A strain of high-efficiency degrading fungus trichoderma harzianum ts7-1 and its application

Abstract

The application discloses a strain of macrolide antibiotic high-efficiency degradation fungus Trichoderma asperellum TS7-1 and application thereof, and belongs to the technical field of microorganisms. The preservation number of the Trichoderma asperellum TS7-1 is CGMCC No.41372. The strain Trichoderma asperellum TS7-1 (CGMCC No.41372) provided by the application has high-efficiency degradation capacity for various macrolide antibiotics (erythromycin, roxithromycin and azithromycin), and the removal rates of the three antibiotics are all above 85% within 36 hours. The high-concentration antibiotic tolerance, degradation rate and degradation spectrum of the Trichoderma asperellum TS7-1 are obviously superior to those of other strains in the prior art. The Trichoderma asperellum TS7-1 is directly separated from a natural soil body without antibiotic pollution, has no hidden danger of animal and plant pathogenicity, and has no microbial toxicity to degradation products of the macrolide antibiotics, so that secondary pollution is avoided, and excellent environmental safety is achieved.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a macrolide antibiotic-efficient fungus, Trichoderma TS7-1, and its applications. Background Technology

[0002] Macrolide antibiotics (such as erythromycin, roxithromycin, and azithromycin) are widely used antibacterial drugs in clinical practice and animal husbandry. However, tens of thousands of tons of macrolide antibiotics enter the environment annually through various pathways, including pharmaceutical wastewater, waste residue, medical wastewater, livestock and poultry wastewater, and agricultural runoff, causing widespread water and soil pollution. Residual antibiotics in the environment not only exhibit significant ecotoxicity to aquatic organisms and soil microorganisms, but more seriously, even at low concentrations, these residual antibiotics can act as selective pressure, inducing and accelerating the generation, horizontal transfer, and spread of antibiotic resistance genes (ARGs) in the environment, leading to a rapid increase in resistant bacteria. These resistant bacteria can then enter the human body through the food chain and drinking water, threatening human health.

[0003] Existing antibiotic pollution control technologies, such as physicochemical methods like adsorption, advanced oxidation, and membrane separation, as well as traditional biological treatment methods like activated sludge and biofilms, can remove antibiotics to some extent, but they generally suffer from problems such as high cost, easy generation of secondary pollution, limited degradation efficiency, and sensitivity to environmental conditions, making it difficult to meet increasingly stringent environmental protection requirements and the needs of sustainable development.

[0004] In contrast, utilizing the metabolic capabilities of microorganisms to degrade antibiotics offers advantages such as environmental friendliness, low cost, and the ability to achieve complete detoxification and mineralization, making it a highly promising technology for antibiotic pollution control. However, currently reported macrolide-degrading strains generally suffer from narrow degradation spectra, low degradation rates, and poor environmental adaptability. Some degrading bacteria even carry large amounts of antibiotic resistance genes and have potential pathogenicity, severely limiting their effectiveness in practical pollution control. Therefore, screening for highly efficient antibiotic-degrading strains with broad degradation spectra, high safety, strong adaptability, genetic stability, and ease of engineering application is crucial for the resource utilization of antibiotic pollutants and waste, and is of great significance for source control and end-of-pipe prevention of macrolide antibiotic pollution. Summary of the Invention

[0005] The purpose of this invention is to provide a highly efficient macrolide antibiotic degrading fungus, *Trichoderma echinococcus* TS7-1, and its application, in order to solve the problems existing in the prior art. The *Trichoderma echinococcus* TS7-1 (CGMCC No. 41372) provided by this invention has a highly efficient degradation ability against a variety of macrolide antibiotics (erythromycin, roxithromycin, and azithromycin). The removal rate of the three antibiotics reaches more than 85% within 36 hours. Its high-concentration antibiotic tolerance, degradation rate, and degradation spectrum are significantly better than other strains in the prior art.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a strain of Trichoderma asperellum TS7-1, which has the accession number CGMCC No.41372, the accession date of June 17, 2024, and the depositary institution is the China General Microbiological Culture Collection Center, located at the Institute of Microbiology, Chinese Academy of Sciences, Beijing.

