Synthesis method and application of circular shRNA with gene knockdown function

By designing circ-shRNA and using a cyclization method linked by 2′,5′-phosphodiester bonds, the stability problem of nucleic acid drugs in the exonuclease environment was solved, and the gene knockdown function of circular shRNA in cells was realized, providing a direction for the development of novel nucleic acid drugs.

CN120464698BActive Publication Date: 2026-02-13NANKAI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510609105.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-13
Publication Date
2026-02-13
Estimated Expiration
2045-05-13

AI Technical Summary

Technical Problem

Existing nucleic acid drugs have poor stability during systemic circulation, especially naked siRNA, which degrades within minutes in serum. Furthermore, there are safety and targeting issues in nucleic acid drug delivery, and the gene knockdown function of circular shRNA is difficult to achieve.

Method used

By designing shRNA as circ-shRNA, cyclization was performed using 2′,5′-phosphodiester bonds, and the cyclization reaction was carried out in MES buffer and EDAC solution to form a circular structure. Then, the shRNA was purified using RNase R enzyme to ensure improved stability under exonuclease environment and to reform shRNA in cells to perform gene knockdown function.

Benefits of technology

This study improved the stability of circular shRNA in the exonuclease environment, enabling it to effectively inhibit gene expression after entering cells, and provides a direction for the development of novel nucleic acid drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120464698B_ABST
    Figure CN120464698B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of biological medicine, and in particular to a synthesis method and application of circular shRNA with gene knockdown function. The present application provides a synthesis method of circular shRNA with gene knockdown function. The ends of linear shRNA are connected by 2', 5'-phosphodiester bond to form circular shRNA, which can improve the stability of delivery in the environment of exonuclease. Moreover, after entering the cell, the 2', 5'-phosphodiester bond can be cleaved by DBR1 (Debranching RNA Lariats 1), so as to obtain shRNA, which can play the gene knockdown function of shRNA and play the role of inhibiting gene expression. The present application provides a new direction for developing a new nucleic acid drug for knocking down gene expression, and has a broad application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to a synthesis method and application of circular shRNA with gene knockdown function. BACKGROUND

[0002] RNA interference (RNAi) is a natural protection mechanism in organisms, which principle is to degrade messenger RNA so that protein cannot be translated, thereby inhibiting the expression of genes. Using RNA interference technology can specifically inhibit the expression of target genes. Therefore, RNA interference-related therapies have been developed for the treatment of various diseases, including small interfering RNA (siRNA), microRNA (miRNA), short hairpin RNA (shRNA), ribozyme, antisense oligonucleotide. Among these therapies, siRNA, miRNA and shRNA can specifically bind to the targeted mRNA, and thus are concerned in the field of nucleic acid therapy. shRNA as a nucleic acid therapeutic drug has many advantages, including controllability of nucleic acid sequence, easy synthesis, efficient production, and relatively clear and direct mechanism of action. Although it has great potential advantages, it is particularly important to improve its stability for RNA interference exposed to a nucleic acid-rich nuclease environment during systemic circulation. For example, naked siRNA is degraded within a few minutes in serum. The instability of RNA interference has not been completely solved in the problem of nucleic acid drug delivery, and the main challenge of most nucleic acid therapies has not changed, i.e., the problems of safe, efficient and targeted delivery still exist.

[0003] Circular RNA (circular RNAs, circ-RNAs) is a covalently closed single-stranded RNA molecule, which is different from cis-splicing, and endogenous circular RNA is produced by reverse splicing. Circular RNA lacks free ends, forming a covalent closed loop structure, which makes it have a certain ability to resist ribonuclease R (RNase R) degradation. Compared with linear RNA, circular RNA reduces the sensitivity to exonuclease activity and has better stability. However, the circular shRNA connected by 3', 5'-phosphodiester bond cannot exert the gene knockdown function of shRNA nucleic acid drugs. Therefore, the technical problem of how to improve the stability in nucleic acid drug delivery while effectively exerting the gene knockdown function of nucleic acid drugs needs to be solved. SUMMARY

[0004] In view of the above technical problems, the application provides a synthesis method and application of a circular shRNA with a gene knockdown function.

