Ferroporphyrin MOFs-based electrochemical biosensor and preparation method and application thereof
By using iron porphyrin MOFs and bioassisted amplification strategies to construct electrochemical biosensors, the problem of insufficient detection sensitivity of troponin I in the prior art center was solved, and a high sensitivity detection of cardiotroponin I was achieved, with the detection limit as low as 3.54fg mL-1.
Patent Information
- Application Number
- CN202510691990.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-27
- Publication Date
- 2025-08-12
AI Technical Summary
The prior art is difficult to achieve high sensitivity and high specificity detection of cardiotropin I, especially in complex biological systems with low concentrations, and traditional enzyme-linked immunologic methods have poor detection effects.
Iron porphyrin MOFs are used as catalytic material, combined with bioassisted amplification strategy, electrochemical biosensors are constructed, catalytic amplification performance of methylene blue by iron porphyrin MOFs, and signal amplification is performed in combination with DNA aptamer technology to achieve high sensitivity detection of cardiotroponin I.
A high sensitivity detection of cardiotroponin I was achieved, with a detection range of 10fg mL-1 to 10ng mL-1, and a detection limit as low as 3.54fg mL-1, with excellent sensitivity, stability and reproducibility.
Smart Images

Figure CN120468249A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of electrochemical biosensors for detecting cardiac troponin I, and particularly relates to an electrochemical biosensor based on iron porphyrin MOFs, and a preparation method and application thereof. Background Art
[0002] Acute myocardial infarction (AMI) can cause irreversible cardiac damage and ultimately lead to heart failure. Therefore, early diagnosis of AMI is crucial for mitigating and preventing its progression. Cardiac troponin I (cTnI) is a key biomarker for AMI. Its high specificity, sensitivity, and long diagnostic window provide sufficient time for accurate and sensitive detection of myocardial damage. Clinically, enzyme-linked immunosorbent assays (ELISAs) are often used to detect AMI disease markers. However, this method struggles to accurately, sensitively, and rapidly detect AMI disease markers at low levels in early serum. Electrochemical biosensors combine the high sensitivity of electrochemical analysis with the high specificity of biological analysis, making them particularly suitable for low-concentration biological systems and providing powerful technical support for the detection of trace disease markers. Sensitivity is a crucial metric for measuring sensor analytical performance. Utilizing signal amplification materials with excellent catalytic properties and introducing efficient biological signal amplification strategies are crucial for improving the sensitivity of electrochemical biosensors.
[0003] Metal-Organic Framework (MOFs) is a type of crystalline porous material with a periodic network structure formed by self-assembly of inorganic metal central ions and organic ligands. The main components of MOFs are metal centers and organic ligands. They have rich catalytic active sites, high porosity, large specific surface area, and porous structure, which give them excellent catalytic performance. Zhou et al. (Sensors and Actuators B: Chemical, 2020, 324: 128724) embedded G4-hemin into NH2-MIL-53 (Al) to prepare a new type of MOF enzyme (G4-hemin@MOF), and used its catalytic signal amplification strategy to develop an electrochemical biosensor. Yu et al. (Chemical Communications, 2018, 54(84): 11901-11904.) successfully introduced PtNi alloy nanoclusters into the pores of MIL-101(Fe). Using PtNi@MIL-101(Fe) as an efficient electrocatalyst, they demonstrated excellent synergistic catalysis for MB and achieved highly sensitive detection of transcription factors. Although researchers have made great progress in catalytic signal amplification by encapsulating functionalized substances in MOFs, most MOFs themselves do not have electrocatalytic activity. Therefore, developing a MOF with excellent electrocatalytic activity for the detection of cardiac troponin I remains a challenging task. Summary of the Invention
[0004] The purpose of the present invention is to provide an electrochemical biosensor based on iron porphyrin MOFs, a preparation method thereof, and an application thereof in detecting cardiac troponin I. The electrochemical biosensor of the present invention is essentially an electrochemical biosensor for detecting cardiac troponin I.
[0005] The implementation process of the present invention is as follows:
[0006] A method for preparing an electrochemical biosensor based on iron porphyrin MOFs comprises the following steps:
[0007] (1) Preparation of iron porphyrin MOFs
[0008] (1.1) Dissolve ZrCl4 and benzoic acid in DMF, transfer the solution to a reactor, and perform a solvothermal reaction at 80-120°C;
[0009] (1.2) After the reaction is completed, tetracarboxyphenylporphyrin iron is added to the reactor, ultrasonically dissolved, and then subjected to a solvothermal reaction at 100-140°C. After the reaction is completed, the iron porphyrin MOFs are obtained after filtration, washing, and drying;
[0010] (2) Preparation of DNA3-MB-iron porphyrin MOFs complex
[0011] Iron porphyrin MOFs were added to a methylene blue solution for adsorption overnight, and the MB-iron porphyrin MOFs complex was obtained after centrifugation and washing, and the MB-iron porphyrin MOFs complex was dispersed in PBS (buffer) at pH = 7.4 for later use; the MB-iron porphyrin MOFs complex dispersion was mixed with DNA3 and incubated at room temperature, and the DNA3-MB-iron porphyrin MOFs complex was obtained after centrifugation, and the DNA3-MB-iron porphyrin MOFs complex was dispersed in PBS at pH = 7.4 to obtain a DNA3-MB-iron porphyrin MOFs complex dispersion;
[0012] (3) Preparation of electrochemical biosensors
[0013] (3.1) The polished and dried glassy carbon electrode (GCE) was immersed in HAuCl4 solution for electrochemical deposition to obtain the AuNPs-modified electrode DpAu / GCE;
[0014] (3.2) DNA1 was added dropwise to the modified GCE surface and incubated at room temperature overnight. DNA1 was immobilized on the GCE surface via Au-S to obtain the electrode DNA1 / DpAu / GCE;
[0015] (3.3) In order to block nonspecific active sites, bovine serum albumin was further incubated to obtain the electrode BSA / DNA1 / DpAu / GCE;
[0016] (3.4) Drop the aptamer onto the electrode and incubate at room temperature to obtain the electrode aptamper / BSA / DNA1 / DpAu / GCE;
[0017] (3.5) A mixture of 10 μL of cTnI at different concentrations and 10 U of Exo I was added to the electrode surface for incubation to achieve Exo I-induced cyclic shearing of the target and cyclic amplification of cTnI, thereby obtaining an electrode Exo I+cTnI / aptamper / BSA / DNA1 / DpAu / GCE.
[0018] (3.6) DNA2 was added dropwise to the electrode and incubated at room temperature to obtain the electrode DNA2 / ExoI+cTnI / aptamper / BSA / DNA1 / DpAu / GCE;
[0019] (3.7) The DNA3-MB-iron porphyrin MOFs complex dispersion was dropped onto the electrode and incubated at room temperature to obtain an electrochemical biosensor.
[0020] Furthermore, in step (1.1), the mass ratio of ZrCl4 to benzoic acid is 0.005:(0.1-0.2), and the mass volume ratio of benzoic acid to DMF is 0.15 g:(0.8-2) mL; in step (1.2), the mass ratio of ZrCl4 to tetracarboxyphenylporphyrin iron is 5:(2-3); in step (1.1), the time for the solvent thermal reaction at 80-120°C is 1-1.5 h; in step (1.2), the time for the solvent thermal reaction at 100-140°C is 11-13 h.