[0008] The present invention also provides the application of the aforementioned Trichoderma TS7-1 or its fermentation broth in the degradation of macrolide antibiotics.

[0009] The present invention also provides the application of the aforementioned Trichoderma TS7-1 or its fermentation broth in the preparation of bacterial agents that degrade macrolide antibiotics.

[0010] Optionally, the macrolide antibiotics include erythromycin, azithromycin, or roxithromycin.

[0011] Optionally, the concentration of the fermentation broth is 1×10⁻⁶. 7 Spores / mL.

[0012] The present invention also provides a bacterial agent for degrading macrolide antibiotics, including the aforementioned Trichoderma TS7-1 or its fermentation broth.

[0013] The present invention also provides a method for degrading macrolide antibiotics, comprising the step of culturing Trichoderma TS7-1 or its fermentation broth in an environment containing macrolide antibiotics.

[0014] Optionally, the macrolide antibiotics include erythromycin, azithromycin, or roxithromycin.

[0015] The present invention also provides the application of the aforementioned Trichoderma TS7-1 or its fermentation broth or the aforementioned inoculum in the degradation of erythromycin contained in the fermentation residue of erythromycin.

[0016] The present invention discloses the following technical effects:

[0017] The *Trichoderma echinococcosis* TS7-1 (CGMCC No. 41372) provided by this invention has a high efficiency in degrading various macrolide antibiotics (erythromycin, roxithromycin, and azithromycin). Within 36 hours, the removal rate of the three antibiotics reaches more than 85%. Its resistance to high concentration antibiotics, degradation rate, and degradation spectrum are significantly better than those of the published patented strains *Staphylococcus aureus* X9 (patent CN119506143), salt-tolerant rhizobium IURM F69 (patent CN113462592), *Bacillus sicca* IURM E94 (patent CN113416671), *Bordezoella bortezii* IURM F57 (patent CN114231430), and the compound bacterial agent composed of *Delftia deltaenoides* Ery-6A and *Indole-producing Chlorella* Ery-6B (patent CN112760262).

[0018] The Trichoderma TS7-1 of this invention is directly isolated from natural soil that is not contaminated with antibiotics, posing no risk of pathogenicity to animals or plants, and has no microbial toxicity to the degradation products of macrolide antibiotics, thus avoiding secondary pollution and exhibiting excellent environmental safety.

[0019] Strain TS7-1 was tested at 28℃, pH 7-8, and HPO4. 2- At a concentration of 7.0 mmol / L, with the addition of 1 g / L starch as a supplementary carbon source, the fungal TS7-1 achieved a maximum 24-hour removal rate of 92.2% for 100 mg / L erythromycin.

[0020] Strain TS7-1 grows rapidly, is highly adaptable to pH and temperature, can tolerate high concentrations of erythromycin, and still maintains high erythromycin removal efficiency even under the interference of external organic nutrients, demonstrating extremely strong environmental adaptability.

[0021] Strain TS7-1 can utilize antibiotics as a carbon source for metabolic growth, exhibits good environmental adaptability, and is suitable for antibiotic pollution control under different environmental conditions.

[0022] Strain TS7-1 significantly enhanced the high-efficiency removal performance of erythromycin in erythromycin residue mixed with straw powder compost. After 7 days of fermentation of erythromycin residue mixed with straw in a 1:1 ratio, the residual concentration of erythromycin rapidly decreased to 4.4 mg / L, with a removal rate of 97.1%, laying a solid foundation for the rapid detoxification of erythromycin residue and the resource utilization of organic fertilizer fermentation. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 The changes in erythromycin removal rate (A) and antibacterial activity of degradation products of strain TS7-1 are shown in Figure B.

[0025] Figure 2 The removal efficiency (A) and antibacterial activity (B) of TS7-1 strain against erythromycin (ERY), roxithromycin (ROX) and azithromycin (AZI) were evaluated.

