A molecular marker affecting body weight traits of sheep and application thereof
By screening molecular markers that influence the weight trait of Suffolk sheep through genome association analysis, and using marker 1 and marker 2, individuals with specific genotypes were selected as parents, which solved the problem of improving the weight trait of Suffolk sheep and achieved a significant increase in the weight and growth rate of offspring.
Patent Information
- Application Number
- CN202510983273.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-17
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2045-07-17
AI Technical Summary
Existing technologies are insufficient to effectively improve the growth rate and meat production performance of Suffolk sheep, especially in terms of weight traits.
Through genome association analysis, molecular markers affecting sheep weight traits were screened out, specifically marker one (nucleotide sequence such as SEQ ID NO.1, T to C mutation at 101bp) and marker two (nucleotide sequence such as SEQ ID NO.2, A to G mutation at 101bp). Furthermore, SNP loci associated with sheep chromosome 4 were screened out through genome-wide association analysis for the identification of large-weight sheep and for genetic breeding.
By selecting individuals with specific genotypes as parents, the offspring's weight was significantly increased to over 84 kg, thus enhancing the growth rate and meat production performance of Suffolk sheep.
Smart Images

Figure CN120464759B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic breeding, and particularly relates to a molecular marker affecting the body weight trait of sheep and application thereof. BACKGROUND
[0002] Suffolk sheep is one of the large meat sheep breeds in the world, which is obtained by crossing the Southdown sheep as the father and the old type black head horned Norfolk sheep with large body size and high lean meat rate as the mother. The high growth rate and high quality meat of Suffolk sheep can shorten the breeding cycle, reduce the feed cost and improve the breeding income.
[0003] With the increasing demand of consumers for high-quality mutton, the high-end meat products of Suffolk sheep have broad market prospects. Body weight is an important indicator for measuring the growth trait of Suffolk sheep. In order to further improve the growth rate and meat production performance of Suffolk sheep, it is necessary to mine the molecular marker affecting the body weight trait of Suffolk sheep through genome association analysis. SUMMARY
[0004] To solve the above problems, the present application relates to a molecular marker affecting the body weight trait of sheep and application thereof, which can be used for identifying the body weight trait of sheep and breeding sheep with large body weight.
[0005] The present application is realized by the following technical solutions:
[0006] The molecular marker affecting the body weight trait of sheep comprises marker one and / or marker two.
[0007] The nucleotide sequence of the molecular marker one is shown in SEQ ID NO. 1, and a T to C mutation occurs at the site of 101bp.
[0008] The nucleotide sequence of the molecular marker two is shown in SEQ ID NO. 2, and an A to G mutation occurs at the site of 101bp.
[0009] The molecular marker is used for identifying the body weight trait of sheep.
[0010] Preferably, identifying the body weight trait of sheep comprises the following steps.
[0011] Genomic DNA in the blood of sheep is extracted.
[0012] The genomic DNA is fragmented to obtain DNA fragments, and then a library is constructed by using the DNA fragments, the library is sequenced, and sequencing data is obtained.
[0013] The sequencing data is subjected to identification and screening of a mutation site, and when the genotype of the marker one at 101bp on the sheep chromosome 4 is TT, the sheep is a large weight sheep; or when the genotype of the marker two at 101bp on the sheep chromosome 4 is AA, the sheep is a large weight sheep; and the large weight refers to a weight greater than 84kg.
[0014] Preferably, the length of the DNA segment is 320bp-380bp.
[0015] Preferably, the threshold of the whole genome association analysis is set as P=1 / 620054.
[0016] The molecular marker is applied in sheep genetic breeding.
[0017] Preferably, by selecting individuals with TT or AA genotypes as parents, the weight of offspring can be increased.
[0018] Preferably, the sheep is a Suffolk sheep.
[0019] Compared with the prior art, the present application has the following beneficial effects:
[0020] The molecular marker affecting the weight of sheep includes the marker one and / or the marker two; the nucleotide sequence of the molecular marker one is shown in SEQ ID NO. 1, and a T to C mutation occurs at 101bp; the nucleotide sequence of the molecular marker two is shown in SEQ ID NO. 2, and an A to G mutation occurs at 101bp. The present application screens the molecular marker affecting the weight of sheep through genome sequencing, identification of a mutation site, whole genome association analysis and the like, and the marker one and the marker two. The molecular marker is used for identifying the weight of sheep, and by selecting individuals with TT or AA genotypes as parents, the weight of offspring can be increased. BRIEF DESCRIPTION OF DRAWINGS
[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present application or the prior art, the drawings needed in the embodiments or the prior art description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.
