Circular RNA (Ribonucleic Acid) as well as preparation method and application thereof
By using a universal exonome composed of short nucleotides, the problems of non-specific immune responses and lack of universality in the preparation of circular RNA have been solved, achieving the preparation of circular RNA with high cleavage activity and reduced immune response, making it suitable for clinical applications.
Patent Information
- Application Number
- CN202510930842.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-09-04
- Filing Date
- 2025-07-07
- Publication Date
- 2026-03-10
AI Technical Summary
Existing technologies for preparing circular RNA suffer from non-specific immune responses due to the long nucleotide exon sequence, and lack universality and versatility, making it difficult to maintain cost-effective cleavage activity when shortening nucleotide length.
Using a universal exon set composed of short nucleotides, including exon 1 and exon 2 elements with specific sequences, it can successfully achieve cyclization on type I introns and significantly reduce non-specific immune responses, thus possessing universality and applicability.
This method enables the preparation of circular RNA that maintains high cleavage activity while significantly reducing non-specific immune responses, making it suitable for clinical applications.
Smart Images

Figure BDA0005486258610000161 
Figure BDA0005486258610000171 
Figure BDA0005486258610000172
Abstract
Description
Technical Field
[0001] This disclosure belongs to the field of biotechnology, specifically relating to universal exomes for preparing circular RNA, recombinant nucleic acid molecules, circular RNA, methods for their preparation, and applications. Background Technology
[0002] Circular mRNAs are a class of mRNAs without beginning or end terminals, exhibiting a closed circular structure. The main advantages of circular mRNAs lie in their high stability, low immunogenicity, and ease of preparation. As a more stable, safer, and more effective emerging mRNA technology, circular mRNAs represent a major development direction for second-generation mRNA technologies. Besides therapeutic and preventative vaccines, circular mRNAs are the optimal mRNA platform for fields such as protein replacement therapy for rare diseases.
[0003] The main methods for forming circular RNA in vitro include chemical synthesis, enzymatic ligation, and ribozyme methods. The ribozyme method primarily achieves circular RNA formation through the in vitro splicing and ligation mechanism of type I introns. Type I introns are natural ribozymes derived from rRNA, tRNA, and pre-mRNA of bacteria and non-metazoan eukaryotes. They catalyze the splicing and ligation of their own sequences at specific sites (ribozymes are a class of RNA molecules with biocatalytic activity that specifically bind to and cleave target RNA molecules). Before ribozyme circularization, the RNA structure is "type I intron 3' end - exon 2 - open reading frame - exon 1 - type I intron 5' end". When the exons of the type I introns perform their recognition function and the type I introns act as ribozymes, they cleave to form a closed circular RNA structure of "exon 2 - open reading frame - exon 1". The formed circular RNA contains exons 1 and 2 at both ends of the type I intron. Literature reports that the "exon 1 and exon 2" sequences contained in circular RNA are the main reason why cells recognize foreign sequences and generate non-specific immune responses. Summary of the Invention
[0004] The purpose of this disclosure is to identify universal exons with ribozyme activity for the preparation of circular RNA, based on type I introns. This invention unexpectedly discovered that a set of exons composed of short nucleotides not only retains the ribozyme activity of exons composed of long nucleotides, but also maintains cleavage activity while achieving greater cost-effectiveness through shortening nucleotide length, and exhibits significantly reduced non-specific immune responses. More importantly, this set of exons composed of short nucleotides can be successfully used to prepare circular RNA regardless of the type I introns used, demonstrating its versatility and universality.
[0005] According to one aspect of this disclosure, a universal exome for preparing circular RNA is provided, the universal exome comprising:
[0006] The first exon element has a nucleotide sequence that is truncated, mutated, or modified according to the sequence shown in SEQ ID NO:5; and / or
[0007] The second exon element has a nucleotide sequence that is truncated, mutated, or modified from the sequence shown in SEQ ID NO:4;
[0008] The universal exon set has the function of identifying type I introns.
[0009] In some embodiments, the second exon element has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides.
[0010] In some embodiments, the second exon element has 2-15 nucleotides. In some preferred embodiments, the second exon element has 5-10 nucleotides, for example, 5, 6, 7, 8, 9, or 10 nucleotides.
[0011] In some embodiments, the first exon element has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides.
[0012] In some embodiments, the first exon element has 2-15 nucleotides. In some preferred embodiments, the first exon element has 3-10 nucleotides, for example, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.
[0013] In some embodiments, the nucleotide sequence of the second exon element includes aaaat.
[0014] In some embodiments, the nucleotide sequence of the first exon element includes ctt.
[0015] In some embodiments, the nucleotide sequence of the second exon element is selected from aaaat, aaaatc, aaaatcc, aaaatccg, aaaatccgt, or aaaatccgtt.
[0016] In some embodiments, the nucleotide sequence of the first exon element is selected from ctt, actt, gactt, ggactt, cggactt, acggactt, tacggactt, or ctacggactt.
[0017] In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ctt.
[0018] In some embodiments, the nucleotide sequence of the second exon element is aaaatccgtt, and the nucleotide sequence of the first exon element is selected from ctt.
[0019] In some embodiments, the nucleotide sequence of the second exon element is aaaatccgtt, and the nucleotide sequence of the first exon element is selected from ctacggactt.
[0020] In some embodiments, the nucleotide sequence of the second exon element is caaat, and the nucleotide sequence of the first exon element is selected from CTT. In some embodiments, the nucleotide sequence of the second exon element is gaaat, and the nucleotide sequence of the first exon element is selected from CTT. In some embodiments, the nucleotide sequence of the second exon element is taaat, and the nucleotide sequence of the first exon element is selected from CTT. In some embodiments, the nucleotide sequence of the second exon element is aaaa, and the nucleotide sequence of the first exon element is selected from CTT. In some embodiments, the nucleotide sequence of the second exon element is aaat, and the nucleotide sequence of the first exon element is selected from CTT. In some embodiments, the nucleotide sequence of the second exon element is aaa, and the nucleotide sequence of the first exon element is selected from CTT. In some embodiments, the nucleotide sequence of the second exon element is aat, and the nucleotide sequence of the first exon element is selected from CTT. In some embodiments, the nucleotide sequence of the second exon element is aa, and the nucleotide sequence of the first exon element is selected from ctt. In some embodiments, the nucleotide sequence of the second exon element is at, and the nucleotide sequence of the first exon element is selected from ctt. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from cat. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from cct. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from cgt. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ct. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from tt. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from cta. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ctg. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ctc. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from caa. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from cgg.In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ccc.
[0021] In this disclosure, when the first exon element is a 3-nucleotide ctt and the second exon element is a 5-nucleotide aaaat, circularization can still be successfully achieved despite the very short sequences of the two exons. This is a remarkable discovery. Exons of circular RNA can cause non-specific immune responses, and reducing the length and number of exons will undoubtedly greatly reduce the non-specific immune responses that may be caused by circular RNA; this will make circular RNA technology more applicable to clinical practice. This disclosure also unexpectedly found that the above-mentioned exons have been verified to successfully guide the splicing and ligation of type I introns in various types of introns. It is evident that this universal recognition sequence can be used regardless of the type of type I intron used, and the final circular RNA sequence is fixed, demonstrating its universality and applicability.
[0022] According to another aspect of this disclosure, a recombinant nucleic acid molecule for preparing circular RNA is provided, the recombinant nucleic acid molecule comprising:
[0023] The first exon element has a nucleotide sequence that is truncated, mutated, or modified according to the sequence shown in SEQ ID NO:5; and / or
[0024] The second exon element has a nucleotide sequence that is truncated, mutated, or modified from the sequence shown in SEQ ID NO:4;
[0025] The first and second exon elements have the function of recognizing type I introns.
[0026] In some embodiments, the second exon element has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides.
[0027] In some embodiments, the second exon element has 2-15 nucleotides. In some preferred embodiments, the second exon element has 5-10 nucleotides, for example, 5, 6, 7, 8, 9, or 10 nucleotides.
[0028] In some embodiments, the first exon element has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides.
[0029] In some embodiments, the first exon element has 2-15 nucleotides. In some preferred embodiments, the first exon element has 3-10 nucleotides, for example, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.
[0030] In some embodiments, the nucleotide sequence of the second exon element includes aaaat.
[0031] In some embodiments, the nucleotide sequence of the first exon element includes ctt.
[0032] In some embodiments, the nucleotide sequence of the second exon element is selected from aaaat, aaaatc, aaaatcc, aaaatccg, aaaatccgt, or aaaatccgtt.
[0033] In some embodiments, the nucleotide sequence of the first exon element is selected from ctt, actt, gactt, ggactt, cggactt, acggactt, tacggactt, or ctacggactt.
[0034] In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ctt.
[0035] In some embodiments, the nucleotide sequence of the second exon element is aaaatccgtt, and the nucleotide sequence of the first exon element is selected from ctt.
[0036] In some embodiments, the nucleotide sequence of the second exon element is aaaatccgtt, and the nucleotide sequence of the first exon element is selected from ctacggactt.
