Enhanced CAR-T cell for over-expressing CD200 and application of enhanced CAR-T cell
By overexpressing CD200 in CD19 CAR-T cells, a fusion gene containing chimeric antigen receptors and CD200 genes was constructed, and T lymphocytes were transfected with lentiviral vectors, the problem of insufficient killing and anti-tumor effects of CAR-T cell therapy was solved, and stronger cytokine secretion and killing ability was achieved.
Patent Information
- Application Number
- CN202510517682.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-23
- Publication Date
- 2025-08-12
- Estimated Expiration
- 2045-04-23
AI Technical Summary
The existing CAR-T cell therapies still need to be improved in terms of killing and anti-tumor effects.
By overexpressing CD200 in CD19 CAR-T cells, a fusion gene containing chimeric antigen receptors and CD200 genes was constructed, and T lymphocytes were transfected with lentiviral vectors to enhance the cytokine secretion ability of CAR-T cells.
It improves the secretion ability of IFN-γ and TNF-α of CAR-T cells, and enhances its killing and anti-tumor functions.
Smart Images

Figure CN120464631A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to an enhanced CAR-T cell overexpressing CD200 and its application. Background Art
[0002] CAR-T (Chimeric Antigen Receptor T-cell) cell therapy, also known as chimeric antigen receptor T-cell therapy, is a new precision targeted therapy for treating tumors. CAR-T therapy uses genetic engineering to modify human T cells, causing them to express chimeric receptors (CARs) on their surface that can specifically recognize tumor cell antigens. These cells are then amplified and delivered into the patient's body. The modified T cells can precisely target and kill tumor cells, ultimately achieving the goal of treating the tumor.
[0003] However, the killing and anti-tumor effects of CAR-T need to be further improved. Summary of the Invention
[0004] The purpose of the present invention is to provide an enhanced CAR-T cell overexpressing CD200 and its application. Compared with traditional CAR-T cells, the enhanced CAR-T cell of the present invention has better killing and anti-tumor effects.
[0005] The present invention provides the use of CD200 in preparing a product for improving the anti-tumor effect of CAR-T cells, wherein the nucleotide sequence of the gene encoding CD200 is shown in SEQ ID NO.1.
[0006] In the specific implementation of the present invention, the improving the anti-tumor effect of CAR-T cells includes improving the cytokine secretion ability of CAR-T cells.
[0007] In a specific implementation of the present invention, the cytokines include IFN-γ and / or TNF-α.
[0008] The present invention also provides a fusion gene comprising a gene encoding a chimeric antigen receptor and a gene encoding CD200; the nucleotide sequence of the gene encoding CD200 is shown in SEQ ID NO.1.
[0009] In a specific implementation of the present invention, the chimeric antigen receptor includes a scFv sequence, a CD8 hinge and transmembrane domain, a 4-1BB intracellular domain, and a CD3ζ intracellular domain connected in sequence; the gene encoding CD200 is connected via a gene encoding a T2A peptide and a CD3ζ intracellular domain.
[0010] The present invention also provides a lentiviral expression vector comprising the fusion gene described in the above scheme.
[0011] The present invention also provides a recombinant lentivirus, which is prepared by the following method: the lentiviral expression vector, packaging plasmid and envelope plasmid described in the above scheme are mixed and then transfected into packaging cells, and incubated after transfection to obtain the recombinant lentivirus.
[0012] The present invention also provides an enhanced CAR-T cell, comprising a T lymphocyte containing the lentiviral expression vector or the recombinant lentivirus described in the above scheme.
[0013] The present invention also provides the use of the fusion gene, the lentiviral expression vector, the recombinant lentivirus or the enhanced CAR-T cell described in the above scheme in the preparation of a drug for preventing, treating and / or assisting in the treatment of malignant tumors.
[0014] In the specific implementation of the present invention, the malignant tumor includes lymphoma.