[0026] Figure 3 The incubation temperature (A), initial pH (B), initial erythromycin concentration (C), and HPO4 were set as follows: 2- Effects of concentration (D), different carbon sources (E) and nitrogen sources (F) on erythromycin removal and mycelial growth of strain TS7-1;

[0027] Figure 4 Morphological characteristics (A) and aerial hyphae, conidiophores and conidia (BC) of strain TS7-1 on PDA medium;

[0028] Figure 5 A phylogenetic tree of NJ constructed based on ITS sequences;

[0029] Figure 6 The changes in erythromycin residual concentration (A) and removal rate (B) are shown. Detailed Implementation

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0032] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0033] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0034] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0035] Example 1: Isolation and screening of erythromycin-degrading fungi

[0036] (1) Preparation of isolation culture medium

[0037] Solid basic salt medium MSM (NaCl 1g, NH4Cl 1g, K2HPO4 1.5g, KH2PO4 0.5g, MgSO4·7H2O 0.2g, agar 15g, water 1000mL, pH 7.0) was dispensed into Erlenmeyer flasks, 100mL per flask. After sterilization, the medium was cooled to approximately 60°C. 0.01g of erythromycin powder was added to the medium and rapidly shaken to dissolve it completely. The solution was then poured into 9cm Petri dishes to prepare MSM plates containing 100mg / L erythromycin.

[0038] (2) Isolation and screening of erythromycin-degrading bacteria

[0039] Collect 5g (or 5mL) of samples from environmental samples such as forest humus layer soil, erythromycin fermentation solid bacterial residue, landfill leachate, activated sludge from sewage treatment plants, and solid manure from livestock farms. Add 45mL of sterile water and shake on a shaker at 150rpm for 30 minutes to prepare a suspension. Then, perform serial dilutions (10... -2 ~10 -6 100 μL of the diluted solution was spread onto an MSM plate containing 1000 mg / L erythromycin, with each dilution repeated twice. The plates were incubated at 30°C in the dark. When colonies reached 1–2 mm in length, a single colony was picked and inoculated onto a 6 mm diameter MSM agar block containing 100 mg / L erythromycin. The block was then incubated at 30°C in the dark for 24 hours. The incubated agar block was then placed on a plate coated with erythromycin-sensitive Bacillus velezensis L0517 (isolated from healthy leaves of Illicium verum, provided by the Basic Biology Experiment Center of Liupanshui Normal University), and incubated at 30°C in the dark for 12 hours. The width of the inhibition zone (mm) around the agar block was measured, and the relative removal rate of erythromycin was calculated. Relative removal rate = (D0 - D...) i) / D0×100, where D0 is the width of the inhibition zone of the uninoculated erythromycin agar block - 6mm, D i The width of the inhibition zone for each strain is -6mm.

[0040] (3) Secondary screening of erythromycin-degrading bacteria

[0041] The initially screened strains were inoculated onto PDA plates for purification culture. After sporulation, the strains were eluted with a small amount of sterile 2% Tween-80 solution and transferred to potato dextrose liquid (PD) medium. The spore density in the medium was adjusted to reach 102 by adjusting the amount of elution buffer. 7 The bacterial culture was prepared by shaking at 30℃ and 200 rpm for 18 h to obtain a seed culture. 0.5 mL of the seed culture was inoculated into MSM liquid medium containing 100 mg / L erythromycin and cultured at 30℃ and 200 rpm in the dark with shaking. Samples were taken every 12 h to determine the bacterial biomass (mg / DW), erythromycin removal rate (%), and the antibacterial activity of degradation products.

[0042] (4) Determination of biomass of degrading bacteria

[0043] Take 10 mL of thoroughly mixed culture medium, centrifuge at 8000 rpm for 10 minutes, and then remove the supernatant. Resuspend the precipitated mycelium in 5 mL of sterile water. Dry a 7 cm diameter circular filter paper to constant weight and weigh it (m). p Subsequently, the mycelial suspension was filtered through filter paper of known mass, and residual mycelia were rinsed off the centrifuge tube walls with sterile water and filtered together. The filter paper with mycelia attached was dried at 60°C to constant weight, and the total mass (m) was weighed. t The dry biomass of degrading bacteria, mf (mg·DW), is equal to m t -m p .