[0037] In some embodiments, the nucleotide sequence of the second exon element is caaat, and the nucleotide sequence of the first exon element is selected from CTT. In some embodiments, the nucleotide sequence of the second exon element is gaaat, and the nucleotide sequence of the first exon element is selected from CTT. In some embodiments, the nucleotide sequence of the second exon element is taaat, and the nucleotide sequence of the first exon element is selected from CTT. In some embodiments, the nucleotide sequence of the second exon element is aaaa, and the nucleotide sequence of the first exon element is selected from CTT. In some embodiments, the nucleotide sequence of the second exon element is aaat, and the nucleotide sequence of the first exon element is selected from CTT. In some embodiments, the nucleotide sequence of the second exon element is aaa, and the nucleotide sequence of the first exon element is selected from CTT. In some embodiments, the nucleotide sequence of the second exon element is aat, and the nucleotide sequence of the first exon element is selected from CTT. In some embodiments, the nucleotide sequence of the second exon element is aa, and the nucleotide sequence of the first exon element is selected from ctt. In some embodiments, the nucleotide sequence of the second exon element is at, and the nucleotide sequence of the first exon element is selected from ctt. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from cat. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from cct. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from cgt. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ct. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from tt. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from cta. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ctg. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ctc. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from caa. In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from cgg.In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ccc.
[0038] In some embodiments, the recombinant nucleic acid molecule further comprises a 3' intron element and a 5' intron element.
[0039] In some embodiments, the 3' intron element is a 3' intron element of a type I intron.
[0040] In some embodiments, the 5' intron element is a 5' intron element of a type I intron.
[0041] In some embodiments, the 3' intron element has a nucleotide sequence shown in any one of SEQ ID NO: 3, 9, 11, 13, 15 or 17 or a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it.
[0042] In some embodiments, the 5' intron element has a nucleotide sequence shown in any one of SEQ ID NO: 6, 10, 12, 14, 16 or 18, or a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it.
[0043] In some embodiments, the 3' intron element comprises one or more nucleotide modifications relative to the nucleotide sequence shown in any one of SEQ ID NO: 3, 9, 11, 13, 15 or 17, the modifications being selected from one or more of deletion, substitution, and addition.
[0044] In some embodiments, the 5' intron element comprises one or more nucleotide modifications relative to the nucleotide sequence shown in any one of SEQ ID NO: 6, 10, 12, 14, 16 or 18, the modifications being selected from one or more of deletion, substitution, and addition.
[0045] In some embodiments, 5' intron elements and 3' intron elements are obtained by splitting the type I intron into two segments from the unpaired region, wherein the unpaired region is preferably selected from the linear region between two adjacent structural domains of the type I intron or the ring region of the stem-loop structure.
[0046] In some embodiments, the recombinant nucleic acid molecule further includes functional elements comprising coding and non-coding regions, the coding region comprising translation initiation elements (TIEs), coding elements, and optionally terminators or termination boxes, and the non-coding region comprising one or more internal ribosome entry sites (IRES).
[0047] In some implementations, the translation initiation element also includes an untranslated region (UTR) or a segment thereof.
[0048] In some embodiments, the coding element encodes one or more antigens, antigen-binding fragments, fluorescent proteins, proteins with disease therapeutic activity, or proteins with gene-editing activity.
[0049] In some implementations, an insertion element is included between the translation initiation element and the encoding element.
[0050] In some embodiments, the insertion element is selected from at least one of the following: (i) transcriptional level regulatory elements, (ii) translational level regulatory elements, and (iii) purification elements.
[0051] In some embodiments, the insert element comprises one or more of the following sequences: untranslated region sequence, polyA sequence, aptamer sequence, riboswitch sequence, and sequence that binds transcription regulatory factors.
[0052] In some embodiments, the recombinant nucleic acid molecule comprises, from the 5' to 3' direction, operably linked: the 3' intron element, the second exon element, the functional element, the first exon element, and the 3' intron element.
[0053] In some embodiments, the recombinant nucleic acid molecule is DNA or RNA.
[0054] In some embodiments, the 5' end of the recombinant nucleic acid molecule also includes a promoter.
[0055] According to another aspect of this disclosure, a circular nucleic acid precursor is provided, which is obtained by in vitro transcription of the recombinant nucleic acid molecule described in this disclosure.
[0056] According to another aspect of this disclosure, a circular nucleic acid molecule is provided, said circular nucleic acid molecule being generated from the recombinant nucleic acid molecule or the circular nucleic acid molecule precursor described in this disclosure.
[0057] In some embodiments, the circular nucleic acid molecule is a circular RNA molecule.
[0058] In some embodiments, the circular nucleic acid molecule is a circular mRNA molecule.
[0059] In some implementations, the circular nucleic acid molecule has a length of 1000-5000 bp.
[0060] In some embodiments, the circular nucleic acid molecule includes a second exon element, a functional element, and a first exon element that are operatively linked.
[0061] In some implementations, the functional element includes an open reading frame (ORF).
[0062] In some embodiments, the circular nucleic acid molecule contains the nucleotide sequence cttaaaat.
[0063] According to another aspect of this disclosure, an expression vector is provided that comprises the universal exome or recombinant nucleic acid molecule described in this disclosure.
[0064] According to another aspect of this disclosure, a host cell is provided that comprises the universal exome or recombinant nucleic acid molecule described in this disclosure, the circular nucleic acid molecule precursor, the circular nucleic acid molecule, or the expression vector.
[0065] According to another aspect of this disclosure, a method for forming a circular nucleic acid molecule is provided, the method comprising incubating the recombinant nucleic acid molecule or the circular nucleic acid molecule precursor described herein under cyclization conditions.
[0066] In some embodiments, the method forms the circular nucleic acid molecule via ribozyme action.
[0067] In some embodiments, the circular nucleic acid molecule is a circular RNA molecule.
[0068] In some embodiments, the circular nucleic acid molecule is a circular mRNA molecule.
[0069] According to another aspect of this disclosure, a composition is provided comprising the universal exome described in this disclosure, the recombinant nucleic acid molecule, the circular nucleic acid molecule precursor, or the circular nucleic acid molecule.
[0070] In some embodiments, the composition further includes a carrier for encapsulating the recombinant nucleic acid molecule, the circular nucleic acid molecule precursor, or the circular nucleic acid molecule.
[0071] In some embodiments, the composition further includes lipid nanoparticles or lipid polymer complexes that encapsulate the recombinant nucleic acid molecule, cyclic nucleic acid molecule precursor, or cyclic nucleic acid molecule.
[0072] In some embodiments, the composition is a vaccine.
[0073] In some embodiments, the recombinant nucleic acid molecule, cyclic nucleic acid precursor, or cyclic nucleic acid molecule is complexed with lipids to form one or more liposomes, lipid complexes, or lipid nanoparticles. In some embodiments, the composition comprises liposomes, lipid complexes, and / or lipid nanoparticles containing the recombinant nucleic acid molecule, cyclic nucleic acid precursor, or cyclic nucleic acid molecule.
[0074] In some embodiments, the lipid nanoparticles comprise ionizable lipids, neutral lipids, cholesterol, and PEG lipids. In some embodiments, the lipid nanoparticles comprise 40-60 wt% ionizable lipids, 5-15 wt% neutral lipids, 25-50 wt% cholesterol, and 0.5-3 wt% PEG lipids.
[0075] In some embodiments, the composition further comprises an adjuvant.
[0076] In some embodiments, the composition is formulated for oral, transdermal, or parenteral administration; preferably, the composition is formulated as a solution, emulsion, suspension, tablet, capsule, powder, pill, or aerosol.
[0077] According to another aspect of this disclosure, a vaccine formulation is provided comprising the recombinant nucleic acid molecule described herein, the circular nucleic acid molecule precursor described herein, the circular nucleic acid molecule described herein, or the composition described herein.
[0078] According to another aspect of this disclosure, the use of the recombinant nucleic acid molecule, the circular nucleic acid molecule precursor, the circular nucleic acid molecule, or the composition described herein in the preparation of a circular RNA vaccine or medicament is provided.
[0079] In some embodiments, the circular RNA vaccine or drug can be used for infectious disease prevention or treatment, tumor immunotherapy, gene therapy, protein replacement therapy, and cell therapy. In some embodiments, the cell therapy is CAR-T cell therapy.
[0080] According to another aspect of this disclosure, a method for inducing an immune response in a subject is provided, the method comprising the step of administering to the subject a recombinant nucleic acid molecule or circular nucleic acid molecule, composition, nucleic acid, vector, or host cell of the present disclosure. The subject may be a human or an animal, including but not limited to cattle, sheep, cats, dogs, horses, rabbits, monkeys, mice, rats, alpacas, camels, etc. Attached Figure Description
[0081] Figure 1 The diagram illustrates the construction of a linearized vector based on natural type I introns and the formation of circular RNA according to some embodiments.
[0082] Figure 2A schematic diagram of exons P6-10-10, P6-3-10, and P6-3-5 according to different shortening treatments in Example 2 is shown.
[0083] Figure 3 The results show the verification of the preparation of circular RNA using exons P6-10-10, P6-3-10 and P6-3-5 with different shortening treatments as described in Example 2.
[0084] Figure 4 The diagram shows the constructs P1-3-5, P2-3-5, P4-3-5, P5-3-5, P6-3-5, and P7-3-5 obtained by constructing the "first exon element - second exon element" sequence (ctt-aaaat) at both ends of different introns P1, P2, P4, P5, P6, and P7 according to Example 3.
[0085] Figure 5 The results show the verification of the preparation of circular RNA using constructs P1-3-5, P2-3-5, P4-3-5, P5-3-5, P6-3-5, and P7-3-5 as described in Example 3.
[0086] Figure 6 The reverse transcription verification results of circular RNA prepared according to the constructs P1-3-5, P2-3-5, P4-3-5, P5-3-5, P6-3-5, and P7-3-5 in Example 3 are shown.
[0087] Figure 7 The sequencing results of circular RNA prepared according to constructs P1-3-5, P2-3-5, P4-3-5, P5-3-5, P6-3-5, and P7-3-5 in Example 3 are shown.
[0088] Figure 8 The results show the cyclization efficiency verified by RT-qPCR using the constructs P1-3-5, P2-3-5, P4-3-5, P5-3-5, P6-3-5, and P7-3-5 as described in Example 3.
