gel electrophoresis. The protein was transferred to PVDF membrane by wet transfer method, 5% skimmed milk powder was blocked at room temperature for 2h, then the PVDF membrane was incubated with 1:1000 diluted primary antibody METTL1 and β-actin at 4℃ overnight, washed with TBST for 3 times, and then the membrane was incubated with 1:5000 diluted rabbit secondary antibody at room temperature for 1h. After washing with TBST, the developer was added and exposed to imaging by Bio-Rad image analysis system.

[0050] (5) Fluorescent immunohistochemistry was used to detect the expression of intracellular genes. The frozen sections were placed in the environmental-friendly dewaxing solution for 10 min, and then washed with anhydrous ethanol for 5 min for 3 times, and then washed with distilled water. After the sections were naturally cooled, the slides were placed in PBS, and the shaking table was shaken for 5 min, and repeated for 3 times. The sections were placed in 3% hydrogen peroxide solution, and incubated at room temperature for 25 min. The slides were placed in PBS, and the shaking table was shaken for 5 min, and repeated for 3 times. The sections were blocked with 3% BSA at room temperature for 30 min. The blocking solution was removed, and the diluted primary antibody was added to the sections, and the wet box was placed at 4°C overnight. After washing, the fluorescent secondary antibody was added and incubated at room temperature for 50 min (the above steps were repeated according to the number of multiple targets required). After DAPI incubation, the slides were sealed with a sealing agent, and the whole slide was scanned under a fluorescent confocal microscope.

[0051] II. Results

[0052] The applicant detected 53 cases of pulmonary tuberculosis patients (TB) and 50 cases of healthy people (HC) in peripheral blood PBMC samples, and the results showed that: the METTL1 in the PBMC of the pulmonary tuberculosis patient group was significantly down-regulated at the mRNA level compared with the healthy control group, and the difference was statistically significant (P<0.0001, Fig. A). The METTL1 in the peripheral blood PBMC of the pulmonary tuberculosis patient group was significantly down-regulated at the protein level compared with the healthy control group (P<0.0001, Fig. B). The expression of METTL1 in macrophages in the pulmonary tuberculosis granuloma and control lung tissue of the pulmonary tuberculosis patient was detected by fluorescent immunological technology. The results are shown in Fig. C, and the expression of METTL1 in macrophages in the pulmonary tuberculosis granuloma tissue is less than that in the control lung tissue. p <0.0001, Figure 1 A). The METTL1 in the peripheral blood PBMC of the pulmonary tuberculosis patient group was significantly down-regulated at the protein level compared with the healthy control group (P<0.0001, Fig. B). The expression of METTL1 in macrophages in the pulmonary tuberculosis granuloma and control lung tissue of the pulmonary tuberculosis patient was detected by fluorescent immunological technology. The results are shown in Fig. C, and the expression of METTL1 in macrophages in the pulmonary tuberculosis granuloma tissue is less than that in the control lung tissue. Figure 1 Figure 2 B). The expression of METTL1 in macrophages in the pulmonary tuberculosis granuloma and control lung tissue of the pulmonary tuberculosis patient was detected by fluorescent immunological technology. The results are shown in Fig. C, and the expression of METTL1 in macrophages in the pulmonary tuberculosis granuloma tissue is less than that in the control lung tissue.

[0053] Example 2: Design, preparation and verification of the METTL1 overexpression agent.

[0054] I. Methods

[0055] 1. Design the METTL1 overexpression agent. The CDS sequence of the METTL1 gene in the NCBI database was designed, and the target sequence was:

[0056] ​ATGGCAGCCGAGACTCGGAACGTGGCCGGAGCAGAGGCCCCACCGCCCCAGAAGCGCTACTACCGGCAACGTGCTCACTCCAACCCCATGGCGGACCACACGCTGCGCTACCCTGTGAAGCCAGAGGAGATGGACTGGTCTGAGCTATACCCAGAGTTCTTCGCTCCACTCACTCAAAATCAGAGCCACGATGACCCAAAGGATAAGAAAGAAAAGAGAGCTCAGGCCCAAGTGGAGTTTGCAGACATAGGCTGTGGCTATGGTGGCCTGTTAGTGGAACTGTCACCGCTGTTCCCAGACACACTTATTCTGGGTCTGGAGATCCGGGTGAAGGTCTCAGACTATGTACAAGACCGGATTCGGGCCCTACGCGCAGCTCCTGCAGGTGGCTTCCAGAACATCGCCTGTCTCCGTAGCAATGCCATGAAGCACCTTCCTAACTTCTTCTACAAGGGCCAGCTGACAAAGATGTTCTTCCTCTTCCCCGACCCACATTTCAAGCGGACAAAGCACAAGTGGCGAATCATCAGTCCCACCCTGCTAGCAGAATATGCCTACGTGCTAAGAGTTGGGGGGCTGGTGTATACCATAACCGATGTGCTGGAGCTACACGACTGGATGTGCACTCATTTCGAAGAGCACCCACTGTTTGAGCGTGTGCCTCTGGAGGACCTGAGTGAAGACCCCGTTGTGGGACATCTAGGCACCTCAACTGAGGAGGGGAAGAAAGTTCTACGTAATGGAGGGAAGAATTTCCCAGCCATCTTCCGAAGAATACAAGATCCCGTCCTCCAGGCAGTGACCTCCCAAACCAGCCTGCCTGGTCAC- (SEQ ID NO. 1)