[0044] (5) Erythromycin removal rate determination

[0045] Erythromycin concentration was determined and analyzed using an AB TripleTOF 5600 LC-MS / MS system (AB SCIEX, USA). The chromatographic column was an XBridge HBE C18 column (2.1 × 100 mm, 2.5 μm, Ireland). The mobile phase was 0.1% formic acid solution (phase A) and acetonitrile (phase B). The injection volume was 1.0 μL, the flow rate was 0.3 mL / min, and the column temperature was 30 °C. Gradient elution was used: 0–1 min, 95% phase A; 1–10 min, 85% phase A; 10–11 min, 45% phase A; 11–13 min, 5% phase A; 13–16 min, 95% phase A. Electrospray ionization (ESI+) was used for mass spectrometry analysis, with the following parameters: capillary temperature 220 ± 1 °C, positive ion spray voltage 4000 V, and nebulizer gas (N2) flow rate 8.0 L / min. The mass spectrometry scanning range was set to 50-1000 m / z. The detection limit for erythromycin (ERY) was 50 μg / L (signal-to-noise ratio S / N ≥ 3). A standard curve was established using erythromycin standards, and the concentration of erythromycin in the culture medium of each bacterial strain was calculated based on the standard curve (C0). i Using the erythromycin concentration (C0) in the culture medium of uninoculated strains as a control, the erythromycin removal rate was calculated as follows: Removal rate (%) = 1 - (C0) / (C0) i / C0)×100.

[0046] (6) Determination of antibacterial activity of erythromycin degradation products

[0047] The bioactivity of the degradation products of the strain was assessed using the antimicrobial susceptibility testing disc method. Erythromycin-sensitive *Bacillus belye* L0517 was evenly spread on an LB agar plate, and sterile, dry, circular antimicrobial susceptibility testing discs (6 mm in diameter) were placed at 25 mm intervals on the plate surface. After sterilization by filtration through a 0.22 μm sterile filter, 50 μL of the test culture was added dropwise to the antimicrobial susceptibility testing discs. The plates were incubated at 30°C in the dark for 12 h, and the size (mm) of the inhibition zone around the antimicrobial susceptibility testing discs was observed and measured.

[0048] The results showed that among the fungi isolated from the five environmental samples, six strains achieved a relative removal rate of over 50% for 100 mg / L erythromycin after 24 hours of culture. Among them, strain TS7-1 performed the best, with a relative removal rate as high as 81.0% (Table 1).

[0049] Table 1. Relative removal rate of erythromycin by the initial screening strains.

[0050]

[0051] Strains TS7-1 were inoculated into MSM liquid medium containing 100 mg / L erythromycin. Samples were taken every 12 h, and the concentration of erythromycin was detected using a high-performance liquid chromatography-time-of-flight mass spectrometry (HPLC-TOF-MS) system. The antibacterial activity of degradation products was evaluated using the disk diffusion method. The results showed that strain TS7-1 achieved 87.8% and 98.7% removal rates of erythromycin at 24 h and 36 h, respectively, and reached 100% at 48 h. Meanwhile, compared with ERY(0) without erythromycin, the biomass of strain ERY-100, with 100 mg / L erythromycin as the sole carbon source, continuously increased during culture, reaching a peak at 36 h. Figure 1 (A) indicates that strain TS7-1 can grow using erythromycin as the sole carbon source. With the continuous degradation of erythromycin, the antibacterial activity of the culture medium significantly decreased; at 24 h, the inhibition zone width was close to 0 mm, and after 36 h, erythromycin was completely inactivated. Figure 1 (B). This indicates that strain TS7-1 can completely metabolize erythromycin, thus eliminating its microbial toxicity.

[0052] Example 2: Determination of the degradation activity of strain TS7-1 against other macrolide antibiotics

[0053] 0.5 mL of TS7-1 seed culture was inoculated into 10 mL of MSM liquid medium containing 100 mg / L azithromycin (AZI) and roxithromycin (ROX), respectively, and cultured at 30 °C with shaking at 200 rpm. Residual concentrations of azithromycin and roxithromycin were measured every 12 h, and the antibacterial activity of the degradation products after 24 h was determined using the antimicrobial susceptibility testing disk assay.