[0089] Figure 9 The purity test results of the circular RNA prepared according to Example 4 using the natural exon of intron P6, exons P6-10-10, P6-3-10 and P6-3-5 are shown.
[0090] Figure 10 The results show the immunogenicity of circular RNA prepared according to Example 4 using the natural exon of intron P6, exon P6-10-10, P6-3-10 and P6-3-5.
[0091] Figure 11The results show the verification of the preparation of circular RNA according to Example 5 using a universal exon unilateral base substitution for intron 6.
[0092] Figure 12 The results show the circularization efficiency of circular RNA prepared according to Example 5 using a universal exon unilateral base substitution for intron 6. Detailed Implementation
[0093] To make the objectives, technical solutions, and advantages of this disclosure clearer, the following detailed description is provided in conjunction with embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the scope of this disclosure in any way. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in numerous publications.
[0094] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly used in the field to which this document pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.
[0095] Unless the context clearly indicates otherwise, the terms “a” and “an” as used herein include plural references. For example, reference to “a cell” includes multiple such cells and equivalents known to those skilled in the art, etc.
[0096] As used herein, the term "about" indicates a range of ±20% of the following value. In some embodiments, the term "about" indicates a range of ±10% of the following value. In some embodiments, the term "about" indicates a range of ±5% of the following value.
[0097] The terms “circRNA”, “circular polynucleotide”, “circular RNA”, or “circular nucleic acid molecule” used in this article are used interchangeably and refer to polynucleotides that form a circular structure through covalent bonds.
[0098] Ribozymes are RNA molecules that act like proteases. There are generally three methods for preparing circular RNA in vitro using ribozymes: type I intron self-cleavage, type II intron self-cleavage, and circularization using hairpin ribozymes.
[0099] PIE (Permuted Introns and Exons) is an intron-exon construct that rearranges introns and exons by splicing and repositioning type I / II introns and exons. The target gene can be integrated into the exons, and circRNA is synthesized by splicing after transcription. RNA transcribed using the "PIE sequence" as a template is circularized after two transesterification reactions. The first transesterification reaction releases the 5' intron of the PIE structure. In the second transesterification reaction, the free 3'-OH group of the newly generated 3' exon attacks the 3' splicing site, releasing circRNA and the 3' intron.
[0100] Autocatalytic splicing from yeast type II introns can artificially prepare circular RNA in vitro. By inverting the (D1-D3) and (D5-D6) sequences in the six structural regions of the type II intron, self-splicing ribozymes can be formed, allowing for the in vitro preparation of circular RNA. This method produces circular RNA without foreign sequence residues, but its low efficiency currently hinders industrial-scale production. Linking circular RNA through subviral genomes typically requires introducing ribozymes from the subviral genome; some RNAs in vivo often become potential targets for these ribozymes.
[0101] Type I intron self-cleavage catalyzes the cyclization strategy of cyclic ribonucleotides, with Anabaena PIE (premuted intron exon) and T4td (Thymidylate Synthase of T4) PIE being the most widely used ribozyme-catalyzed self-cleavage cyclization systems. In the presence of guanine and divalent cations, the intron sequences of Anabaena PIE and T4td PIE form specific structures and are cleaved through self-catalysis, thus forming a cyclic ribonucleotide sequence within the intron. The splicing scars (E1 and E2 fragments) introduced by the type I intron PIE method can lead to immunogenicity.
[0102] The term "type I intron" as used herein refers to a large class of self-splicing ribozymes, which possess enzymatic catalytic functions and, after transcription into RNA, can self-splice. They can catalyze the excision of themselves from mRNA, tRNA, and rRNA precursors in various organisms. Based on sequence differences, they can be further subdivided into 5 major groups (AEs) and approximately 10 subgroups and minor structural features. IC1 is the most common subclass. The core secondary structure consists of 9 paired regions (P1-P9), with recognition, catalysis, and other functions performed by different paired regions. Introns P1-P6 used in this application all belong to type I introns.
[0103] In some embodiments, the type I intron comprises a nuclear rDNA gene derived from a bacterial bacteriophage, a viral vector, an organelle genome, or a fungal rDNA gene. In some embodiments, the nuclear rDNA gene comprises a nuclear rDNA gene or a fragment thereof derived from a fungus, plant, or algae. In some embodiments, the type I intron is derived from any of the following type I introns: T4 bacteriophage td gene, Anabaena tRNALeu, TpaCOX2, or Ptu.
[0104] The splicing of type I introns actually involves two phosphodiester bond transfers, characterized by the presence of guanosine. The first transesterification reaction is mediated by a free guanosine or guanylic acid (GTP, GMP, or GDP), whose 3'-OH group acts as a nucleophile, attacking the phosphodiester bond at the 5' end of the intron and cleaving the RNA strand upstream. In the second transesterification reaction, the free 3'-OH group of the upstream exon acts as a nucleophile, attacking the phosphodiester bond on the 3'-terminal nucleotide of the intron, completely cleaving the intron, and allowing the two exons to reconnect via a new phosphodiester bond.
[0105] In this paper, the terms “3' intron” or “3' intron element” refer to the 3' end sequence of a type I intron; “5' intron” or “5' intron element” refer to the 5' end sequence of a type I intron; “exon 1” or “exon 1 element” refers to a segment of natural exon sequence flanking the 5' end sequence of a type I intron; and “exon 2” or “exon 2 element” refers to a segment of natural exon sequence flanking the 3' end sequence of a type I intron.
[0106] As used herein, the term "homologous arm" or "homologous region" can refer to any two regions that thermodynamically tend to cross-pair in sequence-specific interactions. In some embodiments, the recombinant nucleic acid molecule or circular nucleic acid molecule of this invention includes external homologous arms, namely, a "5' external homologous arm" and a "3' external homologous arm." In some embodiments, the recombinant nucleic acid molecule or circular nucleic acid molecule of this invention also includes internal homologous arms, namely, a "5' internal homologous arm" and a "3' internal homologous arm." Both internal and external homologous arms can form splice bubbles, which facilitate the proximity of intronic motifs to each other for splicing. Furthermore, the internal homologous arm can generate splice bubbles to allow the translation of several expressed sequences. The percentage of sequence identity between the homologous region and the anti-complementary sequence of the corresponding homologous region can be any percentage of sequence identity that allows hybridization to occur. For example, at least a portion of the sequences of the "5' external homologous arm" and the "3' external homologous arm" in this invention are anti-complementary to allow hybridization to occur. Preferably, the "5' external homologous arm" and the "3' external homologous arm" are completely anti-complementary. For example, at least a portion of the sequences of the “5’ internal homologous arm” and the “3’ internal homologous arm” in this paper are reverse complementary to allow hybridization to occur. Preferably, the “5’ internal homologous arm” and the “3’ internal homologous arm” are completely reverse complementary.
[0107] The terms "tRNA," "transfer RNA," or "transfer ribonucleic acid" used in this article are interchangeable. They refer to nucleic acid molecules that can recognize codons on mRNA using their anticodons, transferring the corresponding amino acids to the polypeptide chain synthesized by the ribosome. "Pre-tRNA" refers to the precursor of tRNA. Newly transcribed tRNA precursors in prokaryotes and eukaryotes are generally inactive and require processing such as splicing, base modification, and 3'-OH linkage to form an ACC structure to become tRNA.
[0108] The terms “wild-type” or “natural” as used in this article mean that the sequence is naturally occurring and has not been modified by humans, including naturally occurring mutants.
[0109] The "sequence identity percentage" or "identity percentage" between two nucleic acid molecules or polypeptide sequences refers to the number of identical matching positions shared by sequences within a comparison window, taking into account additions or deletions (i.e., vacancies) that must be introduced for optimal alignment of the two sequences. A matching position is any location where the same nucleotide or amino acid is present in both the target and reference sequences. Since vacancies are not nucleotides or amino acids, vacancies present in the target sequence are not counted. Similarly, vacancies present in the reference sequence are not counted because nucleotides or amino acids from the target sequence are counted, but those from the reference sequence are not.
[0110] The percentage of sequence identity can be calculated as follows: determine the number of positions in both sequences where the same amino acid residue or nucleic acid base appears (the number of matching positions), divide the number of matching positions by the total number of positions in the comparison window, and multiply the result by 100 to obtain the percentage of sequence identity. Sequence comparison and determination of the percentage of sequence identity between two sequences can be accomplished using software that is readily available online and downloadable. Suitable software programs are available from various sources for protein and nucleotide sequence alignment. A suitable program for determining the percentage of sequence identity is bl2seq, which is part of the BLAST program suite available from the National Center for Biotechnology Information (NCBI) website (blast.ncbi.nlm.nih.gov). Bl2seq uses either the BLASTN or BLASTP algorithm for comparing two sequences. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water, or Matcher, which are part of the EMBOSS suite of bioinformatics programs and are also available from the European Institute of Bioinformatics (EBI) at www.ebi.ac.uk / Tools / psa.
[0111] In this article, "nucleotide" includes deoxyribonucleotides and ribonucleotides and their derivatives. The term "ribonucleotide" as used herein refers to the building block of ribonucleic acid (RNA), consisting of one base, one pentose sugar, and one phosphate molecule; it is a nucleotide with a hydroxyl group at the 2' position of the β-D-ribofuranosyl group. "Deoxyribonucleotide," on the other hand, is the building block of deoxyribonucleic acid (DNA), also consisting of one base, one pentose sugar, and one phosphate molecule; it is a nucleotide where the hydroxyl group at the 2' position of the β-D-ribofuranosyl group is replaced by hydrogen, and is a major chemical component of chromosomes. Nucleotides are usually identified by a single letter representing the bases in them: "A(a)" refers to deoxyadenosine or adenosine containing adenine, "C(c)" refers to deoxycytidine or cytidine containing cytosine, "G(g)" refers to deoxyguanosine or guanosine containing guanine, "U(u)" refers to uridine containing uracil, and "T(t)" refers to deoxythymidine containing thymine.