[0057] Based on the above purpose sequence, a plasmid for targeting overexpression of METTL1 gene expression is synthesized, and further packaged into oe-METTL1 lentivirus form for cell, animal and treatment experiments, etc.

[0058] 2. Lentiviral transfection of cells to overexpress METTL1. THP-1 cells were cultured in complete medium with 10% serum at 37°C in a 5% CO2 incubator. Cells in the logarithmic growth phase were harvested, replaced with serum-free medium, and resuspended to a concentration of 10⁻⁶ cells / mL. 5 Cells were cultured at oe-METTL1 lentivirus / mL at the required MOI, and the culture medium was changed to terminate the transfection after 24 h. Cells transfected with oe-METTL1 lentivirus were named the oe-METTL1 experimental group, and cells treated with empty vector lentivirus were named the oe-NC blank control group.

[0059] 3. RT-qRCR was used to detect the mRNA expression level of the METTL1 gene in each group of cells, as described above.

[0060] 4. Western Blot was used to detect the expression level of the METTL1 gene protein in each group of cells, as described above.

[0061] II. Results

[0062] The results showed that the expression level of METTL1 mRNA in the oe-METTL1 group was significantly higher than that in the oe-NC group. p =0.0004, Figure 3 A); The expression level of METTL1 protein in cells of the oe-METTL1 group was significantly higher than that in the oe-NC group (A); Figure 3 B).

[0063] Example 3: Effects of METTL1 on autophagy and bactericidal function of human macrophages infected with Mycobacterium tuberculosis

[0064] I. Methods

[0065] 1. Establishment of an in vitro infection model of Mycobacterium tuberculosis

[0066] (1) Macrophage activation: Take THP-1 cells in the logarithmic growth phase, centrifuge to remove the supernatant, resuspend the cells in THP-1 complete culture medium, and then add THP-1 at 6×10⁻⁶. 5 Inoculate 1 sample per well into 25mm culture dishes, spread in parallel to 4 dishes, add PMA (50ng / mL) and gently mix. Incubate at 37℃ in a 5% CO2 incubator for 24 hours. Replace the culture medium and continue incubation for another 24 hours.

[0067] (2) Establishment of in vitro infection models with different MOIs: Mycobacterium tuberculosis H37Ra suspension was added to activated THP-1 macrophages with MOIs of 0, 1, 5 and 10, and the cells were cultured at 37°C in a 5% CO2 incubator for 4 h. The old culture medium was discarded, the cells were washed three times with 1×PBS, and fresh THP-1 macrophage complete culture medium was added and the cells were cultured for another 24 h. Cell RNA and protein were collected.

[0068] (3) Establishing in vitro model at different time periods after infection: Add H37Ra suspension to activated THP-1 macrophages at MOI = 10, and culture for 4 h in a 37°C, 5% CO2 incubator. Discard the old culture medium, wash the cells with 1x PBS for 3 times, add fresh THP-1 macrophage complete culture medium, and continue to culture for 0 h, 4 h, 24 h, 48 h, 72 h, collect cell RNA and protein.

[0069] 2. Colony forming unit (CFU) detection

[0070] The above-processed THP-1 macrophages are lysed with 0.03% SDS, and then the lysate is diluted by a factor of 2. 100 μL of the diluted bacterial solution is inoculated on a 7H10 agar plate, and the results are observed after 3-4 weeks of culture in a 37°C, 5% CO2 incubator, and colony counting is performed.

[0071] 3. Detection of macrophage autophagy index

[0072] The above-mentioned macrophages are taken, and the expression level of autophagy marker LC3B is detected by Western blot, as described above.

[0073] The above-mentioned macrophages are taken, and the expression level of autophagy marker LC3B is detected by cell immunofluorescence, as described above.