[0015] The present invention provides the use of CD200 in the preparation of products that enhance the anti-tumor effects of CAR-T cells. CD200 can enhance the cytokine secretion capacity of CAR-T cells, thereby enhancing the killing and anti-tumor effects of CAR-T cells. By overexpressing CD200 on CD19 CAR-T cells, the present invention enhances their cytokine secretion capacity compared to traditional CD19 CAR-T cells, thereby enhancing their killing and anti-tumor functions. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0017] Figure 1 Schematic diagram of the structure of CD200-overexpressing CAR-T and traditional CAR-T;
[0018] Figure 2 The results of IFN-γ secretion by CD200-overexpressing CAR-T and traditional CAR-T cells are shown;
[0019] Figure 3 The results of TNF-α secretion by CD200-overexpressing CAR-T and traditional CAR-T cells are shown;
[0020] Figure 4 The figure shows the comparison of the killing function of CD200-overexpressing CAR-T and traditional CAR-T cells;
[0021] Figure 5 The figure shows the anti-tumor ability test results of CD200-overexpressing CAR-T and traditional CAR-T. DETAILED DESCRIPTION
[0022] The present invention provides the use of CD200 in preparing a product for improving the anti-tumor effect of CAR-T cells, wherein the nucleotide sequence of the gene encoding CD200 is shown in SEQ ID NO.1.
[0023] In the present invention, the nucleotide sequence shown in SEQ ID NO.1 is specifically:
[0024] atggagaggctggtgatcaggatgcccttctctcatctgtctacctacagcctggtttgggtcatggcagcagtggtgctgtgcacagcacaagtgcaag tggtgacccaggatgaaagagagcagctgtacacacctgcttccttaaaatgctctctgcaaaatgcccaggaagccctcattgtgacatggcagaaaaag aaagctgtaagcccagaaaacatggtcaccttcagcgagaaccatggggtggtgatccagcctgcctataaggacaagataaacattacccagctgggactccaaaactcaaccatcaccttctggaatatcaccctggaggatgaagggtgttacatgtgtctcttcaatacctttggttttgggaagatctcaggaacgg cctgcctcaccgtctatgtacagcccatagtatcccttcactacaaattctctgaagaccacctaaatatcacttgctctgccactgcccgcccagccccc atggtcttctggaaggtccctcggtcagggattgaaaaatagtacagtgactctgtctcacccaaatgggaccacgtctgttaccagcatcctccatatcaa agaccctaagaatcaggtggggaaggaggtgatctgccaggtgctgcacctggggactgtgaccgactttaagcaaaccgtcaacaaaggctattggtttt cagttccgctattgctaagcattgtttccctggtaattcttctcgtcctaatctcaatcttactgtactggaaacgtcaccggaatcaggaccgagagccc 。
[0025] In the specific implementation of the present invention, the improving the anti-tumor effect of CAR-T cells includes improving the cytokine secretion ability of CAR-T cells.
[0026] In a specific implementation of the present invention, the cytokines include IFN-γ and / or TNF-α.
[0027] The present invention also provides a fusion gene comprising a gene encoding a chimeric antigen receptor and a gene encoding CD200; the nucleotide sequence of the gene encoding CD200 is shown in SEQ ID NO.1.
[0028] In a specific implementation of the present invention, the chimeric antigen receptor includes CD19 CAR; the chimeric antigen receptor includes a scFv sequence, a CD8 hinge and transmembrane domain, a 4-1BB intracellular domain and a CD3ζ intracellular domain connected in sequence.
[0029] In a specific implementation of the present invention, the gene encoding the chimeric antigen receptor and the gene encoding CD200 are sequentially connected in series; the gene encoding CD200 is connected through the gene encoding the P2A peptide and the CD3ζ intracellular domain in the chimeric antigen receptor.