[0112] The terms “nucleic acid molecule” and “nucleic acid” as used herein are used interchangeably to refer to polymers of deoxyribonucleotides (DNA) or polymers of ribonucleotides (RNA). The terms “nucleic acid molecule sequence,” “nucleic acid sequence,” and “nucleotide sequence” are used interchangeably to refer to the sequence of nucleotides in a nucleic acid molecule. Those skilled in the art will understand that the DNA coding strand (sense strand) and its encoded RNA can be considered to have the same nucleotide sequence, and that the deoxythymidine nucleotide in the DNA coding strand sequence corresponds to the uridine nucleotide in its encoded RNA sequence.
[0113] As used in this article, the term "expression" includes transcription and / or translation of nucleotide sequences. Therefore, expression can involve the production of transcripts and / or polypeptides. The term "transcription" refers to the process of transcribing the genetic code in a DNA sequence into RNA (transcription).
[0114] As used in this article, “in vitro transcription” refers to the in vitro synthesis of RNA, particularly mRNA, in a cell-free system (e.g., in a suitable cell extract). The vectors that can be used to produce transcripts are also called “transcription vectors,” which contain the regulatory sequences required for transcription. The term “transcription” encompasses “in vitro transcription.”
[0115] The term "encoding" as used in this article refers to the inherent characteristic of a specific nucleotide sequence in a nucleic acid molecule. For example, genes, cDNA, or mRNA can serve as templates to synthesize polymers and macromolecules in other biological processes, as long as a definite nucleotide sequence or a definite amino acid sequence is available. Therefore, a gene encoding a protein means that the gene's mRNA produces a protein in a cell or other biological system through transcription and translation.
[0116] As used herein, the term "coding sequence" or "coding region sequence" refers to a nucleotide sequence in a nucleic acid molecule that can serve as a template for the synthesis of a defined nucleotide sequence (e.g., tRNA and mRNA) or a defined amino acid sequence in a biological process. The coding sequence can be a DNA sequence or an RNA sequence. If an mRNA corresponding to a DNA sequence (including the same coding strand as the mRNA sequence and a template strand complementary to it) is translated into a polypeptide in a biological process, the DNA sequence or mRNA sequence can be considered to encode the polypeptide.
[0117] In some embodiments, the recombinant and circular nucleic acid molecules described herein contain coding sequences. In some embodiments, the recombinant and circular nucleic acid molecules described herein contain nucleotide sequences complementary to the coding sequences. In some embodiments, the recombinant nucleic acid molecules described herein are RNA, specifically linear RNA nucleic acid molecules. The term "RNA" as used herein is defined to encompass single-stranded, double-stranded, linear, and circular RNA. The RNA described herein can be chemically synthesized, recombinant-produced, or in vitro transcribed RNA. In some embodiments, the linear RNA nucleic acid molecules described herein are in vitro transcribed RNA (IVT-RNA). IVT-RNA can be obtained by in vitro transcription using an RNA polymerase with a DNA template.
[0118] As used herein, the term "operably linked" refers to the connection of at least a first element and a second element such that the constituent elements are in a relationship that allows them to function in their intended manner. For example, a nucleic acid regulatory sequence is "operably linked" to a nucleic acid coding sequence if a regulatory sequence (e.g., a promoter sequence) and a coding sequence are linked in a manner that allows the expression of the coding sequence to be controlled by the regulatory sequence. In some embodiments, the "operably linked" regulatory sequence is covalently bound to the coding sequence, directly or indirectly (e.g., in a single nucleic acid molecule). In some embodiments, the regulatory sequence controls the expression of the coding sequence in a trans-regulatory manner, and including the regulatory sequence in the same nucleic acid as the coding sequence is not a requirement for operational linking.
[0119] As used herein, the term "vector" refers to a nucleic acid construct designed for delivery between different hosts, including but not limited to plasmids, viruses, granules, bacteriophages, BAC, YAC, etc. In some embodiments, plasmid vectors can be prepared from commercially available vectors. In other embodiments, viral vectors can be prepared from baculoviruses, retroviruses, adenoviruses, AAVs, etc., according to techniques known in the art. In one embodiment, the viral vector is an adenovirus vector.
[0120] As used herein, the term "host cell" refers to a cell used to receive, maintain, replicate, and express nucleic acid molecules or vectors. In some embodiments, the host cell may be a cell in which the polypeptides described herein are expressed.
[0121] As used herein, the term "vaccine" refers to a composition containing an active ingredient (such as the nucleic acid molecule described herein) that can elicit an immune response in a recipient through inoculation. In specific embodiments, the immune response it induces provides immune protection and is sufficient to prevent and / or alleviate at least one symptom associated with a pathogen or disease infection. In some embodiments, the nucleic acid molecule or composition described herein can serve as a vaccine to provide prophylactic and / or therapeutic immunization against a virus in subjects in need.
[0122] As used herein, the term "composition" generally refers to a combination of an active agent (e.g., a compound or composition) and a naturally occurring or non-naturally occurring carrier, which may be inert, such as a detection reagent or label, or active, such as an adjuvant, diluent, binder, stabilizer, buffer, salt, lipophilic solvent, preservative, adjuvant, etc., and includes pharmaceutically acceptable carriers. Carriers also include pharmaceutical excipients and additives such as proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides; derived sugars, such as sugar alcohols, aldonic acids, esterified sugars, etc.; and polysaccharides or sugar polymers), which may be present alone or in combination, comprising 1-99.99% by weight or volume alone or in combination. Exemplary protein excipients include serum albumin (e.g., human serum albumin (HSA), recombinant human albumin (rHA)), gelatin, casein, etc. Representative amino acid / antibody components with buffering capacity include alanine, arginine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, and aspartame. Carbohydrate excipients are also intended to be within the scope of this technology, examples of which include, but are not limited to: monosaccharides, such as fructose, maltose, galactose, glucose, D-mannose, and sorbitol; disaccharides, such as lactose, sucrose, trehalose, and cellobiose; polysaccharides, such as raffinose, melitriose, maltodextrin, dextran, and starch; and sugar alcohols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucol), and inositol.
[0123] Type I introns are natural ribozymes derived from the rRNA, tRNA, and pre-mRNA of bacteria and non-metazoan eukaryotes. They catalyze the cleavage and ligation of their own sequences at specific sites. The exon sequences of type I introns are their specific recognition sequences. Before ribozyme circularization, the RNA structure is "type I intron 5' end - exon 2 - open reading frame - exon 1 - type I intron 3' end". When the exons of the type I intron perform their recognition function and the type I intron acts as a ribozyme, it is cleaved to form a closed circular RNA structure of "exon 2 - open reading frame - exon 1". The formed circular RNA contains exons 1 and 2 at both ends of the type I intron.
[0124] This disclosure relates to an improvement of a universal exon sequence for type I introns. Specifically, by truncating and optimizing the "exon 1-exon 2" sequence and validating it using multiple type I introns, a universal "exon 1 element-exon 2 element" sequence was successfully designed. According to the research in this disclosure, the universal sequence for the exon 1 element can be at least ctt, the universal sequence for the exon 2 element can be at least aaaat, and the total length of the "exon 1 element-exon 2 element" sequence can be as low as 8 nt. This 8 nt short sequence has been validated on six type I introns within the scope of this disclosure, successfully guiding type I intron splicing and ligation. Without affecting the correct recognition of type I introns, this 8 nt short sequence lacks sequence specificity and therefore does not induce endogenous non-specific immunogenicity. More importantly, this universal recognition sequence can be used regardless of the type I intron used, and the final circular RNA circular sequence is fixed, which is more conducive to the validation of circular RNA expression vectors.
[0125] According to one aspect of this disclosure, a universal exome is provided for preparing circular RNA, the universal exome comprising: a first exon element having a nucleotide sequence of truncated, mutated, or modified nucleotide sequence as shown in SEQ ID NO:5; and / or a second exon element having a nucleotide sequence of truncated, mutated, or modified nucleotide sequence as shown in SEQ ID NO:4; the universal exome having the function of recognizing type I introns.
[0126] In some embodiments, the second exon element has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the second exon element has 2-15 nucleotides. In some preferred embodiments, the second exon element has 5-10 nucleotides.
[0127] In some embodiments, the first exon element has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the first exon element has 2-15 nucleotides. In some preferred embodiments, the first exon element has 3-10 nucleotides.
[0128] In some embodiments, the nucleotide sequence of the second exon element includes aaaat. In some embodiments, the nucleotide sequence of the first exon element includes ctt.
[0129] In some embodiments, the nucleotide sequence of the second exon element is selected from aaaat, aaaatc, aaaatcc, aaaatccg, aaaatccgt, or aaaatccgtt. In some embodiments, the nucleotide sequence of the first exon element is selected from ctt, actt, gactt, ggactt, cggactt, acggactt, tacggactt, or ctacggactt.
[0130] In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ctt. In some embodiments, the nucleotide sequence of the second exon element is aaaatccgtt, and the nucleotide sequence of the first exon element is selected from ctt. In some embodiments, the nucleotide sequence of the second exon element is aaaatccgtt, and the nucleotide sequence of the first exon element is selected from ctacggactt.