[0021] Furthermore, in step (2), the concentration of DNA3 was 1.5 μmol L -1 The volume ratio of MB-iron porphyrin MOFs complex dispersion to DNA3 was 10:1; the incubation time was 12 to 13 h.
[0022] Furthermore, in step (3.1), the mass percentage of the HAuCl4 solution is 1%; the potential of the electrochemical deposition is -0.2 V, and the deposition time is 30 s.
[0023] Furthermore, in step (3.2), the concentration of DNA1 was 1.5 μmol L -1 , the volume is 10 μL; in step (3.3), the volume of bovine serum albumin is 10 μL, the volume percentage concentration is 0.25%, and the incubation time is 30 to 40 min; the electrode BSA / DNA1 / DpAu / GCE is stored at 4 to 5°C for subsequent use.
[0024] Furthermore, in step (3.4), the volume of aptamer was 10 μL and the concentration was 2 μmol L -1 , the incubation time is 2 to 2.5 hours.
[0025] Furthermore, in step (3.5), the concentration range of cTnI was 10 fg mL -1 ~10ng mL -1 The incubation temperature is 37-40°C and the incubation time is 1-1.5h.
[0026] Furthermore, in step (3.6), the volume of DNA2 was 10 μL and the concentration was 1.5 μmol L -1 , the incubation time is 2 to 2.5 h; in step (3.7), the volume of the DNA3-MB-iron porphyrin MOFs complex dispersion is 10 μL, and the incubation time is 2.5 to 3 h.
[0027] Application of the electrochemical biosensor obtained by the above method in detecting cardiac troponin I.
[0028] The method for detecting cardiac troponin I using the electrochemical biosensor obtained by the above method comprises the following steps:
[0029] (1) The electrochemical biosensor was tested using a three-electrode system using an electrochemical workstation, with an Ag / AgCl electrode as the reference electrode, a platinum wire electrode as the auxiliary electrode, and the prepared electrochemical biosensor as the working electrode.
[0030] (2) SWV test was performed in pH 7.4 PBS with a potential range of -0.6 V to 0.2 V, and the SWV current response working curve of the electrochemical biosensor at different cTnI concentrations was plotted;
[0031] (3) Substituting the sample solution containing cTnI for different concentrations of cTnI for testing;
[0032] (4) The obtained SWV current response value is used to calculate the cTnI concentration of the sample to be tested through the working curve.
[0033] Positive effects of the present invention:
[0034] (1) The present invention synthesizes PCN-224(Fe) material using iron porphyrin with excellent catalytic activity as a ligand, which has significant catalytic amplification performance for the electrical signal molecule methylene blue (MB). In combination with the bio-assisted amplification strategy, an electrochemical aptamer sensor is constructed to achieve sensitive detection of cardiac troponin I (cTnI).
[0035] (2) The electrochemical biosensor constructed by the present invention achieves highly sensitive detection of cTnI with a detection range of 10 fg mL -1 ~10ng mL -1 , with a detection limit as low as 3.54 fg mL -1 The electrochemical biosensor exhibits excellent sensitivity, stability, and reproducibility, and has broad prospects for practical application. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] Figure 1 (AC) PXRD patterns, (DF) crystal structure diagrams, and (GI) SEM images of PCN-222(Fe), PCN-223(Fe), and PCN-224(Fe);
[0037] Figure 2 (A) FTIR spectra and (B) UV-visible absorption spectra of MB, MB-PCN-222(Fe), MB-PCN-223(Fe), and MB-PCN-224(Fe);
[0038] Figure 3Catalytic performance of (A, C) PCN-222, PCN-223, PCN-224 and (B, D) PCN-222(Fe), PCN-223(Fe), PCN-224(Fe) towards MB in pH = 5.5 and pH = 7.4 PBS;
[0039] Figure 4 Zeta potential of PCN-222(Fe), PCN-223(Fe), and PCN-224(Fe) in different PBSs;
[0040] Figure 5 ITC spectra of (A) MB titrated to pH = 5.5, (B) PCN-222(Fe), (C) PCN-223(Fe), and (D) PCN-224(Fe);
[0041] Figure 6 ITC spectra of MB titrated onto (A) PCN-222(Fe), (B) PCN-223(Fe), and (C) PCN-224(Fe) at pH 7.4.
[0042] Figure 7 For electrochemical biosensors in 5.0 mM [Fe(CN)6] 4- / 3- (A) CV and (B) EIS characterizations of the assembly process in solution system: (a) bare GCE, (b) DpAu / GCE, (c) DNA1 / DpAu / GCE, (d) BSA / DNA1 / DpAu / GCE, (e) aptamper / BSA / DNA1 / DpAu / GCE, (f) ExoI+cTnI / aptamper / BSA / DNA1 / DpAu / GCE, (g) DNA2 / ExoI+cTnI / aptamper / BSA / DNA1 / DpAu / GCE;
[0043] Figure 8 To optimize the effect of (A) DNA1 concentration (B) Exo I incubation time (C) Exo I dosage in electrochemical aptasensor detection;
[0044] Figure 9 (A) Different concentrations of cTnI (10fg mL -1 , 50fg mL -1 , 100fg mL -1 , 1pg mL -1 , 5pg mL -1 , 100 pg mL -1 , 1ng mL -1 , 10 ng mL -1) SWV response and (B) corresponding linear relationship, (C) selectivity, (D) continuous test stability, (E) storage stability, and (F) reproducibility of the constructed electrochemical aptasensor;
[0045] Figure 10 Application of the aptasensor in human serum samples (black line) and the standard calibration curve (red line);
[0046] Figure 11 Schematic diagram of the construction principle of the electrochemical aptamer sensing platform: (A) Preparation of DNA3-MB-PCN-224(Fe); (B) Schematic diagram of the electrochemical biosensor assembly process and the detection of cTnI using MB-PCN-224(Fe) as a signal probe. DETAILED DESCRIPTION
[0047] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Materials and reagents used are commercially available unless otherwise specified. The primary instrument used in the examples is an electrochemical workstation. All electrochemical tests were performed using a three-electrode system, with a modified glassy carbon electrode (GCE, Φ = 3 mm) as the working electrode, an Ag / AgCl electrode as the reference electrode, and a platinum wire as the auxiliary electrode.
[0048] All HPLC-purified oligonucleotides used in this study were provided by Shanghai Bioengineering. Before use, each DNA strand was heated at 95°C for 5 minutes, cooled naturally to room temperature, and the resulting DNA solution was stored in a refrigerator at 4°C for subsequent use. Ultrapure water was used throughout the experiments.
[0049] Table 1 Oligonucleotide sequences used in the experiment
[0050]
[0051] Note: 1. "TAAGAGGGGCAGCGCATGAG" in DNA1 and "CTCATGCGCTGCCCCTCTTA" in DNA2 are complementary sequences.
[0052] 2. The sequence "CTCATGCGCTGCCCCTCTTA" in cTnI aptamer is complementary to the sequence "TAAGAGGGGCAGCGCATGAG" in DNA1.
