Method for editing and correcting colorectal cancer APC gene truncation mutation by using ABE base

Abstract

The invention discloses an adenine base editing system of a targeted colorectal cancer APC gene. The adenine base editing system comprises: a) an adenine base editor; the sgRNA is specifically bound with the APC gene, the target sequence of the sgRNA is located in a truncated mutation region of the APC gene, and the truncated mutation region is located in the 1286th codon to the 1513th codon of the APC gene. The adenine base editing system is used for correcting Q1338 * truncation mutation of the APC protein.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and specifically relates to a method for correcting truncation mutations in the APC gene of colorectal cancer using ABE base editing technology and its application in the treatment of colorectal cancer. Background Art

[0002] Adenine base editors (ABEs) are a precision gene editing technology developed in recent years. Developed by David Liu's laboratory at Harvard University in 2017, ABE base editors can efficiently perform A>G conversions on the genome, thereby correcting C>T base mutations. Their mechanism of action is that, guided by sgRNA, the ABE protein is localized to the target gene locus and unwinds the DNA double helix. The fused adenosine deaminase deaminates adenosine (A) within a region of the target DNA known as the editing window, converting it to the intermediate inosine (I). This intermediate is then recognized as guanine (G) during DNA replication. Ultimately, through the DNA repair process, the AT base pairs on the double-stranded DNA are converted to GC base pairs, thereby achieving base editing. Since its advent, ABE base editors have shown great application potential in the treatment of various genetic diseases including retinal diseases, α-1 antitrypsin deficiency, congenital heart disease, cystic fibrosis, β-thalassemia, spinal muscular atrophy (SMA), etc.

[0003] Cancer is one of the most serious threats to human health and life. It is characterized by gene mutations or other changes in the cell genome that cause cell growth to deviate from the body's normal regulation. Finding the driver genes of specific tumors and intervening in them has become one of the main goals of cancer research. At present, 568 cancer driver genes have been reported in 66 different types of cancer tissues. Among them, the adenomatous polyposis coli (APC) gene has the highest mutation rate in colorectal cancer (CRC), which ranks third in cancer incidence and second in mortality worldwide.

[0004] APC is a tumor suppressor gene that encodes a 2843-amino acid protein with multiple functional domains. It forms a protein complex with AXIN1 and GSK3β, acting as an antagonist of the WNT signaling pathway. Furthermore, it regulates various biological processes in a WNT-independent manner, including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in the APC gene can lead to familial adenomatous polyposis (FAP) and often progress to malignancy. Mutations in the APC gene occur in the majority of colorectal cancers. However, notably, the majority of these mutations do not result in complete loss of APC protein. Studies have found that over 90% of APC mutations result in premature stop codons, resulting in C-terminal truncations of the APC protein (Rowan et al., 2000. APC mutations in sporadic colorectal tumors: A mutational "hotspot" and interdependence of the "two hits"). Truncated APC proteins lack the binding regions for microtubules, EB1, and β-catenin, and can induce chromosomal instability, promote tumor cell proliferation and migration, and inhibit differentiation. To address APC truncation mutations, Alona Zilberberg's team used aminoglycosides and macrolides to induce gene read-through, restoring expression of the full-length APC protein. This approach suppressed the tumorigenic properties caused by APC truncation mutations in mice (Zilberberg et al., 2010. Restoration of APC gene function in colorectal cancer cells by aminoglycoside- and macrolide-induced read-through of premature termination codons). However, this approach lacks targeted efficacy, limiting its clinical application. Jerry W Shay's team used a small molecule truncated APC selective inhibitor (TASIN-1) to specifically kill tumor cells with truncated APC without significantly affecting WT APC cells, thereby inhibiting CRC growth (Zhang et al., 2016. Selective targeting of mutant adenomatous polyposis coli (APC) in colorectal cancer).Zhang Jian's research group developed inhibitors targeting the truncated APC protein and the cancer metastasis target Asef protein, inhibiting the binding of truncated APC to Asef, thereby inhibiting CRC metastasis (Jiang et al., 2017. Peptidomimetic inhibitors of APC-Asef interaction block colorectal cancer migration). However, these inhibitors are all designed to inhibit the cancer-promoting function of truncated APC and cannot restore the normal tumor suppressor function of the APC gene. Currently, there is no clinical drug or treatment that can effectively correct APC truncated mutations in CRC patients to restore their normal gene function. Therefore, there is still a need for precise, effective, stable and safe ABE base editing to correct APC gene truncated mutations (C>T) in colorectal cancer.