[0131] In this disclosure, when the first exon element is a 3-nucleotide ctt and the second exon element is a 5-nucleotide aaaat, circularization can still be successfully achieved despite the very short sequences of the two exons. This is a remarkable discovery. Exons of circular RNA can cause non-specific immune responses, and reducing the length and number of exons will undoubtedly greatly reduce the non-specific immune responses that may be caused by circular RNA; this will make circular RNA technology more applicable to clinical practice. This disclosure also unexpectedly found that the above-mentioned exons have been verified to successfully guide the splicing and ligation of type I introns in various types of introns. It is evident that this universal recognition sequence can be used regardless of the type of type I intron used, and the final circular RNA sequence is fixed, demonstrating its universality and applicability.
[0132] According to another aspect of this disclosure, a recombinant nucleic acid molecule for preparing circular RNA is provided, the recombinant nucleic acid molecule comprising: a first exon element having a nucleotide sequence of SEQ ID NO:5 that has been truncated, mutated, or modified; and / or a second exon element having a nucleotide sequence of SEQ ID NO:4 that has been truncated, mutated, or modified; wherein the first exon element and the second exon element have the function of recognizing type I introns.
[0133] In some embodiments, the second exon element has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the first exon element has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides.
[0134] In some embodiments, the second exon element has 2-15 nucleotides. In some preferred embodiments, the second exon element has 5-10 nucleotides. In some embodiments, the first exon element has 2-15 nucleotides. In some preferred embodiments, the first exon element has 3-10 nucleotides.
[0135] In some embodiments, the nucleotide sequence of the second exon element includes aaaat. In some embodiments, the nucleotide sequence of the first exon element includes ctt.
[0136] In some embodiments, the nucleotide sequence of the second exon element is selected from aaaat, aaaatc, aaaatcc, aaaatccg, aaaatccgt, or aaaatccgtt. In some embodiments, the nucleotide sequence of the first exon element is selected from ctt, actt, gactt, ggactt, cggactt, acggactt, tacggactt, or ctacggactt.
[0137] In some embodiments, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ctt. In some embodiments, the nucleotide sequence of the second exon element is aaaatccgtt, and the nucleotide sequence of the first exon element is selected from ctt. In some embodiments, the nucleotide sequence of the second exon element is aaaatccgtt, and the nucleotide sequence of the first exon element is selected from ctacggactt.
[0138] In some embodiments, the recombinant nucleic acid molecule further comprises a 3' intron element and a 5' intron element.
[0139] In some embodiments, the 3' intron element is a 3' intron element of a type I intron. In some embodiments, the 5' intron element is a 5' intron element of a type I intron.
[0140] In some embodiments, the 3' intron element has a nucleotide sequence shown in any one of SEQ ID NO: 3, 9, 11, 13, 15, or 17, or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with it. In some embodiments, the 3' intron element includes one or more nucleotide modifications relative to the nucleotide sequence shown in any one of SEQ ID NO: 3, 9, 11, 13, 15, or 17, the modifications being selected from one or more of deletion, substitution, and addition.
[0141] In some embodiments, the 5' intron element has a nucleotide sequence shown in any one of SEQ ID NO: 6, 10, 12, 14, 16, or 18, or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with it. In some embodiments, the 5' intron element includes one or more nucleotide modifications relative to the nucleotide sequence shown in any one of SEQ ID NO: 6, 10, 12, 14, 16, or 18, the modifications being selected from one or more of deletion, substitution, and addition.
[0142] In some embodiments, the 5' intron element and the 3' intron element constitute a type I intron or a portion thereof on the T4 phage td gene or the Anabaena tRNA gene.
[0143] In some embodiments, 5' intron elements and 3' intron elements are obtained by splitting the type I intron into two segments from the unpaired region, wherein the unpaired region is preferably selected from the linear region between two adjacent structural domains of the type I intron or the ring region of the stem-loop structure.
[0144] In some implementations, the P6, P2, P5, P8, or P9 regions of the type I intron are divided into two segments to obtain 5' intron elements and 3' intron elements.
[0145] In some implementations, the loop is divided into two parts at the middle position downstream of P6, into 5' intron elements and 3' intron elements; for some introns in this loop region that are too long, the entire loop region can be deleted, and the loop region can be divided into 5' intron elements and 3' intron elements upstream and downstream of the deleted region.
[0146] In some embodiments, the recombinant nucleic acid molecule further includes functional elements comprising coding and non-coding regions, the coding region comprising translation initiation elements (TIEs), coding elements, and optionally terminators or termination boxes, and the non-coding region comprising one or more internal ribosome entry sites (IRES).
[0147] In some implementations, the translation initiation element also includes an untranslated region (UTR) or a segment thereof.
[0148] In some embodiments, the coding element encodes one or more antigens, antigen-binding fragments, fluorescent proteins, proteins with disease therapeutic activity, or proteins with gene-editing activity.
[0149] In some implementations, an insertion element is included between the translation initiation element and the encoding element.
[0150] In some embodiments, the insertion element is selected from at least one of the following: (i) transcriptional level regulatory elements, (ii) translational level regulatory elements, and (iii) purification elements.
[0151] In some embodiments, the insert element comprises one or more of the following sequences: untranslated region sequence, polyA sequence, aptamer sequence, riboswitch sequence, and sequence that binds transcription regulatory factors.
[0152] In some embodiments, the UTR or fragments thereof are derived from viral or eukaryotic messenger RNA.
[0153] In some embodiments, the recombinant nucleic acid molecule comprises, from the 5' to 3' direction, operably linked: the 3' intron element, the second exon element, the functional element, the first exon element, and the 3' intron element.
[0154] In some embodiments, the recombinant nucleic acid molecule is DNA or RNA.
[0155] In some embodiments, the 5' end of the recombinant nucleic acid molecule also includes a promoter.
[0156] In some embodiments, the promoter can be a constitutive promoter or an inducible promoter. There are no particular limitations on the promoter used, and those skilled in the art can choose conventionally used promoters as needed.
[0157] In some embodiments, the promoter may be an RNA polymerase promoter. Preferably, the promoter is suitable for eukaryotic, prokaryotic, viral, or bacteriophage transcription systems. The promoter sequence is recognized by a polymerase, such as an RNA polymerase, for example, an RNA polymerase of eukaryotic, prokaryotic, viral, or bacteriophage form. In a preferred embodiment, the promoter may include, but is not limited to, the SP6, Ts, or T7 promoter.
[0158] In some implementations, the recombinant nucleic acid molecule is 1000-8000 bp in length.
[0159] In some embodiments, the recombinant nucleic acid molecule is composed of natural nucleotides.
[0160] In some embodiments, the recombinant nucleic acid molecule contains nucleoside modifications, such as at least one nucleoside modification being uridine or adenosine modification.
[0161] In some embodiments, at least one nucleoside modification is selected from N6-methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ), and 5-methoxyuridine (5 molU). In one embodiment, the precursor RNA is modified with methylpseudouridine (m1ψ).
[0162] In some implementations, the sequences of the coded and / or non-coded regions are codon-optimized.
[0163] In some implementations, the circular RNA polynucleotide is optimized to lack at least one microRNA binding site present in an equivalent pre-optimized polynucleotide.
[0164] In some implementations, the circular RNA polynucleotide is optimized to lack at least one RNA editing-sensitive site present in an equivalent pre-optimized polynucleotide.
[0165] According to another aspect of this disclosure, a circular nucleic acid precursor is provided, which is obtained by in vitro transcription of the recombinant nucleic acid molecule described in this disclosure.
[0166] According to another aspect of this disclosure, a circular nucleic acid molecule is provided, said circular nucleic acid molecule being generated from the recombinant nucleic acid molecule or the circular nucleic acid molecule precursor described in this disclosure.
[0167] In some embodiments, the circular nucleic acid molecule is a circular RNA molecule.
[0168] In some embodiments, the circular nucleic acid molecule is a circular mRNA molecule.
[0169] In some implementations, the circular nucleic acid molecule has a length of 1000-5000 bp.
[0170] In some embodiments, the circular nucleic acid molecule includes a second exon element, a functional element, and a first exon element that are operatively linked.
[0171] In some implementations, the functional element includes an open reading frame (ORF).
[0172] In some embodiments, the circular nucleic acid molecule contains the nucleotide sequence cttaaaat.
[0173] The recombinant nucleic acid molecules, circular nucleic acid precursors, or circular nucleic acid molecules disclosed herein contain open reading frames (ORFs). An open reading frame is a sequence of several nucleotide triplets (codons) that can be translated into a peptide or protein. For expression in eukaryotes, the recombinant nucleic acid molecules may contain, for example, an internal ribosome entry site (IRES) sequence. In some specific embodiments, the recombinant nucleic acid molecules also include a promoter, a 5'-cap structure, a polycytidine sequence, a histone stem-loop, and / or an internal ribosome entry side (IRES) motif.
[0174] The recombinant nucleic acid molecules, circular nucleic acid precursors, or circular nucleic acid molecules used in this disclosure are preferably purified nucleic acid molecules. That is, they have a higher purity than the starting material (e.g., RNA transcribed in vitro) after certain purification steps (e.g., HPLC, TFF, precipitation, etc.). Typical impurities that are substantially absent in purified nucleic acid molecules include peptides or proteins (e.g., enzymes derived from DNA-dependent RNA in vitro transcription, such as RNA polymerase, RNase, BSA, pyrophosphatase, restriction endonuclease, DNase), spermidine, RNA fragments, free nucleotides (modified nucleotides, conventional NTPs, cap analogs), plasmid DNA fragments, buffer components (HEPES, TRIS, MgCl2), etc. Other impurities that may be derived from, for example, fermentation processes include bacterial impurities (bioload, bacterial DNA) or impurities derived from purification processes (organic solvents, etc.). It is ideal for the "RNA purity" to be as close to 100% as possible. For RNA purity, it is also desirable for the amount of full-length RNA transcript to be as close to 100% as possible. Therefore, as used herein, “purified circular RNA” has a purity greater than 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher. Purity can be determined, for example, by analytical HPLC or an Agilent 2100 bioanalyzer, and the percentage corresponds to the ratio between the peak area of the target RNA and the total area of all peaks representing various products; or, the purity can be determined, for example, by analytical agarose gel electrophoresis or capillary gel electrophoresis.