[0005] The technical scheme of the application is as follows:

[0006] The application provides a synthesis method of a circular shRNA with a gene knockdown function.

[0007] As an implementation form, the ends of linear shRNA are connected by 2', 5'-phosphodiester bonds to be circularized to form a circular shRNA.

[0008] As an implementation form, 3'-deoxyadenosine (cordycepin) is added to the 3' end of the shRNA, so that the triphosphate (5'PPP) at the 5' end of the shRNA is converted into monophosphate (5'P).

[0009] As an implementation form, E. coli Poly(A) polymerase is used to add 3'-deoxyadenosine (cordycepin).

[0010] As an implementation form, RNA 5' pyrophosphatase is used for treatment, so that the triphosphate (5'PPP) at the 5' end of the shRNA is converted into monophosphate (5'P).

[0011] As an implementation form, the circularization is performed in a reaction system of MES buffer and EDAC solution.

[0012] As an implementation form, the concentration of the EDAC solution is 200-300 mM.

[0013] The application also provides a synthesis method of the circular shRNA to synthesize a circular shRNA with a gene knockdown function.

[0014] As an implementation form, the gene with a gene knockdown function includes a Renilla luciferase reporter gene.

[0015] As an implementation form, the nucleotide sequence of the circular shRNA for knocking down the Renilla luciferase reporter gene is shown in SEQ ID No. 1.

[0016] The application also provides an application of the circular shRNA in preparing a drug with a gene knockdown function.

[0017] Compared with the prior art, the application has the following beneficial effects:

[0018] The application provides a synthesis method of circular shRNA, and circular shRNA connected by 2', 5'-phosphodiester bond is synthesized in vitro for the first time, which can improve the stability of delivery in the exonuclease environment, and after entering the cell, the 2', 5'-phosphodiester bond can be cleaved by DBR1 (Debranching RNA Lariats 1), so as to obtain shRNA, which can play the gene knockdown function of shRNA and play the role of inhibiting gene expression. The application provides a new direction for developing a new nucleic acid drug for knocking down gene expression, and has a broad application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 It is an electrophoresis result of circular synthesis of circ-shRNA RmA, wherein the first lane is small RNA ladder (50 nt), the second lane is a band of linear shRNA RpA, the third lane is a band of linear shRNA RpA after being treated by RNase R enzyme for 1 h, the fourth lane is a band of circ-shRNA RmA, and the fifth lane is a band of circ-shRNA RmA after being treated by RNase R enzyme for 1 h;

[0020] Figure 2 It is a result of shRNA and circular shRNA transfection into a 293T cell line stably expressing a Renilla luciferase reporter gene on the knockdown function of the Renilla luciferase reporter gene; wherein A is a result of shRNA RpA in Comparative Example 2 and shRNA FpA in Comparative Example 3 on the knockdown of the Renilla luciferase reporter gene; B is a result of circ-shRNA RmA in Example 1 and circ-shRNA FmA in Comparative Example 1 on the knockdown of the Renilla luciferase reporter gene; and C is a result of circ-shRNA RpA in Comparative Example 4 and circ-shRNA FpA in Comparative Example 5 on the knockdown of the Renilla luciferase reporter gene. DETAILED DESCRIPTION

[0021] The application provides a synthesis method of circular shRNA, and linear shRNA is connected and circularized by 2', 5'-phosphodiester bond at the end of the linear shRNA to form circular shRNA.

[0022] In the application, 3'-deoxyadenosine is added at the 3' end of the shRNA, and as an embodiment, E. coli Poly(A) polymerase is used to add 3'-deoxyadenosine; the 3'-deoxyadenosine is also called cordycepin. The application adds 3'-deoxyadenosine (cordycepin) at the 3' end of the shRNA to facilitate the subsequent formation of 2', 5'-phosphodiester bond connection.