[0005] APC gene mutations often occur in a small area called the mutation cluster region (MCR) (codons 1286-1513) (Miyoshi et al., 1992. Somatic mutations of the APC gene in colorectal tumors: mutation cluster region in the APC gene). Most of these point mutations are C>T type base transitions. When these mutations occur at the coding sites for glutamine (Q, codon CAG), arginine (R, codon CGA), or tryptophan (W, codon UGG), they can lead to premature termination codons (TAG or TGA), resulting in C-terminal truncated APC protein. Based on this, the use of ABE base editors to correct these C>T type point mutations in the APC gene to restore the expression of the full-length APC protein has important application value in the field of precision treatment of CRC. Summary of the Invention

[0006] To solve the above technical problems, the present invention applies ABE base editing technology to the therapeutic application research of colorectal cancer for the first time.

[0007] Specifically, the first aspect of the present invention provides an adenine base editing system targeting the APC gene of colorectal cancer, comprising: a) an adenine base editor; and b) an sgRNA that specifically binds to the APC gene, wherein the target sequence of the sgRNA is located in the truncated mutation region of the APC gene; preferably, the truncated mutation region is located within codons 1286-1513 of the APC gene.

[0008] In some embodiments, the editor comprises: i) an adenine deaminase domain; ii) a DNA binding protein or a variant thereof.

[0009] In some embodiments, the DNA binding protein is Cas9, preferably, a variant of Cas9, nCas9(D10A) or nCas9(H840A).

[0010] In some embodiments, the adenine base editing system corrects premature stop codons on APC mutant proteins.

[0011] In some embodiments, the correction comprises restoring expression of full-length APC protein.

[0012] In some embodiments, the adenine base editing system corrects the APC protein Q1338* truncation mutation, wherein Q1338* indicates that translation of the APC gene terminates at glutamine 1338.

[0013] In some embodiments, the sgRNA comprises the nucleotide sequence shown in SEQ ID NO: 1 or 2, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 1 or 2.

[0014] The second aspect of the present invention provides a pharmaceutical composition comprising the adenine base editing system described in the first aspect of the present invention and a pharmaceutically acceptable delivery vehicle.

[0015] In some embodiments, the delivery vehicle is selected from a lipid nanoparticle or adeno-associated virus (AAV).

[0016] The third aspect of the present invention provides an in vitro method for repairing truncation mutations in the APC gene of colorectal cancer, comprising: using the adenine base editing system described in the first aspect of the present invention in ex vivo cells; and correcting the APC truncation mutation.

[0017] In some embodiments, the APC truncating mutation is a Q1338* truncating mutation.

[0018] The fourth aspect of the present invention provides a kit for preparing a drug for treating colorectal cancer, comprising: a) the adenine base editing system described in the first aspect of the present invention; and optionally b) instructions for delivering the system to target cells.

[0019] The fifth aspect of the present invention provides the use of the adenine base editing system described in the first aspect of the present invention in the preparation of a drug for inhibiting colorectal cancer.

[0020] The sixth aspect of the present invention provides an in vitro cell model for inhibiting colorectal cancer by base editing, wherein the truncated mutation of the APC gene in the cell model has been repaired by the method described in the third aspect of the present invention.