[0030] In one embodiment of the present invention, the chimeric antigen receptor is CD19 CAR, and its nucleotide sequence is shown in SEQ ID NO. 2, specifically:
[0031] ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTC CACGCCGCCAGGCCG (CD8a signal peptide) gacatccagatgacacagactacatcctccctgtctgcctctctggggagacagtcaccatcagttgc agggcaagt caggacattagtaaatatttaaattggtatcagcagaaaccagatggaactgttaaactcctgatc taccatacatcaagattacactcaggagtcccatcaaggttcagtggcagtgggtctggaacagattattctctca ccattagcaacctggagcaagaa gatattgccacttacttttgccaacagggtaatacgcttccgtacacgttcggaggggggaccaagctggagatcacaggt ggcggtggctcgggcggtggtgggtcgggtggcggcggatctgaggtg aaactgcaggagtcaggacctggcctggtggcgccctcacagagcctgtccgtcacatgcactgtctcaggggtct cattacccgactatggtgtaagctggattcgccagcctccacgaaagggtctggagtggctgggagtaatatgggg tagtgaaaccacatactataattcagctctcaaatccag actgaccatcatcaaggacaactccaagagccaagttttcttaaaaatgaacagtctgcaaactgatgacacagccatttact actgtgccaaacattattactacggtggta gctatgctatggactactggggccaaggaacctcagtcaccgtctcctca(SCFV)accacgacgccagcgccgcgaccaccaacaccggcgcccaccatcgcgtcgcagcccctgtccctgcgcccaga ggcgtgccggccagcggcggggggcgcagtgcacacgagggggctggacttcgcctgtgatatctacatctgggc gcccttggccgggacttgtggggtccttctcctgtcactggttatcaccctttactgc(human CD8(CD8 hinge+CD8 transmembrane))AAACGGGGCAGAAAGAAACTCCTGTATATTCAAACAACCATTTATGAGA CCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGA AGAAGAAGAAGGAGGATGTGAACT(human CD137(4-1BB)) (human CD3ζ)taa.
[0032] The present invention also provides a lentiviral expression vector comprising the fusion gene described in the above scheme.
[0033] The lentiviral expression vector further comprises an EF1α promoter and a gene encoding EGFP; the EF1α promoter, the gene encoding the chimeric antigen receptor, the gene encoding CD200, and the gene encoding EGFP are sequentially connected in series; the gene encoding CD200 is connected via a gene encoding the T2A peptide and a gene encoding EGFP.
[0034] The present invention has no particular limitation on the method for constructing the lentiviral expression vector, and conventional methods in the art can be used. In the specific implementation of the present invention, the CD200 gene is knocked in by gene editing in the GV971 vector (CAR-T plasmid).
[0035] The present invention also provides a recombinant lentivirus, which is prepared by the following method: the lentiviral expression vector, packaging plasmid and envelope plasmid described in the above scheme are mixed and then transfected into packaging cells, and incubated after transfection to obtain the recombinant lentivirus.
[0036] In the specific implementation process of the present invention, the packaging cells include HEK293T cells; the cell density of the HEK293T is 4×10e5 / ml; the lentiviral expression plasmid is the transfer plasmid pLVX; the packaging plasmid is psPAX2; the envelope plasmid is PmD2.G; the mass ratio of the lentiviral expression vector, packaging plasmid and envelope plasmid is 10:7.5:2.5.
[0037] The present invention also provides an enhanced CAR-T cell, comprising a T lymphocyte containing the lentiviral expression vector or the recombinant lentivirus described in the above scheme.
[0038] In the present invention, the T lymphocytes include CD3+ T cells.
[0039] The present invention also provides the use of the fusion gene, the lentiviral expression vector, the recombinant lentivirus or the enhanced CAR-T cell described in the above scheme in the preparation of a drug for preventing, treating and / or assisting in the treatment of malignant tumors.
[0040] In the specific implementation of the present invention, the malignant tumor includes lymphoma.
[0041] In the specific implementation of the present invention, the dosage form of the drug includes injection.
[0042] To further illustrate the present invention, the enhanced CAR-T cells overexpressing CD200 and their applications provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.
[0043] Example 1
[0044] The schematic diagram of the CAR-T structure designed in this example is shown in the following figure. Figure 1 shown. Figure 1 The original structures of the traditional CD19-CAR-T plasmid and the CD200 overexpression CAR-T plasmid are both driven by the EF1α promoter and then connected to the various CAR-T components.
[0045] 1. Construction of lentiviral expression plasmid:
[0046] 1) Construction of traditional CD19-CAR-T plasmid: The simple GV971 vector is a traditional CD19-CAR-T plasmid, and the lentivirus obtained by packaging it is a traditional CAR-T virus.