[0023] In the present application, the 5' end of the shRNA is treated with RNA 5' pyrophosphohydrolase (RppH). The present application uses RNA 5' pyrophosphohydrolase to treat the 5' end of the shRNA, which removes the pyrophosphate from the 5' terminal triphosphorylated RNA to generate 5' monophosphate RNA, facilitating the subsequent formation of a 2', 5'-phosphodiester bond linked cyclization.

[0024] In the present application, the cyclization is performed in an MES buffer and an EDAC solution. In one embodiment, the cyclization is performed in an MgCl2 solution, an MES buffer and an EDAC solution. The MgCl2 solution can reduce electrostatic repulsion, promote the proximity of the RNA ends, the MES buffer provides a stable pH environment for the cyclization reaction, and the EDAC solution covalently links the shRNA through a 2', 5'-phosphodiester bond. The concentration of the MgCl2 solution is 50-150 mM, and in one embodiment, the concentration of the MgCl2 solution is 100 mM. The concentration of the MES buffer is 50-150 mM, and in one embodiment, the concentration of the MES buffer is 100 mM; the pH of the MES buffer is 5.5-7, and in one embodiment, the pH of the MES buffer is 6.2. The concentration of the EDAC solution is 200-300 mM, and in one embodiment, the concentration of the EDAC solution is 250 mM. As one embodiment, the shRNA is first heated in a system of MgCl2 solution and MES buffer, the heating temperature is 75-85°C, and the heating time is 1-3 min. The present application destroys the non-covalent interactions of the secondary structure in the shRNA by heating, which fully stretches the linear shRNA molecule, exposing the ends or ligation sites, thereby improving the cyclization efficiency, and also eliminating local base pairing or stacking within the shRNA molecule, providing spatial accessibility for the subsequent 2', 5'-phosphodiester bond reaction. Then, after rapid cooling to room temperature, the above solution is added to a system containing an EDAC solution for cyclization. The cyclization temperature is 2-8°C, and in one embodiment, the cyclization temperature is 4°C; the cyclization time is not less than 2 h, and in one embodiment, the cyclization time is 48 h.

[0025] In the present application, after the circularization is completed, RNase R enzyme is added to the reaction system. RNase R enzyme can effectively degrade linear RNA molecules while retaining circular RNA molecules, thereby achieving efficient enrichment and purification of circular RNA. The enzyme activity of the RNase R enzyme and the RNA after the circularization reaction is 1-3 U: 1 μg. As an embodiment, the reaction conditions of the RNase R enzyme are as follows: the reaction buffer is 50 mM Tris-HCl (pH 8.0) containing 75 mM KCl and 3 mM MgCl2, the reaction temperature is 37°C, and the reaction time is 1 h. After the reaction is completed, the present application removes the enzyme and other impurities by phenol-chloroform extraction method to obtain enriched circular RNA.

[0026] The present application also provides a synthesis method of the circular shRNA to synthesize circular shRNA with gene knockdown function. Renilla luciferase produced by the expression of renilla luciferase reporter gene can catalyze the production of renilla luciferin to produce fluorescence, and the expression level of the gene can be quickly detected according to the luminescence intensity. In the present application, shRNA capable of knocking down the renilla luciferase gene is circularized according to the synthesis method described in the present application. As an embodiment, the nucleotide sequence of the circular shRNA is shown in SEQ ID No. 1. The circular shRNA shown in SEQ ID No. 1 is transfected into a 293T cell line stably expressing a renilla luciferase reporter gene, which can significantly inhibit the expression of the renilla luciferase reporter gene. It shows that the circular shRNA synthesized by the method of the present application can exert the function of gene knockdown.

[0027] The present application also provides the use of the circular shRNA in the preparation of a drug with gene knockdown function.

[0028] In order to make the purpose, technical scheme and advantages of the present application more clear, the present application will be described in detail below combined with examples, but they should not be understood as limiting the scope of protection of the present application.

[0029] The materials, reagents and the like used in the following examples can be obtained from commercial channels, such as the reagents, consumables and the like related to the present application, unless otherwise specified. If no specific use conditions are indicated, they are usually used according to conventional conditions or according to the conditions recommended by the company.