[0022] Figure 1 It is a distribution diagram of SNPs in a 1Mb window of chromosome after quality control of the present application, and the left Y axis represents the name of the chromosome, and the upper X axis represents the window size.
[0023] Figure 2 It is a G matrix visualization diagram of the present application.
[0024] Figure 3 For the principal component analysis of the present application, the first two explained variance percentages PC1 and PC2 are taken as the X and Y axes.
[0025] Figure 4 The Manhattan Plots and QQ-plots of the present application show the GWAS results of Suffolk sheep body weight, and the significant SNPs in the whole genome are shown in red; A is the Manhattan plot of the Suffolk sheep body weight trait; B is the QQ plot of the Suffolk sheep body weight trait. DETAILED DESCRIPTION
[0026] In order to facilitate the understanding of the present application, the present application will be described more fully below, and the preferred embodiments of the present application will be given. However, the present application can be realized in many different forms, and is not limited to the embodiments described in the present application. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.
[0027] Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as commonly understood by those skilled in the art to which the present application belongs. The terms used in the present application in the specification of the present application are only for the purpose of describing the specific embodiments, and are not intended to limit the present application.
[0028] The technical solutions of the present application will be further described below in combination with specific embodiments.
[0029] EMBODIMENT
[0030] Test animals and phenotype sources:
[0031] The test sheep of the present application are all from Inner Mongolia Saieru Sheep Science and Technology Co., Ltd. The phenotypic records of the body weight traits of Suffolk sheep at one year old were measured from 2020 to 2024, as shown in Table 1. Blood samples of 300 Suffolk sheep individuals were collected, and all samples were immediately stored at -80℃ after collection, and transported to the laboratory on dry ice and stored at -80℃ for a long time.
[0032] Table 1 Description of Suffolk sheep body weight traits
[0033]
[0034] I. Genomic DNA extraction and quality control
[0035] DNA was extracted from blood samples using the phenol-chloroform method, and the DNA concentration, the absorption wavelength ratio of nucleic acids and proteins and phenolic substances (260 nm / 280 nm), and the absorption wavelength ratio of carbohydrates (260 nm / 230 nm) were detected using a spectrophotometer NanoDrop2000, and the DNA quality was evaluated by 1% agarose gel electrophoresis.
[0036] II. Library construction and sequencing
[0037] After the qualified genomic DNA sample was processed, the genomic DNA was randomly broken into 350 bp fragments using a Covaris ultrasonic disrupter. The DNA fragments were subjected to end repair, poly A addition, sequencing adapter addition, purification, PCR amplification, and other steps to complete the entire library preparation. After the library construction was completed, Qubit2.0 was used for preliminary quantification, and qPCR was used to accurately quantify the effective concentration of the library to ensure the quality of the library. After the library quality detection was qualified, sequencing was performed using the Huada MGI-T7 sequencing platform, and the sequencing mode was PE150 mode.
[0038] III. Identification, screening, and annotation of variant sites
[0039] After the raw sequencing data was subjected to quality control and pretreatment using fastp software version V0.20.0, sequencing data Clean reads data was obtained. The reference genome was indexed, and Burrows-Wheeler Aligner software version V0.7.17 was used to align the quality-controlled Clean reads data with the reference genome of sheep Oar_v4.0, GCF_000298735.2. SAMtools software version V1.8-20 was used to convert the aligned sam file to a bam file and sort the bam file. The MarkDuplicates program in Genome Analysis Toolkit software version V3.8 was used to remove duplicate data from the sorted bam file to obtain the final bam file. The final bam file was indexed, and the HaplotypeCaller module in GATK software was used for SNP variant detection. After obtaining the vcf file, VariantFiltration module was used for filtering. ANNOVAR software package was used for functional annotation of the detected gene variants. According to the location of the variant site on the reference genome and the gene location information on the reference genome, the region where the variant site occurred in the genome, such as the intergenic region, intron region, or CDS region, and the impact of the variant, such as synonymous and nonsynonymous mutations, can be obtained.
[0040] IV. Data quality control and population stratification correction
[0041] Call rate, MAF, HWE.