[0053] 3. DNA2 ATAGAACTCTGATTAG ” and DNA3 CTAATCAGAGTTCTAT " is a complementary sequence.
[0054] The electrochemical biosensor constructed by the present invention has satisfactory selectivity, stability and reproducibility, and has broad application prospects in biosensing.
[0055] In a first aspect, the present invention provides a method for preparing an electrochemical biosensor based on iron porphyrin MOFs, comprising the following steps:
[0056] (1) Preparation of iron porphyrin MOFs
[0057] (1.1) Dissolve ZrCl4 and benzoic acid in DMF, transfer the solution to a reactor, and perform a solvothermal reaction at 80-120°C for 1-1.5 hours; the mass ratio of ZrCl4 to benzoic acid is 0.005:(0.1-0.2), and the mass volume ratio of benzoic acid to DMF is 0.15 g:(0.8-2) mL; in step (1.2), the mass ratio of ZrCl4 to tetracarboxyphenylporphyrin iron is 5:(2-3);
[0058] (1.2) After the reaction is completed, tetracarboxyphenylporphyrin iron is added to the reactor, ultrasonically dissolved, and then solvothermal reaction is carried out at 100-140°C for 11-13 hours. After the reaction is completed, the iron porphyrin MOFs are obtained after filtration, washing, and drying;
[0059] (2) Preparation of DNA3-MB-iron porphyrin MOFs complex
[0060] Iron porphyrin MOFs were added to methylene blue solution for adsorption overnight, and MB-iron porphyrin MOFs complex was obtained after centrifugal washing and dispersed in 1 mL of PBS with pH = 7.4 for later use. The MB-iron porphyrin MOFs complex dispersion was mixed with 1.5 μmol L -1 DNA3 was mixed with MB and iron porphyrin MOFs at a volume ratio of 10:1 and incubated at room temperature for 12 to 13 hours. After centrifugation, a DNA3-MB-iron porphyrin MOFs complex was obtained, which was dispersed in 1 mL of PBS (pH = 7.4) to obtain a DNA3-MB-iron porphyrin MOFs complex dispersion.
[0061] (3) Preparation of electrochemical biosensors
[0062] (3.1) The polished and dried glassy carbon electrode (GCE) was immersed in a 1% by mass HAuCl4 solution for electrochemical deposition for 30 seconds at a potential of -0.2 V to obtain an Au NPs-modified electrode (DpAu / GCE).
[0063] (3.2) 10 μL of a 1.5 μmol L -1 DNA1 was added dropwise onto the modified GCE surface and incubated at room temperature overnight. It was then immobilized on the GCE surface via Au-S to obtain the electrode DNA1 / DpAu / GCE.
[0064] (3.3) To block nonspecific active sites, 10 μL of bovine serum albumin (BSA, 0.25% by volume) was dropped onto the electrode and incubated for 30–40 min to obtain a BSA / DNA1 / DpAu / GCE electrode, which was stored at 4–5°C for subsequent use.
[0065] (3.4) 10 μL of a 2 μmol L -1 The aptamer was dropped onto the electrode and incubated at room temperature for 2 to 2.5 h to obtain the electrode aptamper / BSA / DNA1 / DpAu / GCE;
[0066] (3.5) 10 μL of different concentrations (10 fg mL -1 ~10ng mL -1 A mixture of 100 μg of cTnI and 10 U of Exo I was added dropwise to the electrode surface and incubated at 37-40°C for 1-1.5 hours to achieve Exo I-induced cyclic shearing of the target and cyclic amplification of cTnI, thereby obtaining the electrode ExoI+cTnI / aptamper / BSA / DNA1 / DpAu / GCE.
[0067] (3.6) 10 μL of a 1.5 μmol L -1 DNA2 was added dropwise to the electrode and incubated at room temperature for 2 to 2.5 h to obtain the electrode DNA2 / Exo I+cTnI / aptamper / BSA / DNA1 / DpAu / GCE;
[0068] (3.7) 10 μL of DNA3-MB-iron porphyrin MOFs complex dispersion was dropped onto the electrode and incubated at room temperature for 2.5 to 3 h to obtain an electrochemical biosensor.
[0069] In a second aspect, the present invention provides an electrochemical biosensor for detecting cardiac troponin I prepared by the above method.
[0070] In a third aspect, the present invention provides an application of an electrochemical biosensor prepared by the above method in detecting cardiac troponin I.
[0071] In a fourth aspect, the present invention provides a method for detecting cardiac troponin I using the electrochemical biosensor obtained by the above method, comprising the following steps:
[0072] (1) The electrochemical biosensor was tested using a three-electrode system using an electrochemical workstation, with an Ag / AgCl electrode as the reference electrode, a platinum wire electrode as the auxiliary electrode, and the prepared electrochemical biosensor as the working electrode.
[0073] (2) SWV test was performed in pH 7.4 PBS with a potential range of -0.6 V to 0.2 V, and the SWV current response working curve of the electrochemical biosensor at different cTnI concentrations was plotted;
[0074] (3) Substituting the sample solution containing cTnI for different concentrations of cTnI for testing;
[0075] (4) The obtained SWV current response value is used to calculate the cTnI concentration of the sample to be tested through the working curve.
[0076] The electrochemical biosensor of the present invention and its preparation method and application are further described in detail below with reference to specific embodiments.
[0077] Example 1 Preparation of Iron Porphyrin MOFs
[0078] The preparation method of iron porphyrin MOFs comprises the following steps:
[0079] (1) ZrCl4 (5 mg) and benzoic acid (0.15 g) were ultrasonically dissolved in 1 mL DMF, placed in a 10 mL reactor, and subjected to solvothermal reaction at 100 °C for 1 h;
[0080] (2) After the reaction, tetracarboxyphenylporphyrin iron (TCPP(Fe)) (2.5 mg) was added to the above reactor, ultrasonically dissolved, and then subjected to a solvothermal reaction at 120°C for 12 h. After the reaction, the mixture was cooled to room temperature, and then centrifuged and washed with DMF and ethanol, and the product was collected and dried in an oven at 60°C to obtain iron porphyrin MOFs, which was recorded as PCN-224(Fe).
[0081] Comparative Example 1 Preparation of PCN-222
[0082] The preparation method of PCN-222 comprises the following steps:
[0083] (1) ZrCl4 (36.2 mg) was dissolved in DMF solvent (3.3 mL) by ultrasonication;
[0084] (2) Tetracarboxyphenylporphyrin (TCPP) (10.0 mg) and CF3COOH (0.15 mL) were dissolved in the solution obtained in step (1). After ultrasonic treatment for 20 min, the mixed solvent was placed in a 20 mL polytetrafluoroethylene-lined reactor and subjected to solvent thermal reaction at 120 ° C for 24 h. After the reaction was completed, it was cooled to room temperature, and then centrifuged and washed with DMF and ethanol and the product was collected and dried in an oven at 60 ° C to obtain PCN-222.
[0085] Comparative Example 2 Preparation of PCN-222(Fe)
[0086] The preparation method of PCN-222(Fe) is the same as that of Comparative Example 1, except that the amount of ZrCl4 is replaced by 15 mg, TCPP is replaced by TCPP(Fe), the amount of TCPP(Fe) is 5 mg, CF3COOH is replaced by 0.2 g of benzoic acid, and the amount of DMF is 4 mL.