[0030] Example 1 In vitro synthesis of circular shRNA (circ-shRNA RmA) with knockdown of renilla luciferase reporter gene

[0031] 1. Synthesis of linear shRNA (shRNA RmA) with knockdown of renilla luciferase reporter gene function

[0032] The DNA template for synthesizing shRNA RmA was amplified by PCR using forward primer SEQ ID No. 2 and reverse primer SEQ ID No. 3. The PCR amplification system was 10 μM of forward primer and reverse primer, water and Premix Ex Taq mixed; the PCR reaction conditions were: heating at 95 °C for 5 min to denature the DNA, and then cooling to 64 °C for 30 s. The purified DNA fragment was used as a template to synthesize shRNA RmA in vitro using T7 RNA polymerase. Then, deoxyribonuclease I (DNase I) was used to treat at 37 °C for 1 h. After the reaction was completed, the enzyme and other impurities were removed by phenol-chloroform extraction method to obtain pure shRNA RmA. The nucleotide sequence of shRNA RmA is shown in SEQ ID No. 4. The primers were synthesized by Sheng Wu Bioengineering Co., Ltd.

[0033] SEQ ID No. 2: TAATACGACTCACTATAGCTATGAGCATCAAGATAATCGCGTCGCAGCGGATT;

[0034] SEQ ID No. 3: AGCTATGAGCATCAAGATAATCCGCTGCGACGCGAT;

[0035] SEQ ID No. 4: GCUAUGAGCAUCAAGAUAAUCGCGUCGCAGCGGAUUAUCUUGAUGCUCAUAGCU.

[0036] 2. Cyclization and purification of shRNA RmA

[0037] 2.1 Modification of shRNA RmA

[0038] shRNA RmA was added to a solution containing 10x PAP Reaction Buffer, 1 mM C9137 cordycepin, RNase Inhibitor, E. coli Poly(A) Polymerase, and reacted at 37 °C for 30 min to add a 3'-deoxyadenosine (cordycepin) poly(A) tail to the 3' end of shRNA RmA. shRNA RmA was added to a solution containing 1x NEBuffer TM 2 and RppH, and reacted at 37 °C for 30 min to remove pyrophosphate from the 5' end of linear shRNA using RNA 5' pyrophosphohydrolase (RppH), resulting in 5' monophosphate RNA.

[0039] 2.2 Cyclization of shRNA RmA

[0040] The modified shRNA RmA was heated in a system of 100 mM MgCl2, 100 mM MES buffer with pH = 6.2 at 80℃ for 2 min, quickly cooled to room temperature, and then 250 mM EDAC was added to the system after 5 min, and the cyclization reaction was carried out at 4℃ for 48 h. After the reaction was completed, the enzyme and other impurities were removed by phenol-chloroform extraction method to obtain a RNA sample containing circ-shRNA (circ-shRNA RmA) connected by 2', 5'-phosphodiester bond.

[0041] 2.3 Purification of circ-shRNA RmA

[0042] According to the addition of 3 U RNase R enzyme reaction per microgram of RNA sample, the RNase R enzyme can degrade linear RNA while retaining circular RNA, thereby realizing efficient enrichment and purification of circ-shRNA RmA. The reaction conditions of the RNase R enzyme are as follows: the reaction buffer is 50 mM Tris-HCl (pH 8.0) containing 75 mM KCl and 3 mM MgCl2, the reaction temperature is 37℃, and the reaction time is 1 h. After the reaction is completed, the enzyme and other impurities are removed by phenol-chloroform extraction method to obtain purified circ-shRNA RmA, and the nucleotide sequence is shown as SEQ ID No. 1.

[0043] SEQ ID No. 1: GCUAUGAGCAUCAAGAUAAUCGCGUCGCAGCGGAUUAUCUUGAUGCUCAUAGCUA.

