Application of mulberry bark extract in preparation of medicine for preventing and / or treating ischemia-reperfusion injury

Abstract

The invention relates to the technical field of medicines, in particular to application of mulberry bark extract in preparation of medicines for preventing and / or treating ischemia-reperfusion injury, and finds that morusin administration treatment can effectively relieve pathological injury of mouse liver tissue, reduce activity of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum after hepatic ischemia-reperfusion, and can be used for preparing medicines for preventing and / or treating ischemia-reperfusion injury. The expression of inflammatory cytokines is inhibited, and the proportion of apoptotic cells is remarkably reduced. The invention further finds that the morusin inhibits the expression of 15-hydroxyeicosapentaenoic acid (15-HETE), and the protection effect of the morusin on the HIRI can be reversed by adding the 15-HETE, so that the morusin can be used for inhibiting the expression of the 15-hydroxyeicosapentaenoic acid (15-HETE).

Description

Technical Field

[0001] The present invention relates to the field of pharmaceutical technology, and in particular to use of a mulberry bark extract in preparing a medicine for preventing and / or treating ischemia-reperfusion injury. Background Art

[0002] Hepatic ischemia reperfusion injury (HIRI) refers to the pathophysiological phenomenon in which cellular damage in ischemic liver tissue worsens after blood flow and oxygen are restored. In clinical practice, HIRI is a common complication after liver resection and liver transplantation, and is a high-risk factor for liver dysfunction and transplant rejection, which greatly affects the therapeutic effect of liver surgery. The pathogenesis of HIRI is complex, including inflammatory response, oxidative stress, metabolic disorders, calcium overload, apoptosis and other pathophysiological mechanisms. Currently, many treatments targeting these pathogenic factors have been explored clinically, but the treatment effects still cannot meet clinical needs. Therefore, in-depth exploration of the pathogenesis of HIRI and the search for effective treatment strategies are currently urgent medical issues that need to be addressed.

[0003] Morusin, an enoyl flavonoid extracted from mulberry bark, possesses multiple biological activities, including antioxidant, anti-inflammatory, and anti-aging activities. Morusin has demonstrated significant protective effects in ischemic disease research. Morusin can inhibit activation of the nuclear factor kappa-B (NF-κB) signaling pathway, thereby alleviating interleukin-mediated inflammatory responses. Morusin can also regulate cell apoptosis through the phosphatidylinositol 3-kinase (PI3K) signaling pathway. Although shikonin is involved in regulating pathophysiological mechanisms such as inflammation and apoptosis, its role in HIRI remains unclear. Summary of the Invention

[0004] The present invention aims to provide the use of a mulberry bark extract in the preparation of a medicament for preventing and / or treating ischemia-reperfusion injury. The present invention found that administration of mulberry bark extract effectively alleviated pathological damage in mouse liver tissue, reduced serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activity after hepatic ischemia-reperfusion, inhibited the expression of inflammatory cytokines, and significantly reduced the proportion of apoptotic cells. The present invention further found that mulberry bark extract inhibited the expression of 15-hydroxyeicosapentaenoic acid (15-HETE), and that the addition of 15-HETE reversed the protective effect of mulberry bark extract against HIRI.

[0005] The present invention solves the technical problem by adopting the following technical solutions: In a first aspect, the present invention provides use of a mulberry bark extract in preparing a medicament for preventing and / or treating ischemia-reperfusion injury.

[0006] In one or more embodiments of the present invention, the ischemia-reperfusion injury is liver ischemia-reperfusion injury or cerebral ischemia-reperfusion injury.

[0007] In one or more embodiments of the present invention, the mulberry bark extract is used for preparing a medicament for preventing and / or treating liver ischemia-reperfusion injury.

[0008] In one or more embodiments of the present invention, the mulberry bark extract is used for preparing a medicament for preventing liver ischemia-reperfusion injury.

[0009] In one or more embodiments of the present invention, the mulberry bark extract is morin.