[0047] 2) Construction of a CD200-overexpressing CAR-T plasmid: Obtain a gene encoding a chimeric antigen receptor (CAR) (SEQ ID NO. 2) and a CD200 gene (SEQ ID NO. 1). The CD200 gene is linked to the CD3 intracellular domain of the CAR gene via P2A. Gene editing is performed in the GV971 vector (CAR-T plasmid) to knock in the CD200 gene fragment, thereby obtaining a lentiviral expression plasmid that overexpresses the CD200 gene.
[0048] 2. Lentivirus packaging: HEK293T cells were used as packaging cells and plated at a cell density of 4 × 105 / ml. After culturing for 24 h, the transfer plasmid pLVX (overexpressing CD200 CAR-T plasmid or traditional CD19-CAR-T plasmid), packaging plasmid psPAX2, and envelope plasmid PmD2.G were mixed at a mass ratio of 10 μg:7.5 μg:2.5 μg to obtain a plasmid mixture.
[0049] Mix 625 μl of reduced serum medium (Opti-mem) and 45 μl of Lipo3000 and mark it as tube 1; mix 625 μl of Opti-mem, 30 μl of P3000 and the plasmid mixture and mark it as tube 2; mix tubes 1 and 2 and incubate for 15 minutes to obtain mixed solution 1, add mixed solution 1 dropwise to the cell culture medium, incubate in an incubator for 48 hours, and then collect the virus.
[0050] 3. Purification of human peripheral blood T cells: Lymphocytes are first isolated from human peripheral blood using lymphocyte separation medium, and then high-purity CD3+ T cells are sorted from them using a magnetic bead sorting kit.
[0051] 4. T cell lentiviral transfection: Activate the highly purified CD3+ T cells obtained in step 3 with pre-coated CD3 / CD28 antibodies for 24 h. Collect the activated cells and plate them in a 24-well plate at 1 × 10e6 / well. Add the viral supernatant prepared in step 2 at an appropriate MOI (10) and 10 ng / ml polybrene. Centrifuge at room temperature for 2 h. 4 h after centrifugation, replace with fresh T cell culture medium supplemented with fresh cytokines.
[0052] 5. T cell expansion: Continue to culture the T cells obtained in step 4 at a cell density of 1×10e6 / ml, passage them every 2 days and supplement with cytokines (12.5ng / ml IL-7 + 25ng / ml IL-15) to obtain a sufficient number of CAR-T cells.
[0053] Comparative Example 1
[0054] Comparison of cytokine secretion function between the experimental group (CD200 overexpressing CAR-T, CD200 OE) and the control group (conventional CAR-T cells, control)
[0055] The CD200 CAR-T cells and conventional CAR-T cells prepared by the above method were incubated with PMA plus ionomycin (using Thermo Fisher Scientific kit, catalog number 00-4975-93, 1:500) in a 37°C incubator for 4 hours. The intracellular IFN-γ and TNF-α staining of the two groups of cells were detected by flow cytometry. Figure 2 、 Figure 3 As shown in Tables 1 and 2, the results show that compared with traditional CAR-T, CAR-T overexpressing CD200 has stronger IFN-γ and TNF-α secretion ability.
[0056] Table 1 IFN-γ secretion by CD200-overexpressing CAR-T cells and conventional CAR-T cells
[0057] Biological replicates <![CDATA[Control (×10 3 )]]> <![CDATA[CD200OE(×10 3 )]]> 1 4.428 7.496 2 4.708 8.059 3 4.728 9.288 average value 4.621 8.281
[0058] Table 2 TNF-α secretion by CD200-overexpressing CAR-T cells and conventional CAR-T cells
[0059] Biological replicates <![CDATA[Control (×10 4 )]]> <![CDATA[CD200OE(×10 4 )]]> 1 3.127 4.8948 2 3.225 4.6214 3 3.237 5.048 average value 3.196 4.855
[0060] Comparative Example 2
[0061] Comparison of the cytotoxicity between CD200-overexpressing CAR-T (CD200 OE) and conventional CAR-T cells (control, CD200Control)
[0062] Raij cells and CAR-T cells were mixed at a ratio of 1:1 and co-cultured. The killing effect of the two groups was detected after 24 hours. Figure 4 As shown in Table 3, the results showed that compared with traditional CAR-T, CAR-T overexpressing CD200 had stronger tumor cell killing ability.