[0044] Comparative Example 1: In vitro synthesis of circular shRNA (circ-shRNA FmA) with knockdown of firefly luciferase reporter gene

[0045] The firefly luciferase reporter gene is another commonly used luciferase reporter gene system, and the in vitro synthesized circular shRNA (circ-shRNA FmA) with knockdown of firefly luciferase reporter gene does not have knockdown effect on the renilla luciferase reporter gene.

[0046] 1. Synthesis of linear shRNA (shRNA FmA) with knockdown of firefly luciferase reporter gene function

[0047] The DNA template for synthesizing shRNA FmA was amplified by PCR using forward primer SEQ ID No. 5 and reverse primer SEQ ID No. 6. The PCR amplification system was 10 μM of forward primer and reverse primer, water and Premix Ex Taq mixed; the PCR reaction conditions were: heating at 95°C for 5 min to denature the DNA, and then cooling to 64°C for 30 s. The purified DNA fragment was used as a template to synthesize shRNA FmA by in vitro transcription using T7 RNA polymerase. Then, deoxyribonuclease I (DNase I) was used to treat at 37°C for 1 h. After the reaction was completed, the enzyme and other impurities were removed by phenol-chloroform extraction method to obtain pure shRNA FmA. The nucleotide sequence of shRNA FmA is shown in SEQ ID No. 7. The primers were synthesized by Sheng Wu Bioengineering Co., Ltd. (Sheng Wu).

[0048] SEQ ID No. 5: TAATACGACTCACTATAGCTACATTCTGGAGACATATCGCGTCGCAGCGGAT

[0049] SEQ ID No. 6: GGCTACATTCTGGAGACATATCCGCTGCGACGCGAT

[0050] SEQ ID No. 7: GCUACAUUCUGGAGACAUAUCGCGUCGCAGCGGAUAUGUCUCCAGAAUGUAGCC.

[0051] 2. Cyclization and purification of shRNA FmA

[0052] The cyclization and purification method described in Example 1 was used to obtain circ-shRNA FmA.

[0053] Comparative Example 2: In vitro synthesis of linear shRNA (shRNA RpA) with the function of knocking down the luciferase reporter gene of sea lamprey

[0054] The synthesis method of shRNA RmA described in Example 1 was used. The difference was that the forward primer for PCR amplification of shRNA RpA was SEQ ID No. 8, and the reverse primer was SEQ ID No. 9. The nucleotide sequence of the amplified shRNA RpA is shown in SEQ ID No. 10. The primers were synthesized by Sheng Wu Bioengineering Co., Ltd. (Sheng Wu).

[0055] SEQ ID No. 8: TAATACGACTCACTATAGCTATGAGCATCAAGATAATCGCGTCGCAGCGGATT;

[0056] SEQ ID No. 9: TAGCTATGAGCATCAAGATAATCCGCTGCGACGCGAT;

[0057] SEQ ID No. 10: GCUAUGAGCAUCAAGAUAAUCGCGUCGCAGCGGAUUAUCUUGAUGCUCAUAGCUA.

[0058] Synthesis of linear shRNA (shRNA FpA) with the function of knocking down firefly luciferase reporter gene in vitro

[0059] The synthesis method of shRNA FpA is the same as that of shRNA RmA in Example 1. The difference is that the forward primer for PCR amplification of shRNA FpA is SEQ ID No. 11, and the reverse primer is SEQ ID No. 12. The nucleotide sequence of shRNA FpA amplified is shown in SEQ ID No. 13. The primer is synthesized by Sheng Wu Bioengineering Co., Ltd. (Sheng Wu).

[0060] SEQ ID No. 11: TAATACGACTCACTATAGCTACATTCTGGAGACATATCGCGTCGCAGCGGAT;

[0061] SEQ ID No. 12: TGGCTACATTCTGGAGACATATCCGCTGCGACGCGAT;

[0062] SEQ ID No. 13: GCUACAUUCUGGAGACAUAUCGCGUCGCAGCGGAUAUGUCUCCAGAAUGUAGCCA.