[0010] In one or more embodiments of the present invention, the sansinol is used for preparing a drug for preventing or treating liver ischemia-reperfusion injury.

[0011] In one or more embodiments of the present invention, the sansinol is used for preparing a drug for preventing liver ischemia-reperfusion injury.

[0012] In one or more embodiments of the present invention, the sansinol is used as a medicine to treat liver ischemia-reperfusion injury by inhibiting 15-HETE.

[0013] The present invention includes the following beneficial effects: The present invention discovered through in vivo and in vitro experiments that sangxinsu can significantly inhibit inflammatory responses and reduce liver ischemia-reperfusion injury. Furthermore, the present invention discovered that sangxinsu can inhibit 15-HETE-mediated inflammatory responses, thereby alleviating HIRI. Compared with the prior art, the present invention has developed a new use for sangxinsu, which can reduce liver ischemia-reperfusion injury, has the characteristics of low toxicity and minimal side effects, can be industrially synthesized, and is inexpensive, providing new means and methods for clinically reducing liver ischemia-reperfusion injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Schematic diagram of the histological results of HIRI in mice treated with sansin, where A is the experimental process design diagram of the mouse HIRI model, B is the H&E staining results of liver tissue of each group of mice, and C is the liver histological injury score results of each group of mice.

[0015] Figure 2This is a schematic diagram of the serological results of HIRI in mice treated with sansin, where A is the serum ALT expression level of mice in each group, and B is the serum AST expression level of mice in each group.

[0016] Figure 3 Schematic diagram of Tunel staining results of liver tissue apoptosis after HIRI in mice treated with sansin.

[0017] Figure 4 Schematic diagram of the fluorescence staining results of CD11b-positive inflammatory cells in the liver tissue of mice after HIRI was treated with sansin.

[0018] Figure 5 This is a schematic diagram of the expression of inflammatory cytokines in liver tissue after HIRI in mice was treated with sansin, A is the expression level of interleukin 1β (IL-1β) mRNA in the liver tissue of each group of mice, B is the expression level of interleukin 6 (IL-6) mRNA in the liver tissue of each group of mice, and C is the expression level of tumor necrosis factor α (TNF-α) mRNA in the liver tissue of each group of mice.

[0019] Figure 6 This is a schematic diagram of the expression results of 15-HETE in the liver tissues of each group of mice after HIRI of mice was treated with sansin.

[0020] Figure 7 This is the result of CCK8 in which Sancin improves H / R-induced liver cell damage through 15-HETE.

[0021] Figure 8 This is a schematic diagram of the results of improving the expression of inflammatory cytokines in hepatocytes induced by H / R by sansin through 15-HETE. A is the expression level of IL-1β mRNA in the hepatocytes of each group, B is the expression level of IL-6 mRNA in the hepatocytes of each group, and C is the expression level of TNF-α mRNA in the hepatocytes of each group.

[0022] Unless stated otherwise, the terms used in the specification and claims have the following meanings.

[0023] As used herein, the term "prevention" refers to preventing the occurrence of a disease and / or preventing the recurrence of a disease. DETAILED DESCRIPTION

[0024] While the present invention specification describes specific embodiments in detail, those skilled in the art should recognize that the following embodiments are illustrative and are not to be construed as limiting the present invention. Those skilled in the art will appreciate that improvements and modifications to the present invention, without departing from the principles of the present invention, will be made, and that the resulting technical solutions will fall within the scope of the claims. The following examples illustrate the beneficial effects of the present invention.

[0025] Example 1 Experimental study on the therapeutic effect of sansinol on liver ischemia-reperfusion injury in mice

[0026] 1. Animals and Materials Sources of materials: Morusin (S0915) was purchased from Selleck; C57BL / 6J mice were purchased from Beijing Huafukang Biotechnology Co., Ltd.; HE staining kit (C0105S) was purchased from Beyotime Biotechnology Co., Ltd.; ALT detection kit (C009-2-1) and AST detection kit (C010-2-1) were purchased from Nanjing Jiancheng Bioengineering Institute; Tunel staining kit (C1089) was purchased from Beyotime Biotechnology Co., Ltd.; CD11b antibody (GB115689-50) was purchased from Sevier Biotechnology Co., Ltd.; TOYOBO RNA reverse transcription kit and real-time fluorescence quantitative PCR kit were purchased from Sichuan Aishike Biotechnology Co., Ltd.