[0021] In some embodiments, the APC truncating mutation is a Q1338* truncating mutation.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] For the first time, ABE base editing technology has been applied to the treatment of solid tumors (human colorectal cancer). Without introducing exogenous genes, the method of the present invention restores the oncogenic truncated APC protein to the full-length APC protein that suppresses tumors through precise gene editing. This removes the cancer-promoting function of the truncated APC protein while increasing the tumor-suppressing function of the full-length APC protein, achieving a dual tumor-suppressing effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Other features, objects and advantages of the present invention will become more apparent upon reading the detailed description of non-limiting embodiments with reference to the following drawings:

[0025] Figure 1 Analysis of mutation types in colorectal cancer cell lines. (A) 29 colorectal cancer cell lines from the CCLE database harboring various point mutations in the APC gene; (B) Types of nucleotide mutations in each cell line; (C) Sanger sequencing identified a Q1338* (CAG to TAG) truncating mutation in the APC gene in the SW480 / SW620 cell lines, while the control cell line HCT116 did not harbor a mutation at position Q1338 in the APC gene; (D) Schematic diagram of the C-terminal truncated APC protein resulting from the Q1338* mutation; (E) sgRNA was designed targeting the stop codon at position 1338 in the SW480 APC gene mutation site.

[0026] Figure 2 APC premature stop codon mutations in SW480 cells were successfully corrected using ABE base editing. (AC) Sanger sequencing (A) and next-generation sequencing (B, C) confirmed that co-transfection of ABE8e and sgRNA partially corrected the APC truncation mutation in SW480 cells, with an efficiency of approximately 30%. (D) Sanger sequencing identified APC-edited monoclonal SW480 cell lines. Clone#1 and Clone#2 represent two APC-corrected SW480 cell lines (the same below). (E) Western blot analysis of APC C-terminal protein, using α-Tublin as an internal control. HCT116 serves as a positive control for full-length APC protein expression, and WT represents wild-type SW480 cells.

[0027] Figure 3 APC-edited SW480 cells showed a significant decrease in proliferation. (A-B) EdU incorporation assays assess cell proliferation; scale bar, 200 μm; (B) Percentage of cells positive for EdU incorporation, *P < 0.05, **P < 0.01; (C-D) Flow cytometry analysis of the cell proliferation marker Ki67; (D) Percentage of Ki6-positive cells, ****P < 0.0001.

[0028] Figure 4 The expression of WNT signaling pathway-related molecules in the APC-edited SW480 cell line was reduced. (AB) Western Blot and IF were used to detect the β-catenin protein level in the APC-corrected SW480 cell line. GAPDH was used as an internal control, F-actin was used as the cytoskeleton, and WT was used as the wild-type SW480. Scale bar: 50 μm. (C) Western Blot was used to detect the nuclear and cytoplasmic β-catenin protein levels in the SW480 cell line. W = whole cell lysate protein, C = cytoplasmic protein, N = nuclear protein, LaminB1 was used as a nuclear internal control, and α-Tublin was used as a cytoplasmic internal control. (D) RT-qPCR was used to detect the mRNA levels of CTNNB1, WNT signaling pathway downstream target genes (AXIN2, MYC, CCND1, CCND2), and TCF7 / LEF1. GAPDH was used as an internal control. ns P>0.05, **P<0.01, ***P<0.001, ****P<0.0001. (E) Western The protein expression levels of non-phosphorylated β-catenin, MYC, CCND1 and CCND2 were detected by Blot, and GAPDH was used as an internal control. DETAILED DESCRIPTION

[0029] Unless otherwise defined, technical or scientific terms used herein shall have the ordinary meaning as understood by persons of ordinary skill in the art to which this invention pertains. The terms "first," "second," and similar terms used in the present patent application specification and claims do not denote any order, quantity, or importance, but are merely used to distinguish different components. Similarly, terms such as "a" or "an" do not denote a limitation of quantity, but rather denote the presence of at least one.

[0030] As used herein, the term "adenine base editor" is an artificially designed gene editing tool, a fusion protein complex formed by molecular linkage of an adenine deaminase domain, a Cas9 protein or its variant, and a uracil glycosylase inhibitor (UGI). Its function is to use the deaminase to perform targeted deamination of adenine (A) on the target DNA chain, converting it to hypoxanthine (I), thereby achieving A→G base substitution during DNA replication or repair, and is independent of DNA double-strand breaks (DSBs).

[0031] As used herein, the term "sgRNA" is an artificially designed single-stranded RNA molecule composed of a CRISPR array (crRNA) and a transactivating crRNA (tracrRNA) fused via a linker sequence. It is used to guide an adenine base editor (ABE) or a CRISPR-associated protein (such as a Cas9 variant) to specifically recognize and bind to a target DNA site. Its function is to achieve precise positioning through complementary pairing of the spacer sequence with the target DNA, and to activate the editor's function through the interaction of the tracrRNA domain with the Cas9 protein.