[0063] Synthesis of shRNA capable of knocking down Renilla luciferase reporter gene in vitro to form circular shRNA (circ-shRNA RpA) with 3', 5'-phosphodiester bond connection circularization

[0064] The shRNA RpA described in Comparative Example 2 was added to a system containing T4 RNA Ligase 2, 10x T4 Rnl2 Reaction Buffer and reacted at 25°C for 48 h, so that T4 RNA ligase 2 circularized shRNA RpA by enzymatic circularization connection to form circular shRNA (circ-shRNA RpA) with 3', 5'-phosphodiester bond connection circularization.

[0065] The shRNA capable of knocking down firefly luciferase reporter gene was synthesized in vitro to cyclize the circular shRNA (circ-shRNA FpA) with 3', 5'-phosphodiester bond.

[0066] The shRNA FpA described in Comparative Example 3 was added to a system containing T4 RNA Ligase 2, 10x T4 Rnl2 Reaction Buffer, and reacted at 25°C for 48 h, so as to cyclize the shRNA FpA by means of enzymatic cyclization of T4 RNA ligase 2 to form the circular shRNA (circ-shRNA FpA) cyclized with 3', 5'-phosphodiester bond.

[0067] Test Example 1: Verification of synthesis of circ-shRNA RmA

[0068] 1. Preparation of denatured urea polyacrylamide gel

[0069] The reagents for gel preparation are as follows:

[0070]

[0071]

[0072] 2. Sample processing

[0073] Five samples of small RNA ladder (50 nt), shRNA RpA in Comparative Example 2, shRNA RpA treated with RNase R enzyme for 1 h, circ-shRNA RmA in Example 1, and circ-shRNA RmA treated with RNase R enzyme for 1 h were mixed with an equal volume of formamide, glycerol mixture, and denatured in a PCR instrument at 95°C for 2 min. Among them, the RNase R enzyme can effectively degrade linear RNA molecules while retaining circular RNA molecules.

[0074] 3. Electrophoresis

[0075] Tris-Borate-EDTA Buffer was used inside and outside the electrophoresis tank, and electrophoresis was performed at a rated voltage of 70 V for 4 h.

[0076] 4. Staining and gel imaging

[0077] The treated gel was stained in NA-RED staining solution for 30 min, and observed and photographed under an ultraviolet gel imager. The electrophoresis results are shown in Figure 1 Figure 1 ​As shown in the results, the linear shRNA RpA in the third lane was digested after RNase R enzyme treatment, while the circular circ-shRNA RmA in the fifth lane was not digested after RNase R enzyme treatment. The experimental results prove that the synthesis of the circular shRNA is completed.

[0078] Test Example 2: Function verification of circ-shRNA RmA

[0079] 1. Construction of 293T cell line stably expressing Renilla luciferase reporter gene

[0080] The Renilla luciferase reporter gene was constructed into the modified lentiGuide puro plasmid of CRISPR / cas9.

[0081] The lentiGuide puro plasmid was co-transfected into 293T cells together with two other lentivirus packaging plasmids PMDG.2 and psPAX2, and the virus supernatant was collected 48 h after transfection. The virus supernatant was used to infect 293T cells, and 24-48 h after infection, puromycin was used for screening to obtain a 293T cell line stably expressing the Renilla luciferase reporter gene. Among them, the 293T cell line contains the DBR1 (RNA debranching enzyme 1) gene, which is responsible for degrading the lariat RNA produced during the splicing process, i.e., containing the DBR1 gene can cleave the 2', 5'-phosphodiester bond.