[0027] 2. Animal Grouping and Dosing Twenty mice were randomly divided into the PBS+Sham group (PBS+sham operation), the Morusin+Sham group (Morusin+sham operation), the PBS+IR group (PBS+liver ischemia-reperfusion injury), and the Morusin+IR group (Morusin+liver ischemia-reperfusion injury).

[0028] Mice in the morusin+sham and morusin+IR groups received intraperitoneal injections of 20 mg / kg each time 24 hours and 2 hours before model establishment, respectively. Morusin was dissolved in DMSO (80 mg / ml) and diluted 100-fold in PBS before use. Mice in the PBS+sham and PBS+IR groups received the same volume of control solution (prepared with a volume ratio of 1% DMSO and 99% PBS).

[0029] 3. Construction of Mouse HIRI Model A mouse HIRI model was established by occluding blood flow to the left and middle lobes of the liver. The following steps were performed: 1% sodium pentobarbital (50 mg / kg) was injected intraperitoneally to anesthetize the mouse. After full anesthesia, the mouse was secured in the supine position on an operating table. The abdominal tissue was disinfected with iodine and the abdominal cavity was opened along the midline using sterile ophthalmic scissors. A saline-soaked cotton swab was used to fully expose the hepatic hilum. A sterile arterial clamp was used to occlude the common trunk vessels of the left and middle lobes of the liver. Successful occlusion resulted in a rapid gray-yellow discoloration of the liver tissue. The abdominal cavity was then covered with saline-soaked gauze. After 60 minutes of blood flow occlusion, the clamp was removed and blood flow to the left and middle lobes was restored, resulting in a rapid return of the liver tissue to a bright red color. The abdominal cavity was sutured and the mouse was placed on a water bath blanket to maintain body temperature until fully awake. Water and food were freely available during reperfusion. Liver tissue and serum samples were collected at the scheduled reperfusion time. Control mice were not subjected to blood flow occlusion, and the remaining procedures were identical to those for HIRI mice. The left lobe of mouse liver tissue was fixed in 4% paraformaldehyde; the middle lobe of liver tissue was cut and placed into cryovials, quickly frozen in liquid nitrogen, and stored in a −80°C freezer; mouse blood was collected by cardiac exsanguination, centrifuged (3500 rpm / min, 15 minutes), and stored in a −80°C freezer.

[0030] 4. Result detection 4.1 H&E staining Paraffin sections were thoroughly dewaxed using xylene I / II for 5-10 minutes each, followed by rehydration through graded ethanol (100%, 95%, 85%, 75%) for 5 minutes each. Nuclei were stained with hematoxylin for 3-5 minutes. After rinsing with running water, sections were differentiated with 1% hydrochloric acid-alcohol for 30 seconds to remove nonspecific cytoplasmic staining. The sections were then blued with ammonia or running water for 5-10 minutes to develop a vibrant blue nuclear chromatin. Cytoplasmic counterstaining was performed with 0.5% eosin solution for 30 seconds to 3 minutes, with the specific duration depending on the tissue type. After staining, sections were dehydrated through graded ethanol (75%, 85%, 95%, 100%) for 1 minute each, cleared twice with xylene for 3-5 minutes each, and mounted with neutral gum.

[0031] Figure 1 Schematic diagram of the histological results of HIRI in mice treated with sansin, where A is the experimental process design diagram of the mouse HIRI model, B is the H&E staining results of liver tissue of each group of mice, and C is the liver histological injury score results of each group of mice.