[0087] Comparative Example 3 Preparation of PCN-223
[0088] The preparation method of PCN-223 comprises the following steps:
[0089] ZrCl4 (3.5 mg), TCPP (5 mg) and acetic acid (0.35 mL) were ultrasonically dissolved in 1 mL of DMF, and then the mixed solution was placed in a 10 mL reactor and subjected to solvent thermal reaction at 120 ° C for 12 h. After the reaction was completed, it was cooled to room temperature, and then centrifuged and washed with DMF and ethanol and the product was collected and dried in an oven at 60 ° C to obtain PCN-223.
[0090] Comparative Example 4 Preparation of PCN-223(Fe)
[0091] The preparation method of PCN-223(Fe) is the same as that of Comparative Example 1, except that the amount of acetic acid is replaced by 0.55 mL, and TCPP is replaced by TCPP(Fe).
[0092] Comparative Example 5 Preparation of PCN-224
[0093] The preparation method of PCN-224 comprises the following steps:
[0094] (1) ZrCl4 (30 mg), TCPP (10 mg) and benzoic acid (0.4 g) were dissolved in 4 mL of DMF by ultrasonication;
[0095] (2) The above solution was placed in a 20 mL reactor and subjected to a solvent thermal reaction at 120 °C for 24 h. After the reaction was completed, it was cooled to room temperature, and then centrifuged and washed with DMF and ethanol to collect the product, and dried in an oven at 60 °C to obtain PCN-224.
[0096] Example 2 Preparation of Iron Porphyrin MOFs
[0097] The preparation method of iron porphyrin MOFs comprises the following steps:
[0098] (1) ZrCl4 (5 mg) and benzoic acid (0.1 g) were ultrasonically dissolved in 0.8 mL DMF, placed in a 10 mL reactor, and subjected to solvothermal reaction at 80 °C for 1.5 h;
[0099] (2) After the reaction, TCPP(Fe) (2 mg) was added to the above reactor, ultrasonically dissolved, and then subjected to a solvent thermal reaction at 140°C for 11 h. After the reaction, it was cooled to room temperature, and then centrifuged and washed with DMF and ethanol to collect the product, and dried in an oven at 60°C to obtain iron porphyrin MOFs.
[0100] Example 3 Preparation of Iron Porphyrin MOFs
[0101] The preparation method of iron porphyrin MOFs comprises the following steps:
[0102] (1) ZrCl4 (5 mg) and benzoic acid (0.2 g) were ultrasonically dissolved in 2 mL of DMF, placed in a 10 mL reactor, and subjected to solvothermal reaction at 120 °C for 1 h;
[0103] (2) After the reaction, TCPP(Fe) (3 mg) was added to the above reactor, dissolved by ultrasonication, and then subjected to a solvothermal reaction at 100 °C for 13 h. After the reaction, the mixture was cooled to room temperature, washed by centrifugation with DMF and ethanol, and the product was collected and dried in an oven at 60 °C to obtain iron porphyrin MOFs.
[0104] Example 4 Taking PCN-224 (Fe) obtained in Example 1 as an example, an electrochemical biosensor was prepared. A method for preparing an electrochemical biosensor based on iron porphyrin MOFs comprises the following steps:
[0105] (1) Preparation of DNA3-MB-PCN-224(Fe) complex
[0106] 20 mg of PCN-224(Fe) was added to 4 mL of methylene blue solution (MB, 25 mg L -1 ) overnight, followed by centrifugation and washing to obtain MB-PCN-224(Fe), which was then dispersed in 1 mL of PBS (pH 7.4) for later use. The MB-PCN-224(Fe) dispersion was mixed with DNA3 at a volume ratio of 10:1 and incubated at room temperature for 12 h. DNA3-MB-PCN-224(Fe) was obtained after centrifugation and dispersed in 1 mL of PBS (pH 7.4) for later use.
[0107] (2) Preparation of electrochemical biosensors
[0108] (2.1) The polished and dried glassy carbon electrode (GCE) was immersed in a 1% by mass HAuCl4 solution for electrochemical deposition for 30 seconds at a potential of -0.2 V to obtain an Au NPs-modified electrode (DpAu / GCE).
[0109] (2.2) 10 μL of a 1.5 μmol L -1 DNA1 was added dropwise onto the modified GCE surface and incubated at room temperature overnight. DNA1 was immobilized on the GCE surface via Au-S to obtain the electrode DNA1 / DpAu / GCE.
[0110] (2.3) To block nonspecific active sites, 10 μL of bovine serum albumin (BSA, 0.25% by volume) was dropped onto the electrode and incubated for 30 min to obtain the BSA / DNA1 / DpAu / GCE electrode, which was stored at 4°C for subsequent use.
[0111] (2.4) 10 μL of a 2 μmol L -1 The aptamer was dropped onto the electrode and incubated at room temperature for 2 h to obtain the electrode aptamper / BSA / DNA1 / DpAu / GCE;
[0112] (2.5) 10 μL of different concentrations (10 fg mL -1 ~10ng mL -1 A mixture of 100 μg of cTnI and 10 U of Exo I was added dropwise to the electrode surface and incubated at 37°C for 1 hour to achieve Exo I-induced cyclic shearing of the target and achieve the purpose of cyclic amplification of cTnI, thus obtaining the electrode Exo I + cTnI / aptamper / BSA / DNA1 / DpAu / GCE;
[0113] (2.6) 10 μL of a 1.5 μmol L -1 DNA2 was added dropwise onto the electrode and incubated at room temperature for 2 h to obtain the electrode;
[0114] (2.7) 10 μL of DNA3-MB-PCN-224(Fe) dispersion was added dropwise to the electrode and incubated at room temperature for 2.5 h to obtain the electrochemical biosensor DNA3-MB-PCN-224(Fe) / DNA2 / ExoI+cTnI / aptamper / BSA / DNA1 / DpAu / GCE.
[0115] Example 5 Taking PCN-224 (Fe) obtained in Example 1 as an example, an electrochemical biosensor was prepared. A method for preparing an electrochemical biosensor based on iron porphyrin MOFs comprises the following steps:
[0116] (1) Preparation of DNA3-MB-PCN-224(Fe) complex
[0117] 20 mg of PCN-224(Fe) was added to 4 mL of methylene blue solution (MB, 25 mg L -1) overnight, followed by centrifugation and washing to obtain MB-PCN-224(Fe), which was then dispersed in 1 mL of PBS (pH 7.4) for later use. The MB-PCN-224(Fe) dispersion was mixed with DNA3 at a volume ratio of 10:1 and incubated at room temperature for 13 h. DNA3-MB-PCN-224(Fe) was obtained after centrifugation and dispersed in 1 mL of PBS (pH 7.4) for later use.
[0118] (2) Preparation of electrochemical biosensors
[0119] (2.1) The polished and dried glassy carbon electrode (GCE) was immersed in a 1% by mass HAuCl4 solution for electrochemical deposition for 30 seconds at a potential of -0.2 V to obtain an Au NPs-modified electrode (DpAu / GCE).