[0175] In other aspects of this disclosure, a composition is provided. The composition according to this disclosure is preferably provided as a pharmaceutical composition or as a vaccine. “Vaccine” is generally understood to be a prophylactic or therapeutic material that provides at least one epitope of an antigen, preferably an immunogen. “Providing at least one epitope” means, for example, that the vaccine contains said epitope (or an antigen containing said epitope) or that the vaccine contains, for example, a molecule encoding said epitope or an antigen containing said epitope. The antigen preferably stimulates the adaptive immune system to provide an adaptive immune response. The compositions or vaccines provided herein may further contain at least one pharmaceutically acceptable excipient, adjuvant, or other component (e.g., additives, excipients, etc.).
[0176] As used herein, the term "antigen" generally refers to a substance that can be recognized by the immune system, preferably by the adaptive immune system, and is capable of triggering an antigen-specific immune response, for example, by forming antibodies and / or antigen-specific T cells as part of an adaptive immune response. Typically, an antigen can be or may contain a peptide or protein that can be presented to T cells by the MHC. In this document, fragments, variants, and derivatives of peptides and proteins containing at least one epitope are also understood as antigens.
[0177] The term "vaccine" is generally understood to be a preventive or therapeutic material that provides at least one antigen or antigenic function. An antigen or antigenic function can stimulate the body's adaptive immune system to provide an adaptive immune response. In the context of this disclosure, the circular RNA providing the antigen can generally be a circular RNA having at least one open reading frame, which can be translated by a cell or organism providing the circular RNA. The product of such translation is a peptide or protein that can serve as an antigen, preferably an immunogen. The translation product can also be a fusion protein composed of more than one immunogen, such as a fusion protein composed of two or more epitopes, peptides, or proteins derived from the same or different viral proteins, wherein the epitopes, peptides, or proteins can be linked by a linker sequence.
[0178] In some embodiments, the compositions of this disclosure are vaccines. At least one circular RNA according to this disclosure is complexed with one or more cationic or polycationic compounds, preferably with cationic or polycationic polymers, cationic or polycationic peptides or proteins, such as protamine, cationic or polycationic polysaccharides and / or cationic or polycationic lipids. In some embodiments, at least one circular RNA according to this disclosure can be complexed with lipids to form one or more liposomes, lipid complexes or lipid nanoparticles. Thus, in one embodiment, the compositions of this disclosure comprise liposomes, lipid complexes and / or lipid nanoparticles containing at least one circular RNA. In this context, the term "complexed" means that the circular RNA is substantially stably combined with one or more of the above compounds to form a larger complex or assembly without covalent bonding. According to some preferred embodiments, the circular RNA contained in the composition or vaccine optionally complexes or associates with lipids (particularly cationic and / or neutral lipids) to form one or more liposomes, lipid complexes or lipid nanoparticles (LNPs).
[0179] Lipid nanoparticles (LNPs) comprise: (a) at least one circular RNA according to this disclosure, optionally contained in a composition or vaccine as defined herein, (b) cationic lipids, (c) aggregation-reducing agents (e.g., polyethylene glycol (PEG) lipids or PEG-modified lipids), (d) optionally non-cationic lipids (e.g., neutral lipids), and (e) optionally sterols. In the context of this disclosure, the term "lipid nanoparticle" is not limited to any particular form and includes any form produced when cationic lipids and optionally one or more other lipids are combined, for example, in an aqueous environment and / or in the presence of RNA. For example, liposomes, lipid complexes, emulsions, micelles, lipid nanocapsules, nanosuspensions, etc., are all within the scope of lipid nanoparticles. In some embodiments, the LNP, in addition to comprising at least one circular RNA of the present disclosure, also comprises (i) at least one cationic lipid; (ii) a neutral lipid; (iii) a sterol, such as cholesterol; and (iv) a PEG-lipid, wherein the molar ratio is approximately 20-60% cationic lipid: 5-25% neutral lipid; 25-55% sterol; and 0.5-15% PEG-lipid. In still other embodiments, the lipid nanoparticles comprise ionizable lipids, neutral lipids, cholesterol, and PEG-lipids. Preferably, the lipid nanoparticles comprise 40-60 wt% ionizable lipids, 5-15 wt% neutral lipids, 25-50 wt% cholesterol, and 0.5-3 wt% PEG-lipids.
[0180] LNPs may include any cationic lipids suitable for forming lipid nanoparticles. Preferably, the cationic lipids carry a net positive charge at approximately physiological pH. Cationic lipids may be amino lipids. As used herein, the term "amino lipid" means those lipids having one or two fatty acid or fatty alkyl chains and an amino head group (including alkylamino or dialkylamino), which can be protonated at physiological pH to form cationic lipids.
[0181] Cationic lipids can be, for example, N,N-dioleoyl-N,N-dimethylammonium chloride (DODAC), N,N-distearate-N,N-dimethylammonium bromide (DDAB), 1,2-dioleoyltrimethylammonium chloride propane (DOTAP) (also known as N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride and 1,2-dioleoyloxy-3-trimethylaminopropane chloride salts), N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleoyloxy)propylamine (DODMA), 1,2-dilinoleoyloxy-N,N-dimethylamino1 2-Dilinoleoyl-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleoyl-3-morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-dilinoleoylthio-3-dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2-linoleoyl-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleoyl-3-trimethylaminopropane chloride (DLin-TMA.Ci), 1,2-dilinoleoyl-3-trimethylaminopropane chloride (DLin-TAP).CI), 1,2-dilinyloxy-3-(N-methylpiperazinyl)propane (DLin-MPZ), or 3-(N,N-dilinylamino)-1,2-propanediol (DLinAP), 3-(N,N-dilinylamino)-1,2-propanediol (DOAP), 1,2-dilinyloxy-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 2,2-dilinyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogues thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadec-9,12 1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)bisdodecane-2-ol (C12-200), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-K-C2-DMA), 2,2-dilinoleyldimethylaminomethyl-[1,3]-dioxolane (DLin-DMA), (6Z,9Z,28Z,31Z)-heptantriane-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butyrate (DLin-M-C3-DMA). Other cationic lipids include, but are not limited to, N,N-distearate-N,N-dimethylammonium bromide (DDAB), 3P-(N-(N',N) '-Dimethylaminoethane)-carbamoyl)cholesterol (DC-Choi), N-(1-(2,3-dioleoyloxy)propyl)-N(sperminecarbamoyl)ethyl)-N,N-dimethyltrifluoroacetate ammonium (DOSPA), bis(octadecylaminoglycylcarboxyspermine) (DOGS), 1,2-dioleoyl-sn-3-phosphate ethanolamine (DOPE), 1,2-dioleoyl-3-dimethylpropane ammonium (DODAP), N-(1,2-dimyristyloxypropyl-3-yl)-N,N-dimethyl- Additionally, commercial formulations of cationic lipids such as LIPOFECTIN (including DOTMA and DOPE, available from GIBCO / BRL) and LIPOFECTAMINE (including DOSPA and DOPE, available from GIBCO / BRL) can be used.
[0182] Cationic lipids can also be amino lipids. Suitable amino lipids include those with alternative fatty acid groups and other dialkylamino groups, including those with different alkyl substituents (e.g., N-ethyl-N-methylamino- and N-propyl-N-ethylamino-). Generally, amino lipids with fewer saturated acyl chains are easier to size, especially when used for filtration sterilization purposes where the size of the complex must be less than about 0.3 micrometers; in such cases, amino lipids containing unsaturated fatty acids with carbon chain lengths in the C14 to C22 range can be used. Other scaffolds can also be used to separate the amino and fatty acid or fatty alkyl moieties of amino lipids. Representative amino lipids include, but are not limited to, 1,2-dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyloxy-3-morpholinylpropane (DLin-MA), 1,2-dilinoleyl-3-dimethylaminopropane (DLinDAP), and 1,2-dilinoleylthio-3-dimethylaminopropane (DLin-SD). A) 1-Linoleyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3-trimethylaminopropane chloride (DLin-TMA.CI), 1,2-dilinoleyl-3-trimethylaminopropane chloride (DLin-TAP.CI), 1,2 and 2,2-dilinoleyldimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA); dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA).
[0183] In some embodiments, the amino or cationic lipid has at least one protonable or deprotonable group, such that the lipid is positively charged at or below a physiological pH (e.g., pH 7.4) and neutral at a second pH, preferably at or above a physiological pH. Lipids having more than one protonable or deprotonable group, or zwitterionic lipids, may also be used in this disclosure. In some embodiments, the pKa of the protonable group of the protonable lipid is in the range of about 4 to about 11, for example, about 5 to about 7 pKa. The LNP may comprise two or more cationic lipids. Different cationic lipids can be selected to obtain different advantageous properties.