[0054] The results showed that strain TS7-1 also exhibited highly efficient degradation capabilities against two other macrolide antibiotics, azithromycin and roxithromycin. After 24 hours of culture, the removal rates of azithromycin and roxithromycin reached 93.2% and 73.2%, respectively, and further increased to 99.3% and 85.2% after 36 hours. Figure 2 In strain A), the degradation rate order was: azithromycin > erythromycin > roxithromycin. Furthermore, the antibacterial activity of strain TS7-1 against the degradation products of azithromycin and roxithromycin also decreased rapidly after 24 hours of treatment, demonstrating a significant detoxification effect. Figure 2 (B)

[0055] Example 3: Effects of culture conditions on erythromycin removal and growth of strain TS7-1

[0056] To optimize the erythromycin degradation efficiency of strain TS7-1, the effects of factors such as culture temperature, initial pH, initial erythromycin concentration, carbon source, and nitrogen source were systematically investigated.

[0057] (1) Incubation temperature

[0058] TS7-1 seed culture was inoculated into MSM liquid medium containing 100 mg / L erythromycin, and the culture was carried out with temperature gradients (20, 25, 28, 30, 32, 35, 40 °C) and shaken at 200 rpm for 24 h. The biomass of the strain and the erythromycin removal rate were then measured.

[0059] (2) Initial pH value

[0060] The pH of the MSM liquid medium containing 100 mg / L erythromycin was adjusted to 3-10 using 1.0 mol / L NaOH or HCl. The culture was then incubated at the optimal temperature (determined by (1)) with shaking at 200 rpm for 24 h. The biomass of the strain and the erythromycin removal rate were then determined.

[0061] (3) Initial concentration of erythromycin

[0062] Different concentrations of erythromycin (1, 5, 10, 25, 50, 100, 200 mg / L) were added to MSM medium, the pH was adjusted to the optimal value (determined by (2)), and the culture was carried out at the optimal temperature with shaking at 200 rpm for 24 h. The biomass of the strain and the erythromycin removal rate were then measured.

[0063] (4)HPO4 2- concentration

[0064] The concentration of K2HPO4 in the MSM medium was set to 0, 1, 3, 5, 7, 9 and 11 mmol / L, respectively, and the pH value was adjusted to the optimal value (determined by (2)). After sterilization and cooling, erythromycin was added to a concentration of 100 mg / L. After inoculation, the culture was shaken at 200 rpm for 24 h at the optimal temperature, and the biomass of the strain and the removal rate of erythromycin were measured.

[0065] (5) Carbon and nitrogen sources

[0066] Different carbon sources (sodium acetate, glucose, sucrose, starch, cellulose) or nitrogen sources (urea, KNO3, peptone) were added to MSM medium containing 100 mg / L erythromycin, with the control group having no added carbon source. The pH was adjusted to the optimal value, and the culture was carried out at the optimal temperature with shaking at 200 rpm for 24 h. The biomass and erythromycin removal rate of the strain were then measured.

[0067] The results showed that culture temperature and initial pH significantly affected the degradation and growth of erythromycin by strain TS7-1. Under conditions of 25–32℃ and pH 6–8, strain TS7-1 exhibited high removal rates of erythromycin, especially at 28℃ and pH 7–8, where the removal rate reached a maximum of 88.5% after 24 hours. Figure 3 (AB). This indicates that strain TS7-1 has a wide range of adaptability to temperature and pH values.

[0068] The initial erythromycin concentration had a significant effect on the degradation ability of strain TS7-1. Figure 3 (C). Initially, low concentrations of erythromycin (<10 mg / L) resulted in low removal rates, while higher concentrations led to higher removal rates, indicating that the strain's erythromycin degradation function requires a certain concentration of erythromycin for induction. Within the range of 25–100 mg / L, as the erythromycin concentration increased, the strain's biomass increased, and the erythromycin removal rate remained at a high level of 84.8%–92.5%. However, at 200 mg / L, both the strain's growth and degradation abilities decreased, indicating that the strain can tolerate high concentrations of erythromycin. (In HPO4) 2- Within a concentration range of 7.0 mmol / L, the removal rate and biomass of erythromycin increased rapidly with increasing concentration, and then decreased with increasing HPO4 concentration. 2- The removal rate and biomass of erythromycin decreased with increasing concentration, indicating that the optimal K2HPO4 concentration in the culture medium was 7.0 mmol / L. Figure 3 (D).