[0032] The term "adenine base editing system" refers to a combination of an adenine base editor, a gene-targeting sgRNA, and a delivery vehicle, used to achieve precise A-to-G base editing in cells or organisms. Common delivery vehicles for adenine base editing systems include viral vectors (such as AAV), non-viral vectors (such as lipid nanoparticles (LNPs), or in vitro delivery agents (such as electrotransduction devices).

[0033] The term "truncating mutation" refers to a genetic variation in the coding region of a gene that results in a premature stop codon (such as TAA, TAG, or TGA) in the resulting mRNA, leading to a truncated protein that is shorter than normal during translation. Such mutations are typically caused by nonsense or frameshift mutations, resulting in a loss of all or part of the protein's function. In this article, the APC truncating mutation Q1338* indicates a missense mutation (CAG to TAG) at the codon corresponding to glutamine at position 1338 in the APC gene, leading to premature translation termination.

[0034] To make the purpose, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the described embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] Example 1 ABE base editing corrects APC truncating mutations in colorectal cancer cells in vitro

[0036] To verify that the ABE base editing system can correct APC truncation mutations in colorectal cancer cells in vitro, this example analyzed and sorted the mutation information of colorectal cancer cell lines in the CCLE database, and screened out 29 colorectal cancer cell lines whose APC mutation types were only SNV mutations, and the most common base substitution type was C>T( Figure 1 AB). Through in vitro cell culture, genomic DNA extraction, PCR (primer sequence: Primer-F: GGATGTAATCAGACGACACAGGAAGC, SEQ ID NO: 3; Primer-R: GGCTCATCGAGGCTCAGAGCAC, SEQ ID NO: 4) amplification of the target fragment, and Sanger sequencing, the results showed that the APC mutation site in the SW480 / SW620 cell line was Q1338* (CAG to TAG) ( Figure 1 CD).

[0037] sgRNA was designed for the mutation site of SW480 APC gene (exemplary sgRNA is shown in SEQ ID NO: 1 (CCCTACAGTCTGCTGGATTTGG) or SEQ ID NO: 2 (ACCCTACAGTCTGCTGGATTTGG), as shown in Figure 1E) SW480 cells were co-transfected with the ABE8e plasmid and the corresponding sgRNA plasmid. Transfection conditions were as follows: 200,000 cells were plated in a 24-well plate, 16-20 hours after plating. For plasmid transfection, 750 ng of ABE8e plasmid and 250 ng of sgRNA plasmid were added to each well, mixed, and transfected with 2 μl of jetPRIME transfection reagent (Cat. No. 101000046, Polyplus Inc.). 72 hours after transfection, genomic DNA was extracted, and the target fragment was amplified by two rounds of PCR and purified. The first round of PCR primers were SEQ ID NO: 21 (ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNGGTCAGCTGAAG ATCCTGTGAG) and SEQ ID NO: 22 (TGGAGTTCAGACGTGTGCTCTTCCGATCTCTGCTAAACATGAGTGGGGTCTCCTG). The second round of amplification primers were used for library construction.

[0038] The base editing effect of the target site was detected by the second generation detection technology (NGS). The results showed that the mutation site produced about 30% of the editing ( Figure 2 AC).

[0039] The transfected SW480 cells were subjected to monoclonal selection and amplification culture. The monoclonal selection method was as follows: 72 hours after the SW480 cells were transfected, they were digested into a single cell suspension, the cell density was adjusted to 50,000 per milliliter, 2 μL of the cell suspension was added to 20 mL of complete culture medium, and after gentle mixing, 200 μL per well was plated in a 96-well cell plate. The cells were cultured in a 37°C incubator for 12-14 days. Under a microscope, wells with obvious clone formation were observed and amplified. The genomic DNA was then extracted and the target fragment was amplified by PCR. The monoclonal fragment was verified by Sanger sequencing, and finally an APC-edited SW480 monoclonal cell line that can be stably passaged was obtained ( Figure 2 D).