[0120] (2.2) 10 μL of a 1.5 μmol L -1 DNA1 was added dropwise onto the modified GCE surface and incubated at room temperature overnight. DNA1 was immobilized on the GCE surface via Au-S to obtain the electrode DNA1 / DpAu / GCE.
[0121] (2.3) To block nonspecific active sites, 10 μL of bovine serum albumin (BSA, 0.25% by volume) was dropped onto the electrode and incubated for 40 min to obtain the BSA / DNA1 / DpAu / GCE electrode, which was stored at 5°C for subsequent use.
[0122] (2.4) 10 μL of a 2 μmol L -1 The aptamer was dropped onto the electrode and incubated at room temperature for 2.5 h to obtain the electrode aptamper / BSA / DNA1 / DpAu / GCE;
[0123] (2.5) 10 μL of different concentrations (10 fg mL -1 ~10ng mL -1 A mixture of 100 μg of cTnI and 10 U of Exo I was added dropwise to the electrode surface and incubated at 40°C for 1.5 h to achieve Exo I-induced cyclic shearing of the target and cyclic amplification of cTnI, thereby obtaining the electrode ExoI+cTnI / aptamper / BSA / DNA1 / DpAu / GCE.
[0124] (2.6) 10 μL of a 1.5 μmol L -1DNA2 was added dropwise to the electrode and incubated at room temperature for 2.5 h to obtain the electrode DNA2 / Exo I+cTnI / aptamper / BSA / DNA1 / DpAu / GCE;
[0125] (2.7) 10 μL of DNA3-MB-iron porphyrin MOFs complex dispersion was dropped onto the electrode and incubated at room temperature for 3 h to obtain an electrochemical biosensor.
[0126] Example 6 Detection Method
[0127] A method for detecting cardiac troponin I using the electrochemical biosensor obtained by the above method comprises the following steps:
[0128] (1) The electrochemical biosensor was tested using a three-electrode system using an electrochemical workstation, with an Ag / AgCl electrode as the reference electrode, a platinum wire electrode as the auxiliary electrode, and the prepared electrochemical biosensor as the working electrode.
[0129] (2) SWV test was performed in pH 7.4 PBS with a potential range of -0.6 V to 0.2 V, and the SWV current response working curve of the electrochemical biosensor at different cTnI concentrations was plotted;
[0130] (3) Substituting the sample solution containing cTnI for different concentrations of cTnI for testing;
[0131] (4) The obtained SWV current response value is used to calculate the cTnI concentration of the sample to be tested through the working curve.
[0132] Characterization and performance testing:
[0133] (1) Characterization of PCN-222(Fe), PCN-223(Fe), and PCN-224(Fe)
[0134] The structures of PCN-222(Fe), PCN-223(Fe) and PCN-224(Fe) were characterized by powder X-ray diffraction (PXRD). Figure 1 The PXRD in Figure A shows that characteristic diffraction peaks appear at 2.4°, 4.78°, 6.68°, 7.1°, 8.2° and 9.8°, which are consistent with the simulated single crystal data of PCN-222(Fe). Figure 1 To (ACS Applied Materials & Interfaces, 2021, 13(34): 40847-40852). Figure 1Characteristic diffraction peaks appear at 4.7°, 7.0°, 9.5°, and 9.7° in B, which have no obvious changes compared with the standard simulation diagram of PCN-223(Fe) and have high phase purity (ACS Applied Materials & Interfaces, 2017, 9(39): 33539-33543). Figure 1 The main characteristic diffraction peaks appear at 4.5°, 6.4°, 7.9°, 9.1°, and 11.2° in C, which are consistent with the standard simulation pattern of PCN-224(Fe) (ACS Applied Materials & Interfaces, 2022, 14(45): 50751-50761). The above results confirm the successful synthesis of PCN-222(Fe), PCN-223(Fe), and PCN-224(Fe). Figure 1 DF shows the topological structures of PCN-222(Fe), PCN-223(Fe), and PCN-224(Fe). The different topological structures of the three MOFs are derived from Zr 4+ The different coordination abilities of ions lead to different pore sizes and distances between active sites of TCPP(Fe). The morphology and size of the three MOFs were observed using scanning electron microscopy (SEM). Figure 1 As shown in GI, the prepared PCN-222(Fe) exhibits a uniform nanorod morphology with a size of approximately 200nm×70nm, PCN-223(Fe) exhibits a spindle-shaped morphology with a length of approximately 400 to 600nm, and PCN-224(Fe) is a uniform hexagonal particle with a size ranging from 150 to 300nm.
[0135] (2) Characterization of MB-PCN-222(Fe), MB-PCN-223(Fe), and MB-PCN-224(Fe)
[0136] In order to prove the synthesis of MB-PCN-222(Fe), MB-PCN-223(Fe) and MB-PCN-224(Fe), their peak positions and absorbances were analyzed by FTIR spectroscopy and UV-vis. Figure 2 As shown in A, compared with the characteristic peak of the FTIR spectrum of PCN material, at 1487 cm -1 、1132cm -1 MB's unique FTIR characteristic peak appeared at 1487 cm -1 The absorption peak at the peak position may be related to the deformation vibration of methyl or methylene (-CH3 or -CH2-). -1 This peak may be caused by the stretching vibration of CS. To further prove this, UV-vis analysis was performed. Figure 2 B. A significant change in the UV-visible absorbance of the PCN material before and after MB adsorption was observed. The absorbance after MB adsorption was lower than before adsorption, indicating that MB was effectively adsorbed onto the PCN material. The above two characterization results preliminarily demonstrate the successful preparation of MB-PCN-222(Fe), MB-PCN-223(Fe), and MB-PCN-224(Fe).
[0137] (3) Study on the catalytic performance of PCN-222(Fe), PCN-223(Fe) and PCN-224(Fe)
[0138] In order to study the catalytic performance of the synthesized PCN material, methylene blue (MB) was selected as the redox signal molecule, and the SWV current response of the PCN material to MB was tested under different experimental conditions. The present invention studies the effect of pH on the charge of the material. Electrochemical tests were carried out on six materials, PCN-222, PCN-223, PCN-224, PCN-222(Fe), PCN-223(Fe), and PCN-224(Fe), in pH=5.5PBS and pH=7.4PBS, respectively. The results are as follows Figure 3 A and C show that the catalytic effects of PCN-222, PCN-223, and PCN-224 on MB are not obvious in either pH 5.5 or pH 7.4 PBS. Figure 3 As shown in Figures B and D, PCN-222(Fe), PCN-223(Fe), and PCN-224(Fe) exhibit significantly stronger catalytic effects on MB in pH 7.4 PBS than in pH 5.5 PBS. A significant reduction current can be detected in pH 7.4 PBS, with PCN-224(Fe) exhibiting a current response of 18.68 μA. Compared with PCN-222(Fe) (ΔI = 6.30 μA) and PCN-223(Fe) (ΔI = 9.32 μA), PCN-224(Fe) exhibits the highest SWV current response. This suggests that pH affects the charge of the material, which in turn affects the contact between MB and the catalytic site, leading to differences in catalytic strength. From the above test results, it can be seen that PCN materials (PCN-222(Fe), PCN-223(Fe), PCN-224(Fe)) exhibit better catalytic performance in pH = 7.4 PBS, and the synthesized PCN-222(Fe), PCN-223(Fe), PCN-224(Fe) materials have better catalytic performance than PCN-222, PCN-223, and PCN-224 in pH = 5.5 and pH = 7.4 PBS.