[0069] Carbon and nitrogen sources also significantly affected the growth of strain TS7-1 and the degradation of erythromycin. The addition of sucrose, glucose, and starch all improved strain growth and erythromycin removal rates, with the highest removal rate reaching 92.2% in the starch-treated strain. Figure 3 (E). The addition of a nitrogen source is crucial for strain growth and erythromycin degradation, with the addition of peptone significantly improving strain growth and erythromycin removal rate. Figure 3 (F). This indicates that strain TS7-1 has high erythromycin removal efficiency in eutrophic environments and is suitable for treating wastewater or bacterial residue rich in carbon and nitrogen sources.

[0070] In summary, strain TS7-1 thrives at 28℃, pH 7–8, and HPO4. 2- At a concentration of 7.0 mmol / L, with the addition of 1 g / L starch as a supplementary carbon source, strain TS7-1 achieved a 24-hour degradation rate of up to 92.2% for 100 mg / L erythromycin. This bacterium exhibits strong tolerance to high concentrations of erythromycin and demonstrates even higher erythromycin removal efficiency under conditions of added organic nutrients, indicating that it can be used for the efficient removal of macrolide antibiotics from eutrophic water bodies or waste.

[0071] Example 4: Identification of strain TS7-1

[0072] 1. Morphological identification

[0073] Strains TS7-1 were inoculated onto PDA plates and cultured in a 28°C incubator for 48 hours. A small amount of mycelium was taken, stained with lactophenol blue, and then observed and photographed under an optical microscope to capture the morphological characteristics of the strain, while also measuring its size.

[0074] The results showed that strain TS7-1 grew rapidly on PDA medium, with a colony expansion rate of 3.45 cm / day. Initially, the mycelium was white with well-developed aerial hyphae, spreading rapidly radially across the medium surface. After 3 days of culture, numerous dense, granular sporulation structures appeared on the colony surface, turning pale green, and the sporulation areas showed concentric rings. Figure 4 (A). Conidiophores are whorled, with ampoule-shaped pedicels arranged in whorls, swollen at the base and tapering to a point, measuring 6.45–15.23 μm in length and 2.50–5.25 μm in width. Figure 4 (Medium BC). Conidia are solitary, spherical or oval, measuring 1.95–4.52 μm × 1.86–3.55 μm. Strain TS7-1 exhibits typical characteristics of Trichoderma fungi.

[0075] 2. Molecular biological identification

[0076] Genomic DNA was extracted from strain TS7-1 using a modified CTAB method. Using the extracted DNA as a template, the fungal internal transcribed spacer (ITS) sequence was amplified using ITS3F / ITS4R primers. The primer sequences are as follows.

[0077] ITS3F: GCATCGATGAAGAACGCAGC (SEQ ID NO. 2);

[0078] ITS4R:TCCTCCGCTTATTGATATGC (SEQ ID NO. 3).

[0079] The ITS sequence (nucleotide sequence as shown in SEQ ID NO.1) of strain TS7-1 was entered into GenBank's BLATS database for homology comparison. ITS sequences of 19 type strains or recognized strains were downloaded. Using Protocrea farinosa CBS121551 as the peripheral group strain, a NJ developmental tree was constructed using MEAG 11 software as shown below. Figure 5 As shown in the figure. The results showed that strain TS7-1 clustered with *Trichoderma asperellum* with 100% support. Based on morphological characteristics and molecular biological analysis, strain TS7-1 was identified as *Trichoderma asperellum*.

[0080] SEQ ID NO.1:

[0081] .

[0082] The strain was identified as Trichoderma asperellum TS7-1 and taxonomically named Trichoderma asperellum. It was deposited on June 17, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41372, located at the Institute of Microbiology, Chinese Academy of Sciences, Beijing.