[0040] To verify whether the APC gene-edited single cell clones obtained have restored APC full-length protein expression, this example used Western Blot to detect APC full-length protein in two monoclonal cell lines obtained after the APC truncation mutation was corrected. The control WT cells were SW480 cells identified by monoclonal selection as APC non-edited. The method was to culture cells, extract cell proteins using RIPA lysis buffer, and perform protein immunoblotting, incubating with anti-APC-C-terminal protein antibody (Cat. No.: MAB3786, Merck), incubating with fluorescent secondary antibody, and developing. The results showed that the APC-corrected SW480 cells restored the expression of APC full-length protein ( Figure 2E). It can be seen that ABE base editing technology can be used to correct the APC gene Q1338* mutation in SW480 and restore the expression of full-length APC protein.

[0041] To detect the effect of APC editing on cell proliferation in SW480 cells, this example performed cell proliferation assays on two monoclonal cell lines obtained after the APC truncation mutation was corrected. The control WT cells were SW480 cells identified by monoclonal selection as having unedited APC. The experimental methods adopted were Edu incorporation assays and flow cytometry detection of the proliferation marker Ki67. The Edu incorporation assay was performed by plating the three cells mentioned above in this example in a 96-well plate, resuspending the cells to 500,000 / mL, adding 100 μL of the suspension to each well, and incubating overnight in a 37°C constant temperature incubator. When the cell density was about 70%, EdU was diluted to 20 μM with complete cell culture medium, 100 μL of EdU working solution was added to each well, and the cells were incubated at 37°C for 3 hours to ensure that EdU was fully incorporated into the newly synthesized DNA. After Edu labeling was completed, subsequent fixation and staining detection was performed according to the Edu detection operating instructions (reagent catalog number: C0017S, Biyuntian). Finally, fluorescence microscopy was used to record the images, and ImageJ software was used to analyze the positive cells and count the numbers. The flow cytometry technique was used to detect Ki67. The experimental steps were as follows: cell counting was performed on the three types of cells mentioned above, and 1×10 6 The cells were placed in a 1.5mL EP tube, centrifuged and the supernatant discarded, washed twice with 1mL pre-cooled PBS, then vortexed and added dropwise with 75% alcohol, and fixed at -20°C overnight. The next day, they were washed twice with pre-cooled PBS, and 100μL of flow cytometry working solution was added to each tube to resuspend the cells. 2μL of anti-Ki67 antibody coupled to APC was added and incubated at room temperature in the dark for 30 minutes. Then, they were washed once with PBS and resuspended with 200μL of flow cytometry working solution, and detected by BD FACSCantoⅡ flow cytometer. The results were analyzed by FlowJo software, and the percentage of positive cells was counted. The results of both detection methods showed that compared with the unedited SW480 monoclonal line (WT), the proliferation capacity of the two edited SW480 monoclonal cells (Clone#1, Clone#2) was significantly decreased ( Figure 3 ).

[0042] To verify the changes in the expression of WNT signaling pathway-related molecules after restoration of full-length APC protein expression by correcting the APC gene truncation mutation in SW480 cells, Western blot, immunofluorescence (IF), and nuclear-cytoplasmic fractionation assays were performed to verify changes in the accumulation of β-catenin, a key molecule in the WNT signaling pathway. Anti-β-catenin antibodies (Cat. No. 8480S, CST) were used at dilutions of 1:1000 and 1:200, respectively. Western blot and immunofluorescence assays were performed according to the protocol. Western blots used GAPDH as an internal control. IF assays used phalloidin to indicate the cytoskeleton and DAPI to indicate the nuclei. Cy3-anti-Rabbit was used as a secondary antibody to detect β-catenin. Nuclear-cytoplasmic fractionation assays were performed according to the kit instructions (Cat. No. 78833, Thermo Scientific). After isolating cytoplasmic and nuclear proteins, changes in the distribution of β-catenin in the nucleus and cytoplasm were assessed by Western blot. Among them, α-Tublin was used as the cytoplasmic internal reference, and LaminB1 was used as the nuclear internal reference. WB, IF and nuclear cytoplasm separation experiments all showed that the accumulation level of β-catenin protein, a key molecule in the WNT signaling pathway, was significantly reduced, and the level of nuclear entry was significantly reduced ( Figure 4 AC).