[0184] In some embodiments, the cationic lipids are present at a ratio of about 20 mol% to 75 mol% or about 45 to about 65 mol% of the total lipids present in the LNP, for example, about 20, 25, 30, 35, 40, 45, 50, 52.5, 55, 57.5, 60, 65, 70, or 75 mol% (based on 100% total moles of lipids in the lipid nanoparticles). In some embodiments, the ratio of cationic lipids to nucleic acids is about 3 to about 15, for example, about 5 to about 13 or about 7 to about 11. In one embodiment, these amounts are selected such that the N / P ratio in the nanoparticles or composition is in the range of about 0.1 to about 20. Hereinafter, the N / P ratio is defined as the molar ratio of the nitrogen atom (“N”) of the basic nitrogen-containing group of the lipid or lipid-like compound to the phosphate group (“P”) of the RNA that is the carrier.
[0185] In some implementations, LNP contains one or more additional lipids that stabilize particle formation during particle formation.
[0186] In some embodiments, non-cationic lipids, such as neutral lipids, anionic lipids, or amphiphilic lipids, may be used. Neutral lipids can be any of many lipid species present at physiological pH in an uncharged or neutral zwitterionic form. Such lipids include, but are not limited to, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramides, sphingomyelin, dihydrosphingomyelin, cephalin, and cerebrosides. The selection of neutral lipids for the particles described herein is generally guided by considerations such as LNP size and LNP stability in blood flow. Preferably, neutral lipids are lipids having two acyl groups (e.g., diacylphosphatidylcholine and diacylphosphatidylethanolamine). In some embodiments, neutral lipids contain saturated fatty acids with carbon chain lengths in the C10 to C20 range. In other embodiments, neutral lipids having monounsaturated or diunsaturated fatty acids with carbon chain lengths in the C10 to C20 range are used. Alternatively, neutral lipids having a mixture of saturated and unsaturated fatty acid chains may be used. Suitable neutral lipids include, but are not limited to, distearylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoylphosphatidylcholine (POPC), palmitoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N-maleimidemethyl)-cyclohexane-1-carboxylic acid ester (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), and dimyristoylphosphatidylethanolamine (DMPE). Anionic lipids suitable for LNP include, but are not limited to, phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoylphosphatidylethanolamine, N-succinylphosphatidylethanolamine, N-glutarylphosphatidylethanolamine, lysylphosphatidylglycerol, and other anionic modifying groups linked to neutral lipids.
[0187] In some embodiments, the LNP comprises a neutral lipid selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE, and SM. In various embodiments, the molar ratio of cationic lipid to neutral lipid is in the range of about 2:1 to about 8:1. Amphiphilic lipids refer to any suitable substance in which the hydrophobic portion of the lipid material faces the hydrophobic phase, while the hydrophilic portion faces the aqueous phase. Such compounds include, but are not limited to, phospholipids, amino lipids, and sphingolipids. Representative phospholipids include sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearylphosphatidylcholine, or dilinoleoylphosphatidylcholine. Other phosphorus-free compounds, such as sphingolipids, glycosphingolipids, diacylglycerols, and β-acyloxy acids, may also be used.
[0188] In some embodiments, non-cationic lipids are present in the LNP at ratios of about 5 mol% to about 90 mol%, about 5 mol% to about 10 mol%, about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or about 90 mol% of the total lipids present in the LNP. In some embodiments, the LNP comprises about 0% to about 25%, for example about 3% to about 15%, or about 5% to about 12% of neutral lipids on a molar basis. In some embodiments, the LNP may comprise about 25%, 20%, 15%, about 10%, about 7.5%, or about 7% of neutral lipids on a molar basis.
[0189] In some embodiments, sterols, preferably cholesterol, may be used. Sterols may be present at a ratio of about 10 mol% to about 60 mol% or about 25 mol% to about 40 mol% of the LNP. In some embodiments, sterols are present at a ratio of about 10, 15, 20, 25, 30, 32.5, 35, 37.5, 40, 45, 50, 55, or about 60 mol% of the total lipids present in the LNP (based on 100% total molars of lipids in the LNP).
[0190] In some embodiments, aggregation-reducing agents can be used, which are capable of reducing lipid aggregation. Aggregation-reducing agents that can be used may be selected from polyethylene glycol (PEG) lipids, including but not limited to PEG-diacylglycerol (DAG), PEG-dialkylglycerol, PEG-dialkoxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), or mixtures thereof (e.g., PEG-Cer14 or PEG-Cer20). PEG-DAA conjugates may be, for example, PEG-dilauoxypropyl (C12), PEG-dimyristoxypropyl (C14), PEG-dispalmitoxypropyl (C16), or PEG-distearateoxypropyl (C18). Other PEGylated lipids include, but are not limited to, polyethylene glycol-dimyristoylglycerol (C14-PEG or PEG-C14, wherein the PEG has an average molecular weight of 2000 Da) (PEG-DMG), (R)-2,3-bis(octadecoxy)propyl-1-(methoxy polyethylene glycol)2000)propylcarbamate (PEG-DSG), PEG-carbamoyl-1,2-dimyristoyloxypropylamine, wherein the PEG has an average molecular weight of 2000 Da (PEG-cDMA), N-acetylgalactosamine-(R)-2,3-bis(octadecoxy)propyl-1-(methoxy polyethylene glycol)2000)propylcarbamate (GalNAc-PEG-DSG), mPEG(Mw2000)-distearatephosphatidylethanolamine (PEG-DSPE), and polyethylene glycol-dipalmitoylglycerol (PEG-DPG). The concentration of the aggregation reducer can be in the range of about 0.1 to about 15 mol% per 100% total molar lipids in LNP.
[0191] In some embodiments, the molar ratio of cationic lipids to PEGylated lipids is from about 100:1 to about 25:1. In some embodiments, the composition of the LNP is influenced by the selection of the cationic lipid component, the cationic lipid saturation, the PEGylation type, the ratio of all components, and biophysical parameters such as their magnitude. In some embodiments, the LNP composition consists of 57.1% cationic lipids, 7.1% dipalmitoylphosphatidylcholine, 34.3% cholesterol, and 1.4% PEG-c-DMA.
[0192] In some embodiments, the LNP may comprise about 35% to about 45% cationic lipids, about 40% to about 50% cationic lipids, about 50% to about 60% cationic lipids, and / or about 55% to about 65% cationic lipids. In some embodiments, the lipid-to-circular RNA ratio may be in the range of about 5:1 to about 20:1, about 10:1 to about 25:1, or about 15:1 to about 30:1. The average molecular weight of the PEG moiety in the PEG-modified lipid may be in the range of about 500 to about 8000 Daltons, for example, 1000, 2000, 3000, 4000, 5000, 6000, 7000, or 8000 Daltons.
[0193] The total amount of nucleic acids, particularly one or more RNAs, in lipid nanoparticles varies and can be defined, for example, by the w / w ratio of RNA to total lipids. In some embodiments of this disclosure, the RNA to total lipid ratio is less than 0.06 w / w, preferably from 0.03 w / w to 0.04 w / w.
[0194] In some embodiments, the LNP has a median diameter size of about 50 nm to about 300 nm, such as about 50 nm to about 250 nm, for example, about 50 nm to about 200 nm. In some embodiments, smaller LNPs can be used. Such particles can include diameters from 0.1 pm to 100 nm. In other embodiments, smaller LNPs can be used to deliver nucleic acids, such as those with diameters of about 1 nm to about 100 nm, about 1 nm to about 20 nm, about 1 nm to about 40 nm, about 1 nm to about 60 nm, about 1 nm to about 80 nm, about 5 nm to about 100 nm, about 10 nm to about 50 nm, about 20 nm to about 50 nm, about 30 nm to about 50 nm, about 30 nm to about 60 nm, about 40 nm to about 60 nm, about 20 nm to about 70 nm, about 50 nm to about 70 nm, about 60 nm to about 70 nm, about 30 nm to about 80 nm, or about 20 nm to about 90 nm. In some embodiments, the LNP may have a diameter greater than 100 nm, greater than 200 nm, greater than 300 nm, greater than 400 nm, greater than 500 nm, greater than 600 nm, greater than 700 nm, greater than 800 nm, greater than 900 nm, or greater than 1000 nm.
[0195] Liposomes typically consist of a lipid bilayer, which may be composed of cationic, anionic, or neutral (phosphate) lipids and cholesterol, encapsulating an aqueous core. Both the lipid bilayer and the aqueous space can be incorporated with hydrophobic or hydrophilic compounds. Liposomes may have one or more lipid membranes. Liposomes can be monolayered, referred to as monolayers, or multilayered, referred to as multilayers. The characteristics and behavior of liposomes in vivo can be modified by adding a hydrophilic polymer coating, such as polyethylene glycol (PEG), to the surface of the liposomes to impart steric stability. Furthermore, liposomes can be used for specific targeting by attaching ligands (e.g., antibodies, peptides, and carbohydrates) to their surface or to the ends of the attached PEG chains (FrontPharmacol. 2015 Decc 1; 6:286).
[0196] In some embodiments, the compositions of this disclosure comprise adjuvants. The term "adjuvant" is generally understood to exclude agents that themselves can confer immunity. Adjuvants nonspecifically assist the immune system in enhancing antigen-specific immune responses by, for example, promoting antigen presentation to the immune system or inducing nonspecific innate immune responses. Furthermore, adjuvants can modulate antigen-specific immune responses, for example, by shifting a dominant Th2-based antigen-specific response to a more Th1-based antigen-specific response, and vice versa. Thus, adjuvants can advantageously modulate cytokine expression / secretion, antigen presentation, immune response type, etc.