[0042] Genome-wide resequencing was performed on 300 individuals of Suffolk sheep to establish a genotype database, which generated a total of 17243.32 Gb of raw reads, and a total of 47506993 SNPs were obtained. The obtained genotyping data was subjected to quality control using Plink software version V1.90, and individuals with genotype call rate <98%, SNPs with call rate <98%, SNPs with minimum allele frequency <5%, and SNPs with Hardy-Weinberg equilibrium test P value <10 -6 Figure 1
[0043] The first five principal components were calculated using the “--pc5” parameter of Plink software version V1.90. PCA plot was drawn using R version V3.6.0, and the results are shown in Figure 2 Figure 2 Each small square represents the genetic relationship value between the first and last samples, and the smaller the value, the closer to light green, i.e. the two individuals are more distant, and vice versa. The test samples have population stratification, and the degree of genetic correlation between individuals is high, and the first five principal components need to be used as covariates to correct the population stratification of Suffolk sheep. The population was subjected to G matrix-based genomic kinship analysis using Plink v1.90, and the results are shown in Figure 3
[0044] V. Genome-wide association analysis
[0045] The fastGWA-mlm model in GCTA software version V1.94.0beta was used to perform association analysis between SNPs and body weight traits.
[0046] y=X snp β snp +X c β c +g+e
[0047] where y is the phenotype vector; Xsnp is the genotype vector, whose effect is β snp ; X c is the association matrix of gender, year of measurement and the first five PCAs as fixed covariates, whose corresponding coefficient is β c ; g is the vector of total genetic effect captured by the SNP-derived genetic relationship matrix, g ~ N(0, ); π is the vector of SNP-derived genetic relationship matrix, where all the non-diagonal elements are set to 0; e is the residual vector, e ~ N(0, ).
[0048] Due to the use of Bonferroni correction method, 0.05 / SNP number to determine the significance threshold of GWAS is too strict. After linkage disequilibrium, the independent SNPs are obtained for threshold value. The parameters are 50: window size, i.e. SNP number; 10: step length, i.e. SNP number; 0.2: r 2 value, one of the SNP pairs with LD greater than 0.2 is deleted. The threshold of whole genome significant association in the present application is adjusted to P=1 / 620054, which is the number of independent SNPs screened by LD. The genome inflation factor of test statistics, i.e. λ is calculated by the slope of linear regression between observed quantile and theoretical quantile in V3.6.0 version of R. The λ value of body weight trait is 0.971, indicating no genome expansion. Based on the resequencing data of 300 Suffolk sheep, 29 significant SNP sites related to body weight trait are detected, which are located on chromosome 1, 4, 6, 9, 14, 23 and 26, as shown in Table 2 and Figure 4 .
[0049] Table 2 Significant SNP sites related to one-year-old body weight trait
[0050]
[0051] Six, SNP affecting body weight trait of Suffolk sheep
[0052] Further study on the SNPs reaching the whole genome significance level shows that the T→C mutation at position 4460379 on chromosome 4 of Suffolk sheep genome can significantly affect the body weight trait of Suffolk sheep.
[0053] The association analysis of SNP site at position 4460379 on chromosome 4 of Suffolk sheep genome and body weight trait is as follows:
[0054] Table 3 Polymorphism of position 4460379 on chromosome 4 of Suffolk sheep genome
[0055]
[0056] Note: different lowercase letters represent significant differences, P <0.05, the same letter means no significant difference, P >0.05.
[0057] As shown in Table 3, for the individuals with genotype TT, the body weight is the largest; for the individuals with genotype CC, the body weight is the smallest.
[0058] In the whole genome association analysis, the SNP molecular marker at position 4460379 on chromosome 4 of Suffolk sheep genome reaches the whole genome significant level, as shown in Table 2, which indicates that the molecular marker is significantly related to the body weight trait of Suffolk sheep, and when the genotype of the molecular marker is TT, it is beneficial for Suffolk sheep to have a larger body weight, and the body weight is greater than 84 kg. The SNP gene frequency and genotype frequency at position 4460379 on chromosome 4 of Suffolk sheep genome are shown in Table 4.