[0032] 4.2 Serum ALT and AST testing Use the ALT and AST detection kits from Nanjing Jiancheng Bioengineering Institute and follow the instructions as follows. Remove the serum from the -80°C freezer and thaw on ice. Add 20 μl of matrix solution to all wells, add 5 μl of the sample to be tested to the measurement wells, and incubate at 37°C for 30 minutes. Add 20 μl of 2,4-dinitrophenylhydrazine solution to all wells, add 5 μl of the sample to be tested to the control wells, and incubate at 37°C for 20 minutes. Add 200 μl of sodium hydroxide solution to all wells and leave at room temperature for 15 minutes. Use an enzyme reader to detect the absorbance at 510 nm, and calculate the corresponding values of each sample with reference to the ALT and AST standard curves.

[0033] Figure 2 This is a schematic diagram of the serological results of HIRI in mice treated with sansin, where A is the serum ALT expression level of mice in each group, and B is the serum AST expression level of mice in each group.

[0034] 4.3 Tunel staining Paraffin sections were deparaffinized with xylene (15 minutes x 2) and rehydrated with graded ethanol (100% to 75% for 5 minutes each). Cell samples were fixed with 4% paraformaldehyde for 20–30 minutes. The sections were then permeabilized with 0.1% Triton X-100 for 5–20 minutes to enhance membrane permeability. After three washes with PBS, proteinase K (20 μg / mL, incubated at 37°C for 15–30 minutes) was added dropwise to expose DNA breakage sites. TUNEL reaction solution (containing TdT enzyme and luciferin-dUTP) was prepared according to the kit's instructions. After covering the tissue, the sections were incubated in a humidified chamber at 37°C in the dark for 60 minutes. Positive controls required pretreatment with DNase I to induce DNA breakage, while negative controls omitted TdT enzyme. After the reaction, unbound reagents were removed with extensive PBS washes. Cell nuclei were counterstained with DAPI for 5 minutes, and sections were mounted with antiquencher. Images were acquired and observed under a fluorescence microscope.

[0035] Figure 3 Schematic diagram of Tunel staining results of liver tissue apoptosis after HIRI in mice treated with sansin.

[0036] 4.4 Immunofluorescence staining Paraffin sections were preheated in a 65°C oven for 30 minutes, then deparaffinized by immersion in xylene I / II for 10 minutes each, rehydrated in graded ethanol (100%, 95%, 85%, and 70%) for 5 minutes each, and washed three times with PBS. Antigen retrieval was performed using a microwave-heated pH 6.0 citrate buffer (high for 8 minutes, off for 8 minutes, and medium-low for 7 minutes). The sections were cooled and then washed with PBS. Nonspecific binding was blocked by incubation with a blocking buffer containing 5% goat serum and 1% BSA for 1 hour at room temperature. CD11b primary antibody was added dropwise and incubated overnight at 4°C. The sections were then rewarmed the next day for 30 minutes and washed with PBS. A fluorescent secondary antibody (1:400 dilution) was added and incubated for 1 hour at room temperature in the dark. After washing with PBS, nuclear staining with DAPI was performed for 10 minutes. Finally, the sections were mounted with anti-quenching mounting medium and observed under a microscope.

[0037] Figure 4 Schematic diagram of the fluorescence staining results of CD11b-positive inflammatory cells in the liver tissue of mice after HIRI was treated with sansin.

[0038] 4.5 Relative mRNA expression RNA extraction: Approximately 50 mg of tissue was ground into a powder in liquid nitrogen and lysed with TRIzol reagent. The chloroform layer was separated and centrifuged to extract total RNA. Concentration and purity were determined spectrophotometrically (an A260 / A280 ratio of 1.8-2.0 was considered acceptable). cDNA was synthesized using a reverse transcription kit by mixing 1 μg of total RNA with an Oligo(dT) primer and extending at 50°C for 15 minutes.