[0082] 2. circ-shRNA RmA transfection experiment

[0083] Linear shRNA and circular shRNA synthesized in Example 1, Comparative Example 1, Comparative Example 2, Comparative Example 3, Comparative Example 4, and Comparative Example 5 were transfected into the 293T cell line stably expressing the Renilla luciferase reporter gene using Lipofectamine 3000 reagent, and after 48-72 h of culture, cell lysis solution was added to each group of cells, and after centrifugation, the supernatant was used as the substrate for luciferase activity detection. When detecting the luciferase activity, each group was designed with a blank control (BC) adding only the substrate. The expression results of the Renilla luciferase reporter gene in each group are shown in Table Figure 2 Figure 2 A in Table A shows the results of shRNARpA in Comparative Example 2 and shRNA FpA in Comparative Example 3 knocking down the Renilla luciferase reporter gene, and it can be seen from Table A that Figure 2 A in Table A shows the results of shRNARpA in Comparative Example 2 and shRNA FpA in Comparative Example 3 knocking down the Renilla luciferase reporter gene, and it can be seen from Table A that Figure 2 ​The results of knocking down of Renilla luciferase reporter gene by circ-shRNA RmA in Example 1 and circ-shRNA FmA in Comparative Example 1 can be seen in Table B, Figure 2 As can be seen in Table B, transfection of circ-shRNA RmA connected by 2', 5'-phosphodiester bond into 293T cell line stably expressing Renilla luciferase reporter gene can significantly inhibit the expression of the gene (P<0.05); Figure 2 The results of knocking down of Renilla luciferase reporter gene by circ-shRNA RpA in Comparative Example 4 and circ-shRNA FpA in Comparative Example 5 can be seen in Table C, Figure 2 As can be seen in Table C, transfection of circ-shRNA RpA connected by 3', 5'-phosphodiester bond into 293T cell line stably expressing Renilla luciferase reporter gene by the method of circularization using T4 RNA ligase 2 cannot inhibit the expression of the gene. The results show that circ-shRNA RmA connected by 2', 5'-phosphodiester bond of the application can still significantly inhibit the expression of Renilla luciferase reporter gene in 293T cell line stably expressing Renilla luciferase reporter gene.

[0084] The above experimental results show that the circular shRNA connected by 2', 5'-phosphodiester bond of the application can exert the function of shRNA nucleic acid drug gene knockdown, the method of the application can obtain circular shRNA with gene knockdown function, and the application provides a new direction for developing novel nucleic acid drugs for knocking down gene expression, and has broad application prospects.

[0085] The above-mentioned is only an embodiment of the application, and does not limit the patent scope of the application, and any equivalent structure or equivalent process transformation using the content of the specification of the application, or direct or indirect application in other related technical fields, are also included in the patent protection scope of the application.

Claims

1. A method for synthesizing a circular shRNA with gene knockdown function, characterized in that, The ends of linear shRNA are circularized by linking them with 2′,5′-phosphodiester bonds to form circular shRNA; The nucleotide sequence of the circular shRNA is shown in SEQ ID No.

1.

2. The method for synthesizing circular shRNA according to claim 1, characterized in that, Add 3′-deoxyadenosine to the 3′ end of the shRNA to convert the triphosphate at the 5′ end of the shRNA into a monophosphate.

3. The method for synthesizing circular shRNA according to claim 2, characterized in that, 3′-deoxyadenosine was added using E. coli Poly(A) polymerase.

4. The method for synthesizing circular shRNA according to claim 2, characterized in that, shRNA was treated with RNA 5′ pyrophosphate hydrolase.

5. The method for synthesizing circular shRNA according to claim 1, characterized in that, The cyclization was carried out in a reaction system of MES buffer and EDAC solution.

6. The method for synthesizing circular shRNA according to claim 5, characterized in that, The concentration of the EDAC solution is 200-300 mM.

7. A circular shRNA with gene knockdown function synthesized by the synthetic method according to any one of claims 1-6, wherein the nucleotide sequence of the circular shRNA is shown in SEQ ID No.

1.

8. The circular shRNA according to claim 7, characterized in that, The gene with gene knockdown function includes the René luciferase reporter gene.

9. The use of the circular shRNA according to any one of claims 7-8 in the preparation of a drug for knocking down the function of the Renal luciferase reporter gene.

Citation Information

Patent Citations

  • Nucleic acid delivery vectors comprising cyclic single-stranded polynucleotides

    CN114846138A

  • Circular RNA platforms, uses thereof, and their manufacturing processes from engineered DNA

    US20230235337A1