[0139] The Zeta potential test was then carried out and the results were as follows Figure 4As shown in the figure, PCN-222(Fe), PCN-223(Fe) and PCN-224(Fe) materials are positively charged in pH = 5.5 PBS and negatively charged in pH = 7.4 PBS. Since MB is positively charged, based on the basic principle of "like charges repel and opposite charges attract", it is shown that in pH = 7.4 PBS, there is an electrostatic binding effect between PCN-222(Fe), PCN-223(Fe) and PCN-224(Fe) and MB.
[0140] (4) Study on the affinity of PCN-222(Fe), PCN-223(Fe) and PCN-224(Fe) for MB
[0141] Isothermal titration calorimetry experiments were performed to investigate the interaction between PCN materials (PCN-222(Fe), PCN-223(Fe), PCN-224(Fe)) and MB in solutions with different pH values. Figure 5 It is the ITC thermogram tested in pH=5.5 PBS. Figure 5 A is the heat change caused by background when MB is titrated against PBS. Figure 5 BD is the ITC thermogram of MB titrating PCN-222(Fe), PCN-223(Fe), and PCN-224(Fe). By comparison, it is found that the ITC thermograms of MB titrating PBS and MB titrating PCN materials are basically consistent, indicating that when pH = 5.5, there is almost no interaction between PCN material and MB, which means that the catalytic effect is not obvious under the action of electrostatic repulsion.
[0142] Figure 6 The ITC thermograms are obtained from a pH 7.4 PBS test. As can be seen from the figure, the three thermograms for MB titration of PCN-222(Fe), PCN-223(Fe), and PCN-224(Fe) all exhibit strong negative peaks, indicating that the interaction between MB and the PCN materials occurs via an exothermic pathway. Table 2 lists some key thermodynamic parameters. In all three data sets, ΔH < 0 and T·ΔS > 0 were obtained, indicating that the three systems exhibit both enthalpic contributions and entropic driving forces. This indicates that the binding between the PCN materials and MB is driven by both enthalpy and entropy, suggesting that van der Waals forces, hydrogen bonds, and hydrophobic interactions may be involved in the reaction. Negative enthalpy values indicate that the interaction between MB and the PCN materials is more favorable than the interaction between these two substances and the buffer. Positive entropy values indicate that the environment surrounding the binding site becomes more disordered after interaction with MB. Compared with PCN-222(Fe) and PCN-223(Fe), PCN-224(Fe) has the strongest affinity for MB, which can be explained by the large positive binding constant (K a =4.760×10 5 M -1) and a more negative Gibbs free energy change (ΔG = -32.41 kJ mol -1 The results showed that PCN-224(Fe) had a stronger binding force with MB and a stronger catalytic effect. The results of ITC were consistent with the response order of SWV.
[0143] Table 2 Thermodynamic parameters of MB titration of PCN-222(Fe), PCN-223(Fe) and PCN-224(Fe)
[0144]
[0145] (5) Application of the electrochemical biosensor prepared in Example 4 in detecting cardiac troponin I
[0146] Electrochemical tests: SWV tests were performed in pH 7.4 PBS with a potential range from -0.6 V to 0.2 V. The scan rate of CV characterization was set to 0.1 V s -1 The potential range was set to -0.2 V to 0.6 V. The test frequency of EIS characterization was selected in the range of 0.01 Hz to 100 kHz, and the AC voltage was kept constant and set to 5 mV. The test substrate for CV and EIS characterization was [Fe(CN)6] containing KCl (0.1 M). 4- / 3- solution (5 mM).
[0147] (5.1) CV and EIS characterization of the assembly process of the electrochemical biosensor prepared in Example 4
[0148] The present invention is in 5mM [Fe (CN) 6] 4- / 3- In solution, CV and EIS were used to characterize the assembly process of the electrode interface. Figure 7As can be seen in Figure 1, due to the excellent conductivity of AuNPs, the CV peak of DpAu / GCE shows a significant increase compared to bare GCE (curve a) (curve b). When DNA1 is modified onto DpAu / GCE, the CV peak decreases significantly due to the negative charge of DNA1 (curve c). Subsequently, the inactive BSA is modified onto DNA1 / DpAu / GCE, hindering electron transfer, and the CV peak decreases again (curve d). After incubation with aptamer, the negatively charged DNA layer on the electrode surface increases, and the CV response current decreases again (curve e). When the target cTnI is present, the CV response current significantly improves. This is because the aptamer specifically binds to cTnI, and Exo I can hydrolyze the aptamer in the cTnI / aptamer complex, triggering a cyclic amplification process of the target, resulting in the release of a large amount of aptamer from the electrode surface, which further leads to an increase in the CV peak (curve f). After the introduction of DNA2 onto the electrode surface, the CV response current decreases (curve g), which is mainly attributed to the hindrance of charge transfer by the inactive DNA sequence.
[0149] The assembly process of the electrochemical biosensor was further characterized by EIS. et ) is reflected by the semicircle diameter. The larger the diameter, the greater the charge transfer impedance. Figure 7 As shown in B, the bare GCE presents a small semicircle (curve a), indicating that the R et When the bare GCE was modified with AuNPs, the semicircle basically disappeared and turned into a straight line (curve b), indicating that the excellent conductivity of AuNPs promoted electron diffusion. As DNA1, BSA and cTnI aptamers were successively modified on the sensing interface, the semicircle diameter continued to increase (curves c, d and e), that is, R et This is mainly attributed to the formation of DNA sequence and protein molecular layer which hinders the [Fe(CN)6] 4- / 3- Transfer to the electrode surface. When cTnI and Exo I are incubated on the electrode surface, the semicircle becomes significantly smaller (curve f). This is because the specific recognition of cTnI and aptamer and the cyclic shearing process assisted by Exo I significantly reduce the aptamer on the electrode surface, resulting in a decrease in interface resistance. After incubation with DNA2, it can be seen from curve g that R et The value increased significantly. In summary, the analysis results of CV characterization and EIS characterization are consistent, indicating the successful assembly of the electrochemical biosensor.
[0150] (5.2) Optimization of experimental conditions for the electrochemical biosensor prepared in Example 4
[0151] In order to improve the detection performance of the sensing platform, the concentration of DNA1, the amount of Exo I and the incubation time of Exo I were optimized in this work. First, the effect of DNA1 concentration on the construction of the sensing platform was studied. Figure 8 As shown in Figure A, when the DNA1 concentration increases from 0.5 to 2.5 μM, the SWV current response first increases rapidly and then decreases slightly. Therefore, a DNA1 concentration of 1.5 μM was selected as the optimal concentration for this sensing platform. In addition, the amount of Exo I was also optimized. Figure 8 As shown in Figure B, the changes in SWV current response were recorded when the dosage of Exo I increased from 4U to 25U. It can be seen that as the dosage of Exo I increased from 4U to 10U, the SWV current response showed a trend of continuous growth. When the dosage of Exo I increased further, that is, from 10U to 25U, the SWV current response showed a slightly downward trend, indicating that the optimal dosage of Exo I for this sensing platform is 10U. Next, the effect of the incubation time of Exo I on the construction of this sensing platform was further explored. Figure 8 As shown in Figure C, when the incubation time of Exo I was changed from 15 min to 60 min, the SWV current response increased with the increase of Exo I incubation time, and decreased slightly after the incubation time exceeded 60 min, indicating that 60 min was the optimal condition for the target cyclic amplification process in this experiment. Therefore, 60 min was selected as the optimal incubation time for Exo I in subsequent experiments.