[0039] PCR assay: Primer sequences for IL-1β (F: GCAACTGTTCCTGAACTCAACT, R: ATCTTTTGGGGTCCGTCAACT); IL-6 (F: TAGTCCTTCCTACCCCAATTTCC, R: TTGGTCCTTAGCCACTCCTIC); and TNF-α (F: CCCTCACACTCAGATCATCTTCT, R: GCTACGACGTGGGCTACAG). The PCR reaction system consisted of SYBR Green Premix Ex Taq, cDNA template, and primers. Amplification was performed using 40 cycles of pre-denaturation at 95°C for 30 seconds, denaturation at 95°C for 5 seconds, and annealing at 60°C for 30 seconds. Reference genes β-actin or GAPDH were used as controls, and relative mRNA expression was calculated using the 2-ΔΔCt method based on the Ct values of real-time fluorescence quantitative PCR.

[0040] Figure 5This is a schematic diagram of the expression of inflammatory cytokines in liver tissue after HIRI in mice was treated with sansin, A is the expression level of interleukin 1β (IL-1β) mRNA in the liver tissue of each group of mice, B is the expression level of interleukin 6 (IL-6) mRNA in the liver tissue of each group of mice, and C is the expression level of tumor necrosis factor α (TNF-α) mRNA in the liver tissue of each group of mice.

[0041] 5. Experimental Results from Figure 1 It can be seen that compared with the PBS+Sham group, the PBS+IR group had necrosis in the liver tissue of mice, and the area of necrotic tissue in the liver tissue was significantly reduced after treatment with sansin. Figure 2 It was found that IR led to increased expression of ALT and AST in the serum of mice, while treatment with sansinol significantly reduced the levels of ALT and AST in serum, indicating that sansinol can improve liver function damage caused by HIRI. Figure 3 The results confirmed that sansin treatment reduced the number of apoptotic cells caused by HIRI. Figure 4 and Figure 5 The results confirmed that sxs treatment inhibited the infiltration of inflammatory cells and the release of inflammatory cytokines IL-1β, IL-6, and TNF-α after HIRI. These results indicate that sxs can alleviate the inflammatory response, cell apoptosis, and liver damage caused by HIRI.

[0042] Example 2 Effect of sansinol on the regulation of 15-HETE expression during liver ischemia-reperfusion injury in mice

[0043] 1. Animals and Materials Experimental materials: Mouse 15-hydroxyeicosatetraenoic acid (15-HETE) enzyme-linked immunosorbent assay (ELISA) kit, purchased from Shanghai Keaibo Biotechnology Co., Ltd. The rest of the experimental materials are the same as those in Example 1.

[0044] 2. Experimental Methods The grouping and model preparation were the same as those described in Example 1.

[0045] 3. Result detection 15-HETE Assay: Use the 15-HETE enzyme-linked immunosorbent assay kit. Take 100 mg of liver tissue, add a defined amount of PBS, and homogenize thoroughly using a homogenizer. Centrifuge for 20 minutes (3000 rpm). Collect the supernatant for analysis. Set up blank wells and test sample wells. Add 40 μl of sample diluent to the test sample wells on the enzyme-labeled plate, followed by 10 μl of the test sample. Add 100 μl of enzyme-labeled reagent to each well, except for the blank wells. Seal the plate with a film and incubate at 37°C for 60 minutes. Discard the liquid, spin dry, and fill each well with wash solution. Let stand for 30 seconds before discarding. Repeat five times and pat dry. Add 50 μl of chromogen A, followed by 50 μl of chromogen B, to each well. Gently shake to mix. Develop at 37°C for 15 minutes in the dark. Add 50 μl of stop solution to each well to terminate the reaction. Measure the absorbance of each well at 450 nm.

[0046] 4. Experimental Results Figure 6 This is a schematic diagram of the expression of 15-HETE in the liver tissues of mice in each group after HIRI treatment with sansin. Figure 6 It can be seen that compared with the PBS-Sham group, the expression level of 15-HETE in the liver tissue of mice in the PBS-IR group was increased, and the increase in 15-HETE expression caused by HIRI was significantly reduced after treatment with sansin.