[0059] Table 4 SNP gene frequency and genotype frequency at position 4460379 on chromosome 4 of Suffolk sheep genome
[0060]
[0061] The molecular marker containing T→C mutation site at position 4460379 on chromosome 4 is marker one, and the nucleotide sequence is shown in SEQ ID NO. 1, which is: CTCATTGGTTAAGGCTCCCAATCAGAAGATGCAGAAGAGTGACTGGGTGCAGAAGCTGTCATAGCTGTGCAAGGTGTCTTGGGTGGAAGGTGTCACAATTYACGTTACCTTCAGCATTTAAACTCAACCTTGGCGCTGCTGAGCGTGGTACTATGGCTGCACCACCACAATAGACTCTGAGGTGGGGGTGCGCTCCAAATG, Y is T / C. The nucleotide sequence shown in SEQ ID NO. 1 is 100 bp before and after the mutation site.
[0062] Further research on the SNP reaching the whole genome significant level found that A→G mutation at position 4460400 on chromosome 4 of Suffolk sheep genome can significantly affect the body weight trait of Suffolk sheep.
[0063] The association analysis of the SNP site at position 4460400 on chromosome 4 of Suffolk sheep genome and the body weight trait is as follows:
[0064] Table 5 Polymorphism at 4460400 on chromosome 4 of Suffolk sheep genome
[0065]
[0066] Note: different lowercase letters represent significant differences, P <0.05, the same letter means no significant difference, P >0.05.
[0067] As shown in Table 5, for individuals with genotype AA, the body weight is the largest; for individuals with genotype GG, the body weight is the smallest.
[0068] In the whole genome association analysis, the SNP molecular marker at 4460400 on chromosome 4 of Suffolk sheep genome reached the whole genome significant level, as shown in Table 2, which indicates that the molecular marker is significantly related to the body weight trait of Suffolk sheep, and when the genotype of the molecular marker is AA, it is beneficial for Suffolk sheep to have larger body weight, and the body weight is greater than 84 kg. The SNP gene frequency and genotype frequency at 4460400 on chromosome 4 of Suffolk sheep genome are shown in Table 6.
[0069] Table 6 SNP gene frequency and genotype frequency at 4460400 on chromosome 4 of Suffolk sheep genome
[0070]
[0071] The molecular marker containing A→G mutation site at 4460400 on chromosome 4 is marker two, and the nucleotide sequence is shown in SEQ ID NO. 2, which is TCAGAAGATGCAGAAGAGTGACTGGGTGCAGAAGCTGTCATAGCTGTGCAAGGTGTCTTGGGTGGAAGGTGTCACAATTTACGTTACCTTCAGCATTTAAYCTCAACCTTGGCGCTGCTGAGCGTGGTACTATGGCTGCACCACCACAATAGACTCTGAGGTGGGGGTGCGCTCCAAATGCCCAGTGGGGATGCGCCATCT, Y is A / G. The nucleotide sequence shown in SEQ ID NO. 2 is 100 bp before and after the mutation site.
[0072] Therefore, the Suffolk sheep of large body weight can be selected by the T→C mutation at the 4460379th site on the chromosome 4 of the Suffolk sheep genome, or the Suffolk sheep of large body weight can be selected by the A→G mutation at the 4460400th site on the chromosome 4 of the Suffolk sheep genome, and the individual with the TT or AA genotype is selected as the male parent or the female parent to improve the body weight of the offspring of the Suffolk sheep.
[0073] It should be noted that when the present application claims involving numerical ranges, it should be understood that each numerical range has two endpoints and any number between the two endpoints can be selected, and in order to prevent repetition, the present application describes the preferred embodiments.
[0074] The technical features of the above-described embodiments can be combined in any manner, and in order to make the description concise, all possible combinations of the technical features in the above-described embodiments are not described, however, as long as the combinations of the technical features do not exist contradictions, they should be considered as the scope of the present application.
[0075] The above-described embodiments only express several implementation manners of the present application, and the description is more specific and detailed, but it should not be understood as the limitation of the patent scope of the present application. For the ordinary skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims.
Claims
1. Use of a molecular marker genotype affecting the yearling weight trait in sheep for identifying the yearling weight trait in sheep, characterized in that, The molecular marker comprises molecular marker one and / or molecular marker two; The nucleotide sequence of the molecular marker one is shown as SEQ ID NO. 1, and the base at the site at 101 bp is T or C; The nucleotide sequence of the molecular marker two is shown as SEQ ID NO. 2, and the base at the site at 101 bp is A or G; The sheep is a Suffolk sheep.
2. Use of the molecular marker genotype of claim 1 in the genetic breeding of the one-year weight trait in sheep, characterized in that, The sheep is a Suffolk sheep.
Citation Information
Patent Citations
Molecular marker for identifying body weight of Zhongwei goats and application of molecular marker
CN118813829A