[0152] (5.3) Response performance of the electrochemical biosensor prepared in Example 4 to cTnI
[0153] Electrochemical tests were performed under incubation with different concentrations of cTnI, and the corresponding SWV current responses were recorded. Figure 9 As can be seen from A and B, the SWV current response value of the sensing platform showed an increasing trend with the increase of the concentration of the target cTnI, and at 10fg mL -1 ~10ng mL -1 Within the linear range, the SWV current response value of the sensing platform showed a good linear relationship with the logarithm of cTnI concentration (R 2 =0.996), and the corresponding linear regression equation is: I = -4.716lg c -3.88, and the calculated detection limit is 3.54fg mL -1 (3σ / k).
[0154] The electrochemical biosensor constructed in the present invention exhibited a wider linear range and lower detection limit compared to previously reported methods for cTnI detection listed in Table 3. The excellent sensitivity can be attributed to the large loading capacity of PCN-224(Fe), its efficient catalytic activity, and Exo I-assisted target cyclic amplification.
[0155] Table 3 Comparison of various methods for detecting cTnI
[0156]
[0157] The detailed information of the above-mentioned documents is as follows:
[0158] Document 1: Sun Y., Wen L., Ma H., et al. Engineering trienzyme cascade-triggered fluorescent immunosensor platform by sequentially integrating alkaline phosphatase, tyrosinase and horseradish peroxidase [J]. Chinese Chemical Letters, 2023, 34(4): 107654.
[0159] Document 2: Yin
[0160] Document 3: Wu Z., Liu S., Li Y., et al. Electrochemiluminescence resonance energy transfer system fabricated by quantum state complexes for cardiactroponin I detection [J]. Sensors and Actuators B: Chemical, 2021, 336: 129733.
[0161] Document 4: Feng J., Li N., Du Y., et al. Ultrasensitive double-channel microfluidicbiosensor-based cathodic photo-electrochemical analysis viasignal amplification ofSOD-Au@PANI for cardiac troponin I detection[J]. Analytical Chemistry, 2021, 93(42):14196-14203.
[0162] Document 5: Jiang F., Liu S., Dong H., et al. Self-powered photoelectrochemicalimmunosensor with triple enhanced photoelectric response for sensitive detection of cTnI[J]. Sensors and Actuators B: Chemical, 2023, 393: 134234.
[0163] Document 6: Wang Z, Zhao H, Chen K, et al. Sandwich-type electrochemical aptasensor based on HMCS@PDA@AuNPs and PtCu DNs / MUN-CuO-TiO2 for ultrasensitive detection of cardiac troponin I[J]. Sensors and Actuators B: Chemical, 2023, 393: 134275.
[0164] (5.4) Selectivity, stability and reproducibility of the electrochemical biosensor prepared in Example 4
[0165] In order to explore the selectivity of the constructed electrochemical biosensor for cTnI detection, electrochemical tests were performed by selecting different interfering substances (such as Hb, IgG, HSA and BSA). Figure 9 C shows that under the same experimental conditions, when the target cTnI (1 ng mL -1 ) was 100 times the concentration of the other four interfering substances (100 ng mL -1) was substituted, the sensing platform showed a significant SWV current signal for the target cTnI, while the other four interferents had no significant SWV current signal compared to the blank. In addition, when the four interferents and cTnI coexisted, the current signal was almost the same as that of cTnI alone, which shows that the proposed detection system has excellent anti-interference ability. To further explore the stability of the sensing platform, the SWV curves of continuous cycle scanning (n=10) were recorded. Figure 9 As shown in Figure D, it can be seen that there is basically no difference in the SWV current signals of the 10 scans (RSD = 2.8%, n = 10), indicating that the stability of the electrochemical biosensor is relatively excellent. Next, the storage stability of the sensing platform was further studied, and a batch of successfully prepared electrochemical aptamer sensors (BSA / DNA1 / Au / GCE) were stored in a refrigerator at 4°C for 21 days. The stored electrodes were taken out every 2 to 4 days on average, and the electrochemical biosensor was modified according to the above experimental process, and the corresponding SWV current signal response was recorded. Figure 9 E can be seen that the SWV current signal after 21 days only decreased by 11.86% compared with the initial SWV current signal intensity, with no significant fluctuation, which shows that the sensing platform has an ideal long-term storage capacity. In addition, the reproducibility of the electrochemical biosensor is also an important manifestation of the detection of cTnI. Figure 9 As shown in Figure F, the intra-batch and inter-batch differences of the electrochemical biosensor were explored by monitoring the SWV current values. The results showed that both intra-batch and inter-batch experiments showed similar SWV current values, and the calculated RSDs were 1.5% and 0.98%, respectively, verifying that the constructed electrochemical biosensor has excellent reproducibility.
[0166] (5.5) Analysis of cTnI in human serum
[0167] To investigate the analytical feasibility and potential of the constructed electrochemical biosensor in clinical applications, the constructed biosensor was used to detect the content of cTnI in diluted healthy human serum (50-fold diluted with PBS, obtained from the Northwest University Hospital). Five parallel samples were obtained by adding different concentrations of cTnI to healthy human serum for a spike recovery experiment. Linear regression analysis was performed on these samples. The results are shown in Figure 2. Figure 10 (black line) shows that the correlation coefficient reaches 0.9997, showing an excellent linear relationship. The results show that the calibration curve of the actual sample ( Figure 10 black line) and the standard curve ( Figure 10The red line (red line) exhibited similar slopes, demonstrating the suitability of the proposed aptasensor for real-world sample analysis. Spike recovery experiments were also conducted using the linear regression equation (I = -4.551lgc - 5.049) for real-world samples. As shown in Table 4, the recoveries and RSDs ranged from 97.56% to 103.5% and 0.20% to 0.96%, respectively. These results demonstrate that the proposed analytical method exhibits excellent analytical performance in human serum and is suitable for the sensitive detection of cTnI in real-world samples.
[0168] Table 4. Recovery of cTnI in human serum samples using the biosensor (n=3)
[0169]
[0170] The PCN-224 (Fe) with the best electrochemical performance screened out by the present invention is loaded with the electrical signal molecule methylene blue (MB), and the prepared MB-PCN-224 (Fe) composite material is used as a signal probe to construct an electrochemical aptamer sensor for detecting cTnI. The target cyclic shearing process is assisted by exonuclease I (Exo I), which achieves effective signal amplification and improves the sensitivity of detection. Exo I-mediated signal amplification has the advantages of simplicity and convenience. When assisting the target shearing cycle, it only needs to be added to the reaction system without further operation. In addition, in order to further improve the stability of the electrochemical biosensor, DNA3 is fixed to the PCN-224 (Fe) surface using a Zr-OP covalent bond, eliminating the instability of the interaction between the two. The specific steps are as follows. Figure 11 As shown, gold is first deposited on the GCE surface, DNA1 is fixed to the electrode surface through Au-S bonds, and BSA is used to block nonspecific active sites. In the presence of the target cTnI, the cTnI aptamer chain specifically binds to the target cTnI, and then, with the assistance of Exo I, the aptamer is cleaved, causing cTnI to be released again to participate in the circulation and unlocking a large amount of capture probe DNA1. Subsequently, the auxiliary probe DNA2 hybridizes with DNA1 and DNA3, capturing the MB-PCN-224 (Fe) signal probe on the electrode surface to achieve electrical signal amplification. The electrochemical biosensor constructed by the present invention achieves highly sensitive detection of the target cTnI.