[0047] Example 3 Experiment on the regulation of H / R of hepatocytes by 15-HETE

[0048] 1. Experimental Materials AML12 hepatocytes were purchased from the Cell Bank of the Chinese Academy of Sciences; the CCK-8 kit (C0037) was purchased from Beyotime Biotechnology Co., Ltd.; DMEM cell culture medium (G4511-500 ml) and sugar-free DMEM medium (G4528-500 ml) were purchased from Wuhan Sevier Biotechnology Co., Ltd.; and 15-HETE (sc-200944) was purchased from Santa Cruz Biotechnology Co., Ltd. The remaining experimental materials were the same as those in Example 1.

[0049] 2. Cell Grouping and Dosing AML12 cells were divided into blank group, Morusin group (normoxia group), H / R group, Morusin+H / R group and 15-HETE+Morusin+H / R group.

[0050] Morusin group (normoxia group): Pretreatment with DMEM containing 2 μM Morusin for 6 hours. After 6 hours, the cells were replaced with normal DMEM and placed in a normoxic incubator for 6 hours. The cells were then replaced with normal DMEM again and placed in a normoxic incubator for 6 hours before samples were collected.

[0051] Blank group: Pretreatment with DMEM solution containing an equal volume of DMSO for 6 hours. After 6 hours, the cells were replaced with normal DMEM medium and placed in a normoxic incubator for 6 hours. Normal DMEM medium was then replaced again and placed in a normoxic incubator for 6 hours before samples were collected.

[0052] Morusin + H / R group: Pretreatment with DMEM containing 2 μM Morusin was performed for 6 hours. After 6 hours, the cells were replaced with sugar- and serum-free DMEM and placed in a hypoxic incubator for 6 hours. Subsequently, the cells were replaced with normal DMEM and placed in a normoxic incubator for 6 hours before samples were collected.

[0053] 15-HETE + Morusin + H / R group: Pretreatment with DMEM containing 2 μM Morusin and 1 μM 15-HETE for 6 hours. After 6 hours, the cells were replaced with sugar- and serum-free DMEM and placed in a hypoxic incubator for 6 hours. Subsequently, the cells were replaced with normal DMEM and placed in a normoxic incubator for 6 hours before samples were collected.

[0054] H / R group: Pretreatment with DMEM containing an equal volume of DMSO for 6 hours. After 6 hours, the cells were replaced with sugar- and serum-free DMEM and placed in a hypoxic incubator for 6 hours. Subsequently, the cells were replaced with normal DMEM and placed in a normoxic incubator for 6 hours before samples were collected.

[0055] Morusin (normoxia), Morusin + H / R, and 15-HETE + Morusin + H / R groups were treated with a final concentration of 2 μM of Morusin, 6 hours before hypoxia. The 5-HETE + Morusin + H / R group was treated with a final concentration of 15-HETE, 6 hours before hypoxia. The remaining groups were treated with an equal volume of DMSO.

[0056] 3. Construction of Hepatocyte H / R Model The original culture medium was discarded and replaced with sugar- and serum-free DMEM. The culture plates were then transferred to a hypoxic incubator (1% O₂, 5% CO₂, 94% N₂) for 6 hours. During the reoxygenation phase, the hypoxic medium was discarded, and normal culture medium containing serum and glucose was replaced. The cells were then transferred to a normoxic incubator (21% O₂, 5% CO₂) for 6 hours.

[0057] 4. Result detection 4.1 CCK-8 assay Use the 15-HETE enzyme-linked immunosorbent assay kit. Take 100 mg of liver tissue, add the appropriate amount of PBS, and homogenize thoroughly using a homogenizer. Centrifuge for 20 minutes (3000 rpm). Collect the supernatant for analysis. Set up blank wells and test sample wells. Add 40 μl of sample diluent to the test sample wells on the enzyme-labeled plate, followed by 10 μl of the test sample. Add 100 μl of enzyme-labeled reagent to each well, except for the blank wells. Seal the plate with a film and incubate at 37°C for 60 minutes. Discard the liquid, spin dry, and fill each well with wash solution. Let stand for 30 seconds before discarding. Repeat five times and pat dry. Add 50 μl of chromogen A to each well, followed by 50 μl of chromogen B. Gently shake to mix thoroughly. Develop at 37°C for 15 minutes in the dark. Add 50 μl of stop solution to each well to terminate the reaction. Measure the absorbance of each well at 450 nm.