[0083] Example 6: Effect of strain TS7-1 on the removal of erythromycin from erythromycin fermentation residue

[0084] The erythromycin fermentation residue was provided by a pharmaceutical company in Hubei Province. The fermentation residue is slurry-like and characterized by high water content, high total organic carbon (TOC), high nitrogen content, high viscosity, and a strong odor. Before inoculating with strain TS7-1, the residue was mixed with straw powder to adjust the carbon-to-nitrogen ratio (C / N), facilitating subsequent fermentation and erythromycin removal.

[0085] (1) Analysis of the components of erythromycin bacterial residue

[0086] The moisture content (%) of the fungal residue was determined by drying, total nitrogen (TN) was determined by the Kjeldahl method, and total organic carbon (TOC) was determined by a total organic carbon analyzer. The carbon-to-nitrogen ratio (C / N) was calculated from the ratio of TOC to TN. The fungal residue contains high concentrations of soluble proteins and sugars, requiring strict pretreatment before analysis; otherwise, it will interfere with mass spectrometry detection. A small amount of fungal residue was centrifuged at 10,000 rpm for 5 minutes, and the supernatant was collected. 0.8 mL of a methanol / acetonitrile (1:1, v / v) mixture was added to 0.2 mL of the supernatant, vortexed for 30 s, sonicated for 10 min, and then incubated at -20℃ for 2 h. The residue was then centrifuged at 13,000 rpm for 15 min. The supernatant was collected and dried by nitrogen blowing. 0.2 mL of 50% acetonitrile aqueous solution was added for complete reconstitution. The mixture was vortexed for 30 s and sonicated for 10 min. The mixture was centrifuged at 13,000 rpm for 15 min. The supernatant was filtered through a 0.22 μm filter membrane and the erythromycin content was detected by LC-MS system according to the method in Example 1.

[0087] The results (Table 2) showed that the tested erythromycin fermentation residue had a water content of 91.2%, total nitrogen and total organic carbon content of 32.6 and 398.5 g / kg, pH value of 5.9, carbon-nitrogen ratio of 12.3, and erythromycin residue concentration as high as 314.5 mg / kg, exhibiting significant characteristics of high nutrition and high antibiotic residue.

[0088] Table 2. Composition analysis of erythromycin-containing bacterial residue.

[0089]

[0090] (2) Inoculation with fungal TS7-1 and enhanced erythromycin-containing compost residue

[0091] The pH of the erythromycin bacterial residue was adjusted to 7.0 ± 0.5 using 1 mol / L NaOH, and then mixed with corn stalks (crushed to a particle size of ≤ 5 mm) in an equal proportion to prepare a solid substrate. An inoculum of 100% at a ratio of 1 / 100 was then added to 1000 g of the solid substrate. 9 A spore suspension of strain TS7-1 (+TS7-1) was prepared, with an inoculation of the same volume of sterile water as a control (CK). After thorough mixing, the mixture was spread evenly in a plastic container to a thickness of 10 cm, covered with breathable plastic wrap, and incubated at 28°C. During incubation, the container was thoroughly turned over every 1 day, and approximately 10 g of samples were randomly taken and stored at -20°C. After 7 days, the residual erythromycin content was measured uniformly.

[0092] (3) Extraction and content determination of erythromycin in compost

[0093] Accurately weigh 2.000 g of the mixed compost substrate sample, add 30 mL of a pH 6 Tris-CaCl2 mixed extraction solvent (10 mmol / L Tris, 20 mmol / L CaCl2), and sonicate for 10 minutes. Centrifuge at 8,000 rpm for 5 minutes. Collect the supernatant and adjust the pH to 10 with 1 mol / L NaOH. Add the extraction / dispersant (1 mL 1,2-dichloroethane, 1 mL methanol), vortex for 1 minute, and centrifuge at 4,000 rpm for 5 minutes. Collect the 1,2-dichloroethane layer, dry it under nitrogen, add 1 mL acetonitrile, vortex for 30 seconds to accelerate redissolution, and centrifuge at 13,000 rpm for 10 minutes. Take the supernatant, filter it through a 0.22 μm filter membrane, and determine the erythromycin content using an LC-MS system according to the method in Example 1.