[0171] Those skilled in the art will readily appreciate other embodiments of the present application after considering the specification and practicing the contents disclosed herein. This application is intended to cover any variations, uses, or adaptations of the present application that follow the general principles of the present application and include common knowledge or customary techniques in the art that are not disclosed in this application. The description and examples are to be considered merely as exemplary, and the present application is not limited to the precise structures described above and shown in the drawings, and various modifications and variations may be made without departing from the scope thereof.
Claims
1. A method for preparing an electrochemical biosensor based on iron porphyrin MOFs, characterized in that: The steps include: (1) Preparation of iron porphyrin MOFs (1.1) Dissolve ZrCl4 and benzoic acid in DMF, transfer the solution to a reactor, and perform a solvothermal reaction at 80-120°C; (1.2) After the reaction is completed, tetracarboxyphenylporphyrin iron is added to the reactor, ultrasonically dissolved, and then subjected to a solvothermal reaction at 100-140°C. After the reaction is completed, the iron porphyrin MOFs are obtained after filtration, washing, and drying; (2) Preparation of DNA3-MB-iron porphyrin MOFs complex Iron porphyrin MOFs were added to a methylene blue solution for adsorption overnight, and the MB-iron porphyrin MOFs complex was obtained after centrifugation and washing, and the complex was dispersed in PBS at pH = 7.4 for later use; the MB-iron porphyrin MOFs complex dispersion was mixed with DNA3 and incubated at room temperature, and the DNA3-MB-iron porphyrin MOFs complex was obtained after centrifugation, and the complex was dispersed in PBS at pH = 7.4 to obtain a DNA3-MB-iron porphyrin MOFs complex dispersion; (3) Preparation of electrochemical biosensors (3.1) The polished and dried glassy carbon electrode (GCE) was immersed in HAuCl4 solution for electrochemical deposition to obtain the AuNPs-modified electrode DpAu / GCE; (3.2) DNA1 was added dropwise to the modified GCE surface and incubated at room temperature overnight. DNA1 was immobilized on the GCE surface via Au-S to obtain the electrode DNA1 / DpAu / GCE; (3.3) In order to block nonspecific active sites, bovine serum albumin was dropped onto the electrode and incubated to obtain the electrode BSA / DNA1 / DpAu / GCE; (3.4) Drop the aptamer onto the electrode and incubate at room temperature to obtain the electrode aptamper / BSA / DNA1 / DpAu / GCE; (3.5) A mixture of 10 μL of cTnI at different concentrations and 10 U of Exo I was added to the electrode surface for incubation to achieve Exo I-induced cyclic shearing of the target and cyclic amplification of cTnI, thereby obtaining an electrode Exo I+cTnI / aptamper / BSA / DNA1 / DpAu / GCE. (3.6) DNA2 was added dropwise to the electrode and incubated at room temperature to obtain the electrode DNA2 / Exo I+cTnI / aptamper / BSA / DNA1 / DpAu / GCE; (3.7) The DNA3-MB-iron porphyrin MOFs complex dispersion was dropped onto the electrode and incubated at room temperature to obtain an electrochemical biosensor.
2. The method for preparing an electrochemical biosensor based on iron porphyrin MOFs according to claim 1, characterized in that: In step (1.1), the mass ratio of ZrCl4 to benzoic acid is 0.005:(0.1-0.2), and the mass volume ratio of benzoic acid to DMF is 0.15 g:(0.8-2) mL; in step (1.2), the mass ratio of ZrCl4 to tetracarboxyphenylporphyrin iron is 5:(2-3); in step (1.1), the solvent thermal reaction time at 80-120°C is 1-1.5 h; in step (1.2), the solvent thermal reaction time at 100-140°C is 11-13 h.
3. The method for preparing an electrochemical biosensor based on iron porphyrin MOFs according to claim 1, characterized in that: In step (2), the concentration of DNA3 was 1.5 μmol L -1 The volume ratio of MB-iron porphyrin MOFs complex dispersion to DNA3 was 10:1; the incubation time was 12 to 13 h.
4. The method for preparing an electrochemical biosensor based on iron porphyrin MOFs according to claim 1, characterized in that: In step (3.1), the mass percentage of the HAuCl4 solution is 1%; the potential of the electrochemical deposition is -0.2 V, and the deposition time is 30 s.
5. The method for preparing an electrochemical biosensor based on iron porphyrin MOFs according to claim 1, characterized in that: In step (3.2), the concentration of DNA1 was 1.5 μmol L -1 , the volume is 10 μL; in step (3.3), the volume of bovine serum albumin is 10 μL, the volume percentage concentration is 0.25%, and the incubation time is 30 to 40 min; the electrode BSA / DNA1 / DpAu / GCE is stored at 4 to 5°C for subsequent use.
6. The method for preparing an electrochemical biosensor based on iron porphyrin MOFs according to claim 1, characterized in that: In step (3.4), the volume of aptamer is 10 μL and the concentration is 2 μmol L -1 , the incubation time is 2 to 2.5 hours.
7. The method for preparing an electrochemical biosensor based on iron porphyrin MOFs according to claim 1, characterized in that: In step (3.5), the concentration range of cTnI was 10 fg mL -1 ~10ng mL -1 The incubation temperature is 37-40°C and the incubation time is 1-1.5h.
8. The method for preparing an electrochemical biosensor based on iron porphyrin MOFs according to claim 1, characterized in that: In step (3.6), the volume of DNA2 is 10 μL and the concentration is 1.5 μmol L -1 , the incubation time is 2 to 2.5 h; in step (3.7), the volume of the DNA3-MB-iron porphyrin MOFs complex dispersion is 10 μL, and the incubation time is 2.5 to 3 h.
9. Use of the electrochemical biosensor obtained by the method of claim 1 in detecting cardiac troponin I.
10. A method for detecting cardiac troponin I using an electrochemical biosensor obtained by the method of claim 1, characterized in that: The steps include: (1) The electrochemical biosensor was tested using a three-electrode system using an electrochemical workstation, with an Ag / AgCl electrode as the reference electrode, a platinum wire electrode as the auxiliary electrode, and the prepared electrochemical biosensor as the working electrode. (2) SWV test was performed in pH 7.4 PBS with a potential range of -0.6 V to 0.2 V, and the SWV current response working curve of the electrochemical biosensor at different cTnI concentrations was plotted; (3) Substituting the sample solution containing cTnI for different concentrations of cTnI for testing; (4) The obtained SWV current response value is used to calculate the cTnI concentration of the sample to be tested through the working curve.