[0058] Figure 7 This is the result of CCK8 in which Sancin improves H / R-induced liver cell damage through 15-HETE.

[0059] 4.2 Relative mRNA expression The experimental method is the same as described in Example 1.

[0060] Figure 8 This is a schematic diagram of the results of improving the expression of inflammatory cytokines in hepatocytes induced by H / R by sansin through 15-HETE. A is the expression level of IL-1β mRNA in the hepatocytes of each group, B is the expression level of IL-6 mRNA in the hepatocytes of each group, and C is the expression level of TNF-α mRNA in the hepatocytes of each group.

[0061] 5. Experimental Results from Figure 7 It can be seen that compared with the blank group, the liver cell activity in the H / R group was reduced, and the cell damage caused by H / R was significantly restored after treatment with sangsin, while the addition of 15-HETE reversed the protective effect of sangsin. Figure 8 The results confirmed that sansinol could alleviate the release of inflammatory cytokines induced by H / R, while 15-HETE reversed the anti-inflammatory effect of sansinol.

[0062] In summary, the present invention uses the mouse liver ischemia-reperfusion injury (HIRI) model and the hepatocyte hypoxia-reoxygenation (H / R) model to simulate liver ischemia-reperfusion injury. After treatment with sansinol and a blank control, it was found that: (1) For the mouse HIRI model, administration of 40 mg / kg of sansinol 24 hours and 2 hours before modeling can effectively reduce the area of liver necrosis and the number of apoptotic cells in the mice, reduce the expression of serum ALT and AST, reduce the infiltration of inflammatory cells and the production of inflammatory cytokines, and alleviate the inflammatory response in the liver; (2) For the hepatocyte H / R model, after pretreatment with 2 μM concentration of sansin for 6 hours, the hepatocyte H / R model was constructed, which can significantly increase the number of surviving hepatocytes and reduce the production of inflammatory cytokines.

[0063] (3) In vivo and in vitro experiments found that treatment with sansinol could reduce the expression of 15-hydroxyeicosapentaenoic acid (15-HETE), and the addition of 15-HETE could reverse the protective effect of sansinol on HIRI.

[0064] The specification of the present invention describes the specific implementation scheme in detail. Those skilled in the art should recognize that the above implementation scheme is exemplary and cannot be understood as limiting the present invention. For those skilled in the art, without departing from the principles of the present invention, by making several improvements and modifications to the present invention, the technical solutions obtained by these improvements and modifications also fall within the scope of protection of the claims of the present invention.

Claims

1. Use of mulberry bark extract in preparing a medicament for preventing and / or treating ischemia-reperfusion injury.

2. The use according to claim 1, characterized in that The ischemia-reperfusion injury is liver ischemia-reperfusion injury or cerebral ischemia-reperfusion injury.

3. The use according to claim 1, characterized in that The mulberry bark extract is used in preparing medicine for preventing and / or treating liver ischemia-reperfusion injury.

4. The use according to claim 1, characterized in that The mulberry bark extract is used in preparing medicine for preventing liver ischemia-reperfusion injury.

5. The use according to any one of claims 1 to 4, characterized in that The mulberry bark extract is mulberry extract.

6. The use according to claim 5, characterized in that The use of the sansinol in preparing medicine for preventing or treating liver ischemia-reperfusion injury.

7. The use according to claim 5, characterized in that The use of the sansinol in preparing medicine for preventing liver ischemia-reperfusion injury.

8. The use according to claim 6, characterized in that The described sansinol is used as a medicine for treating liver ischemia-reperfusion injury by inhibiting 15-HETE.

Images