[0043] Furthermore, RT-qPCR was used to detect changes in the mRNA accumulation levels of genes related to the WNT signaling pathway (CTNNB1, AXIN2, MYC, CCND1, CCND2, TCF7, and LEF1). Cellular RNA was extracted and reverse transcribed (Cat. No. R323-01, Novagens) to generate cDNA. Real-time fluorescence quantitative PCR (Cat. No. Q331-02, Novagens) was performed using cDNA as a template to detect gene expression. The primer list is shown in Table 1. The results showed that the mRNA level of the CTNNB1 gene encoding the β-catenin protein did not change significantly ( Figure 4 D), the mRNA accumulation levels of downstream target genes of the WNT signaling pathway (AXIN2, MYC, CCND1, CCND2) were significantly reduced, and the mRNA accumulation level of TCF7 / LEF1 was also significantly reduced compared with wild-type cells ( Figure 4D). Changes in the protein levels of non-phosphorylated β-catenin (i.e., active β-catenin, Catalog No.: 8814S, CST), c-MYC (Catalog No.: C3956, Merck), CCND1 (Catalog No.: 2922S, CST), and CCND2 (Catalog No.: 3741S, CST) were detected by Western Blot, using GAPDH as an internal reference. The changes in protein levels were consistent with those in mRNA levels ( Figure 4 E).

[0044] Table 1

[0045]

[0046]

[0047] Example 2 ABE base editing corrects APC truncating mutations in a colon tumor model

[0048] By constructing a mouse subcutaneous tumor transplant model, AAV packaging and delivery of the ABE8e system and sgRNA can significantly inhibit the growth of SW480 cells in mice.

[0049] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It is obvious to those skilled in the art that the present invention is not limited to the details of the above exemplary embodiments, and that the present invention can be implemented in other specific forms without departing from the spirit or essential characteristics of the present invention. Therefore, from all points of view, the embodiments should be regarded as illustrative and non-restrictive. The scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes that fall within the meaning and range of equivalents of the claims are included in the present invention. Any reference signs in the claims should not be construed as limiting the claim to which they relate.

[0050] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.

Claims

1. An adenine base editing system targeting the APC gene in colorectal cancer, characterized in that: Include: a) adenine base editors; and b) an sgRNA that specifically binds to the APC gene, wherein the target sequence of the sgRNA is located in the truncated mutation region of the APC gene; preferably, the truncated mutation region is located within codons 1286-1513 of the APC gene.

2. The adenine base editing system according to claim 1, wherein the editor comprises: i) adenine deaminase domain; ii) a DNA binding protein or a variant thereof.

3. The adenine base editing system according to claim 2, wherein the DNA binding protein is Cas9, preferably, a variant of Cas9, nCas9(D10A) or nCas9(H840A).

4. The adenine base editing system according to claims 1-3, which corrects premature stop codons on APC mutant proteins.

5. The adenine base editing system of claim 4, wherein the correction comprises restoring expression of the full-length APC protein.

6. A pharmaceutical composition, characterized in that It comprises the adenine base editing system according to any one of claims 1 to 5, and a pharmaceutically acceptable delivery vehicle; preferably, the delivery vehicle is selected from lipid nanoparticles or adeno-associated virus (AAV).

7. A method for repairing truncation mutations of the APC gene in colorectal cancer in vitro, characterized in that: include: Using the adenine base editing system according to any one of claims 1 to 5 in vitro cells to correct APC truncating mutations.

8. A kit for preparing a drug for treating colorectal cancer, characterized in that: Include: a) the adenine base editing system of any one of claims 1-5; and optionally b) instructions for delivering the system to target cells.

9. Use of the adenine base editing system according to any one of claims 1 to 5 in the preparation of a drug for inhibiting colorectal cancer.

10. An in vitro cell model for inhibiting colorectal cancer by base editing, characterized in that The truncated mutation of the APC gene in the cell model has been repaired by the method of claim 7.

Images