[0094] The results showed that, compared with the uninoculated control (CK), the concentration of erythromycin in the compost substrate treated with fungal strain TS7-1 (+TS7-1) decreased rapidly after 2 days of fermentation, with a residual concentration of only 4.4 mg / L after 7 days, achieving a removal rate of 97.1%; while the residual concentration in the uninoculated control was still as high as 65.3 mg / L after 7 days of fermentation. Figure 6 (AB). This indicates that inoculating with strain TS7-1 can significantly accelerate the removal of erythromycin during the composting process of bacterial residue.

[0095] In summary, the above results demonstrate that the *Trichoderma echinococcosis* TS7-1 strain provided by this invention exhibits highly efficient degradation capabilities against various macrolide antibiotics (erythromycin, roxithromycin, and azithromycin). Within 36 hours, the removal rate of all three antibiotics reaches over 85%. Its resistance to high-concentration antibiotics, degradation rate, and degradation spectrum are significantly superior to the published patented strains *Staphylococcus aureus* X9 (patent CN119506143), salt-tolerant rhizobium IURM F69 (patent CN113462592), *Bacillus sicca* IURM E94 (patent CN113416671), *Bordezoella buddleia* IURM F57 (patent CN114231430), and the compound bacterial agent composed of *Delftia deltaenoides* Ery-6A and *Indole-producing Chlorella* Ery-6B (patent CN112760262).

[0096] Trichoderma TS7-1 is directly isolated from natural soil that is not contaminated with antibiotics, posing no risk of pathogenicity to plants or animals. It also has no microbial toxicity to the degradation products of macrolide antibiotics, thus avoiding secondary pollution and exhibiting excellent environmental safety.

[0097] Strain TS7-1 was tested at 28℃, pH 7-8, and HPO4. 2- At a concentration of 7.0 mmol / L, with the addition of 1 g / L starch as a supplementary carbon source, the fungal TS7-1 achieved a maximum 24-hour removal rate of 92.2% for 100 mg / L erythromycin.

[0098] Strain TS7-1 grows rapidly, is highly adaptable to pH and temperature, can tolerate high concentrations of erythromycin, and still maintains high erythromycin removal efficiency even under the interference of external organic nutrients, demonstrating extremely strong environmental adaptability.

[0099] The strain TS7-1 can utilize antibiotics as a carbon source for metabolic growth, and has good applicability to antibiotic pollution control under different environmental conditions.

[0100] Strain TS7-1 significantly enhanced the high-efficiency removal performance of erythromycin in erythromycin residue mixed with straw powder compost. After 7 days of fermentation of erythromycin residue mixed with straw in a 1:1 ratio, the residual concentration of erythromycin rapidly decreased to 4.4 mg / L, with a removal rate of 97.1%, laying a solid foundation for the rapid detoxification of erythromycin residue and the resource utilization of organic fertilizer fermentation.

[0101] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of Trichoderma esculenta TS7-1 or its fermentation broth in the degradation of macrolide antibiotics, characterized in that, The preservation number of the Trichoderma TS7-1 is CGMCC No. 41372; The macrolide antibiotics mentioned are erythromycin, azithromycin, or roxithromycin.

2. The application of *Trichoderma esculenta* TS7-1 or its fermentation broth as described in claim 1 in the preparation of a microbial agent for degrading macrolide antibiotics, characterized in that, The macrolide antibiotics mentioned are erythromycin, azithromycin, or roxithromycin.

3. The application as described in claim 1 or 2, characterized in that, The concentration of the fermentation broth is 1×10⁻⁶. 7 Spores / mL.

4. A bacterial agent for degrading macrolide antibiotics, characterized in that, Includes Trichoderma TS7-1 or its fermentation broth as described in claim 1.

5. A method for degrading macrolide antibiotics, characterized in that, The step includes culturing Trichoderma TS7-1 or its fermentation broth as described in claim 1 in an environment containing macrolide antibiotics; The macrolide antibiotics mentioned are erythromycin, azithromycin, or roxithromycin.

6. The application of Trichoderma TS7-1 as described in claim 1 or its fermentation broth or the inoculum as described in claim 4 in the degradation of erythromycin contained in the fermentation residue of erythromycin.

Images