[0074] 4. Transmission electron microscope detection of autophagy level

[0075] Centrifugal collection of cells, 2.5% glutaraldehyde solution fixation overnight, PBS washing 3 times, 15 min each time, then using 1% agarose solution to embed cell precipitate, 1% osmium acid fixation of cells for 3 h at room temperature in the dark, PBS washing 3 times, 15 min each time, sequentially placed into 50% ethanol-70% ethanol-90% ethanol-90% acetone (1:1) for 15 min of dehydration, mixed solution of pure acetone and embedding liquid at a ratio of 2:1 was used for room temperature embedding for 3 h, then changed to a mixed solution with a ratio of 1:2, and continued to embed at room temperature overnight, finally, pure embedding liquid was used for embedding at room temperature for 3 h, and sequentially solidified in an oven at 37°C, 45°C and 60°C overnight, 12 h and 48 h, respectively. After slicing and sectioning, 3% uranyl acetate was used for staining in saturated ethanol for 8 min in the dark, 70% ethanol was used for washing 3 times, ddH2O was used for washing 3 times, 2.6% lead citrate solution was used for CO2-free staining for 8 min, and finally ddH2O was used for washing 3 times, dried at room temperature overnight, and then autophagosomes and autolysosomes were observed under a transmission electron microscope.

[0076] II. Results

[0077] LC3B is a marker of autophagy process, monitoring the expression level of LC3B can understand the development and change of autophagy of the body, the influence of METTL1 on autophagy function of macrophages after infection with Mycobacterium tuberculosis. The results of Western blot detection of LC3B protein show that when not infected with Mycobacterium tuberculosis (CON), the LC3B protein level of the overexpression METTL1 gene (oe-METTL1) group is significantly higher than that of the oe-NC group; after infection with Mycobacterium tuberculosis (24h), the LC3B protein expression levels of the oe-METTL1 group and the oe-NC group are further increased, and the LC3B expression level of the oe-METTL1 group is significantly higher than that of the oe-NC group Figure 4 ); the applicant of the present application found that Mycobacterium tuberculosis infection can reduce the expression level of METTL1 of macrophages, and high expression of METTL1 can promote autophagy of macrophages after infection with Mycobacterium tuberculosis, and low expression of METTL1 inhibits autophagy of macrophages after infection with Mycobacterium tuberculosis Figure 4 .

[0078] The THP-1 macrophage oe-METTL1 stably overexpressing METTL1 gene and the control stable strain oe-NC were used to construct a Mycobacterium tuberculosis in vitro infection macrophage model, and the generation of LC3B was further detected by cell immunofluorescence method. The results show that after infection with Mycobacterium tuberculosis, the LC3B protein level of the oe-METTL1 group is accumulated more than that of the oe-NC group p =0.0009, Figure 5 ), indicating that overexpression of METTL1 can promote autophagy of macrophages after infection with Mycobacterium tuberculosis.

[0079] Transmission electron microscopy is the gold standard for monitoring autophagy process, using THP-1 macrophage oe-METTL1 stably overexpressing METTL1 gene and control stable strain oe-NC to construct a Mycobacterium tuberculosis in vitro infection macrophage model, and transmission electron microscopy was used to detect the autophagy level of macrophages. The results show that after infection with Mycobacterium tuberculosis, the autophagy small topic and autolysosome of the oe-METTL1 group are accumulated more than those of the oe-NC group Figure 6 ), indicating that overexpression of METTL1 can promote autophagy of macrophages after infection with Mycobacterium tuberculosis.

[0080] In the above experiment, the present applicant found that overexpression of METTL1 promoted autophagy of macrophages after infection with Mycobacterium tuberculosis. Therefore, the present applicant constructed a Mycobacterium tuberculosis in vitro infection macrophage model using oe-METTL1 stable strains and control stable strains oe-NC, and collected cell lysates of uninfected and 48 h post-infection cells for plating culture. The results showed that the number of viable bacteria in the oe-METTL1 group was significantly lower than that in the oe-NC group as the post-infection time period was prolonged p = 0.0015, Figure 7 ), indicating that overexpression of METTL1 enhanced the clearance of intracellular Mycobacterium tuberculosis in macrophages and promoted the bactericidal activity of macrophages.

[0081] The above only describes some embodiments of the present application, and those of ordinary skill in the art can make several modifications and improvements without departing from the inventive concept, and these all belong to the protection scope of the present application.

Claims

1. The application of METTL1 overexpression agents in the preparation of anti-tuberculosis drugs, characterized in that, The METTL1 overexpression agent is a lentivirus that overexpresses METTL1, and the CDS sequence of the METTL1 gene has the accession number NM_005371.6 in the NCBI database.

2. The application according to claim 1, characterized in that, The aforementioned anti-tuberculosis drug refers to a drug that can increase the autophagy level of macrophages infected with Mycobacterium tuberculosis and enhance the ability of macrophages to clear intracellular Mycobacterium tuberculosis.

3. The application according to claim 1, characterized in that, The drug uses a METTL1 overexpression agent as the active ingredient and is formulated into a pharmaceutically acceptable dosage form using a pharmaceutically acceptable carrier.

4. The application according to claim 3, characterized in that, The carrier can be solid, liquid, or semi-solid.

5. The application according to claim 3, characterized in that, The dosage forms include tablets, capsules, injections, and drops.