[0063] Table 3 Comparison of the killing function of CD200-overexpressing CAR-T cells and traditional CAR-T cells
[0064] Biological replicates Control (%) CD200OE(%) 1 56 73.68 2 54 76.22 3 56.8 74.56 average value 55.6 74.82
[0065] Comparative Example 3
[0066] Comparison of the anti-tumor abilities of CD200-overexpressing CAR-T and traditional CAR-T
[0067] 1.1 Detection of mouse tumor growth
[0068] Based on the above experiments, Raij cell lines were subcutaneously implanted into NSG immunodeficient mice. Eleven days after tumor implantation, CD200-overexpressing CAR-T (CD200 OE), conventional CAR-T (CD200 Control), or PBS were infused back into the mice. Six replicates were performed in each group, with a dose of 100w / mouse. Tumor volume was measured with a vernier caliper every 2-3 days. The experimental results are shown in Figure 2. Figure 5 As shown in Tables 4 to 7, the results showed that compared with traditional CAR-T, CD200 overexpression CAR-T can achieve better anti-tumor effects.
[0069] Table 4 Changes in tumor volume of tumor-bearing mice after PBS infusion
[0070]
[0071] Table 5 Changes in tumor volume in tumor-bearing mice after re-infusion of traditional CAR-T
[0072]
[0073] Table 6 Changes in tumor volume after reinfusion of CD200-overexpressing CAR-T cells into tumor-bearing mice
[0074]
[0075]
[0076] Table 7 Average tumor volume of tumor-bearing mice in each group over time
[0077]
[0078] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. The use of CD200 in the preparation of a product for enhancing the anti-tumor effect of CAR-T cells, wherein the nucleotide sequence of the gene encoding CD200 is shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that The improvement of the anti-tumor effect of CAR-T cells includes improving the cytokine secretion ability of CAR-T cells.
3. The use according to claim 2, characterized in that The cytokines include IFN-γ and / or TNF-α.
4. A fusion gene, characterized in that It includes a gene encoding a chimeric antigen receptor and a gene encoding CD200; the nucleotide sequence of the gene encoding CD200 is shown in SEQ ID NO.
1.
5. The fusion gene according to claim 4, characterized in that The chimeric antigen receptor includes a scFv sequence, a CD8 hinge and transmembrane domain, a 4-1BB intracellular domain and a CD3ζ intracellular domain connected in sequence; the gene encoding CD200 is connected to the CD3ζ intracellular domain through the gene encoding the T2A peptide.
6. A lentiviral expression vector, characterized in that: Contains the fusion gene according to claim 4 or 5.
7. A recombinant lentivirus, characterized in that The lentivirus is prepared by the following method: the lentiviral expression vector, packaging plasmid and envelope plasmid according to claim 6 are mixed and then transfected into packaging cells, and then incubated after transfection to obtain a recombinant lentivirus.
8. An enhanced CAR-T cell, characterized in that: A T lymphocyte comprising the lentiviral expression vector according to claim 6 or the recombinant lentivirus according to claim 7.
9. Use of the fusion gene of claim 4 or 5, the lentiviral expression vector of claim 6, the recombinant lentivirus of claim 7, or the enhanced CAR-T cell of claim 8 in the preparation of a drug for preventing, treating, and / or assisting in the treatment of malignant tumors.
10. The use according to claim 9, characterized in that The malignant tumor includes lymphoma.
Citation Information
Patent Citations
Chimeric antigen receptor gene engineering vector and immune cells, and applications thereof
CN110129369A
Engineered immunostimulatory bacterial strains and uses thereof
CN112673092A
CEA-targeted hypoxia-induced-started CAR structure, immune cell and application
CN113698490A
Chimeric antigen receptor gene engineering vector, immune cell modified thereby and application thereof
WO2019154204A1