[0197] In some embodiments, the compositions of this disclosure comprise at least one pharmaceutically acceptable carrier, excipient, or transfection agent (e.g., for improving the transfection efficiency of the circular RNA of this disclosure). The choice of a pharmaceutically acceptable carrier depends, in principle, on the route of administration of the compositions or vaccines according to this disclosure. The compositions or vaccines of this disclosure can be administered systemically or locally, for example, orally, transdermally, or parenterally (including subcutaneous, intravenous, intramuscular, intra-arterial, intradermal, and intraperitoneal injections and / or intranasal administration routes). Preferably, the compositions or vaccines according to this disclosure can be administered via intradermal, subcutaneous, or intramuscular routes, and more preferably by injection. Therefore, the compositions or vaccines of this disclosure can be formulated into liquid or solid forms, such as solutions, emulsions, suspensions, tablets, capsules, powders, pills, etc. In some embodiments, the compositions or vaccines of this disclosure can also be formulated as aerosols. In a preferred embodiment, the circular RNA in the compositions, vaccines, or kits of this disclosure is provided in lyophilized form. Preferably, the lyophilized circular RNA is reconstituted in a suitable buffer prior to administration, for example using an aqueous carrier such as Ringer's lactate solution, Ringer's solution, phosphate buffer, etc. Vaccines or (pharmaceutical) compositions according to this disclosure may generally contain a pharmaceutically acceptable carrier. The expression "pharmaceuticalally acceptable carrier" as used herein preferably includes the liquid or non-liquid basis of the vaccines of this disclosure. If the vaccines of this disclosure are provided in liquid form, the carrier will be water, typically pyrogen-free water; isotonic saline; or a buffered (aqueous) solution, such as phosphate, citrate, etc.
[0198] In the context of this disclosure, a therapeutically effective amount is generally understood to be an amount sufficient to induce an immune response.
[0199] The reagents and / or kits used in the following examples are commercially available or can be synthesized by known methods.
[0200] Example
[0201] Example 1. Method for preparing circular RNA
[0202] This embodiment provides a method for preparing circular mRNA capable of expressing luciferase by constructing a coding region sequence of luciferase containing a ribozyme recognition site using type I introns.
[0203] Figure 1 This paper exemplifies the process of constructing a linearized vector and forming circular RNA based on the artificial modification of natural type I introns. According to... Figure 1As can be seen, the natural type I intron is artificially split into a first part containing a 3' intron element followed by a second exon element, and a second part containing a first exon element followed by a 5' intron element. These two parts are then constructed at both ends of the open reading frame (ORF) sequence of the luciferase to be expressed, forming a linear DNA vector. This linear DNA vector is then used as a template for in vitro transcription, resulting in circularized mRNA. From the above, it can be seen that the nucleic acid molecule structure before ribozyme circularization is "3' intron element - second exon element - open reading frame (ORF) - first exon element - 5' intron element". When the exons of the type I intron play a recognition role and the type I intron acts as a ribozyme, it is cleaved to form a closed circular RNA structure of "second exon element - open reading frame - first exon element". The formed circular RNA contains the first and second exon elements at both ends of the type I intron.
[0204] The following section uses natural type I intron 6 as an example to explain in detail the construction method of linear vectors and the formation method of circular mRNA:
[0205] 1. Construction of linear vectors
[0206] This step illustrates the method for constructing linear vectors using natural type I introns (intron 6 / P6(Osp.b(Oscillatoria acuminataPCC).trnL)).
[0207] First, intron 6 was split into a first part containing a 3' intron element and a second part containing a 1' exon element and a 5' intron. Then, a T7 promoter was added to the front of the 3' intron element, and open reading frame (ORF) sequences of luciferase were added to both the 2' and 1' exons. A BSpQI restriction site was added to the end of the 5' intron element. 100 μg of the vector was digested with 5 μL BSpQI (NEB, R0712L) at 50°C for 2 hours to obtain a linearized vector. The vector was then purified by NaCl precipitation.
[0208] The specific sequences of the T7 promoter, 3' intron element, 2nd exon element, ORF, 1st exon element, and 5' intron element are shown in Table 1.
[0209] Table 1
[0210]
[0211]
[0212] 2. Formation of circular mRNA
[0213] The purified linearized vector was transcribed in vitro using the system shown in Table 2: transcription was performed at 45°C for 2 hours. After transcription, 1.33 μL of Dnase I (Invitrogen) was added. TM Linear DNA was digested with enzymes and incubated at 37°C for 30 min. After incubation, an appropriate amount of LiCl was added to precipitate RNA. The precipitate was washed with 70% LiCl and then dissolved in enzyme-free water to obtain purified linear RNA product.
[0214] The linear RNA products from Table 1 were added to GTP solution (20 mM) and heated at 55 °C for 15 min to obtain the cyclized products. After cyclization, an appropriate amount of LiCl was added to precipitate the RNA. The precipitate was washed with 70% LiCl solution, and then dissolved in enzyme-free water to obtain the purified circular RNA products.
[0215] Table 2
[0216] Solution Catalogue number Volume 100 mM ATP solution Hongene, R1331-G 10 μL 100 mM GTP solution Hongene, R2331-G 10 μL 100 mM CTP solution Hongene, R3331-G 10 μL 100 mM UTP solution Hongene, R5331-G 10 μL T7 Reaction Buffer (5X) Promega, P1300 20 μL T7 Enzyme Mix Promega, P1300 13.6 μL DNA linearization template 5 μg 5 μg Nuclease free water / Supplemented to 100 μL
[0217] Example 2. Determination of the minimum "exon 1-exon 2" sequence and verification of its effectiveness.
[0218] Based on the same type I intron (intron 6) as in Example 1, this example determines the smallest fragments of the second and first exon elements that can be used to prepare circular RNA under ribozyme conditions by performing different shortening treatments on the second and first exon elements in the two split parts.
[0219] The following schematically illustrates three combinations of second and first exon elements with different shortening processes, each exhibiting a different length shortening compared to the natural second and first exon elements, such as... Figure 2 As shown in Table 3.
[0220] Table 3
[0221]
[0222]
[0223] Circular RNA was prepared in the same manner as in Example 1, except that in “Step 1 Construction of Linear Vector”, the sequences of the second exon element and the first exon element were replaced with the sequences in P6-10-10, P6-3-10 and P6-3-5 in Table 3 above, respectively.
[0224] The cyclization products obtained by cyclization using different exons were verified using the following method:
[0225] The cyclized sample was diluted to 200 ng / μL with ddH2O and denatured at 70°C for 5 minutes before use.
[0226] Sample analysis was performed on an Agilent 2100 instrument using an RNA analysis kit (Agilent, RNANano Chips): After preparing the gel according to the instructions, the gel was added to the RNA Nano Chips detection chip, followed by the location marker and sample. The analysis and verification were then performed on an Agilent 2100 bioanalyzer.
[0227] The results of the cyclization verification are as follows Figure 3 As shown in the figure. The results indicate that when the natural exons of intron 6 are shortened in different ways, circular RNA can be formed using exons P6-10-10, P6-3-10, and P6-3-5. In particular, when the first exon element is shortened to a 3-base sequence "ctt" and the second exon element is shortened to a 5-base sequence "aaaat", circularization can still be successfully achieved despite the very short sequences of the two exons. This is a surprising discovery. The exons of circular mRNA can cause non-specific immune responses, and reducing the length and number of exons will undoubtedly greatly reduce the non-specific immune responses that may be caused by circular mRNA. The smallest "first exon element - second exon element" sequence "ctt-aaaat" obtained in this disclosure will make circular mRNA technology more applicable to clinical practice.
[0228] Example 3. Universality test of the smallest "exon 1-exon 2" sequence
[0229] This embodiment further verifies the universality and versatility of the minimum "first exon element - second exon element" sequence determined in Embodiment 2 by applying it to a variety of different type I introns.
[0230] 1. Intron construction
[0231] The following are exemplary examples of type I introns used in this embodiment to verify the universality detection:
[0232] Intron 1 (P1, An(Anabaena tRNA-Leu).b.trnL);
[0233] Intron 2 (P2, Aaz(Anabaena azollae tRNA-Leu).b.trnL);
[0234] Intron 4 (P4, Asp(Azoarcus sp.BH72).b.trnI);
[0235] Intron 5 (P5, Atu(Agrobacterium fabrum).b.trnR);
[0236] Intron 6 (P6, Osp.b(Oscillatoria acuminata PCC).trnL); and
[0237] Intron 7 (P7, Sel.b(Synechococcus elongatus PCC 6301).trnL-1).
[0238] Following the method of Example 1, the smallest "first exon element - second exon element" sequence (ctt-aaaat) determined in Example 2 was constructed at both ends of the above introns P1, P2, P4, P5, and P7, respectively. The constructed units are denoted as P1-3-5, P2-3-5, P4-3-5, P5-3-5, and P7-3-5, respectively. The intron sequences are shown in Table 4 below. (See also...) Figure 4 The left side shows the sequences of natural type I introns (P1, P2, P4, P5, P6, P7), and the right side shows the sequences of constructs P1-3-5, P2-3-5, P4-3-5, P5-3-5, and P7-3-5 obtained by constructing the "first exon element - second exon element" sequence (ctt-aaaat) to both ends of different introns.
[0239] The different constructs described above were circularized according to the method in Example 1, and the universality of the smallest "first exon element - second exon element" sequence (ctt-aaaat) was detected.
[0240] Table 4
[0241]
[0242]
[0243] 2. Validation of vector looping
[0244] The vector constructed in step 1 above was subjected to looping verification as follows:
[0245] The cyclized samples of the above-mentioned constructs with different introns were diluted to 200 ng / μL with ddH2O and denatured at 70°C for 5 minutes before use.
[0246] Sample analysis was performed on an Agilent 2100 instrument using an RNA analysis kit (Agilent, RNANano Chips): After preparing the gel according to the instructions, the gel was added to the RNANano Chips detection chip, followed by the addition of the positioning marker and circularized samples P1-3-5, P2-3-5, P4-3-5, P5-3-5, P6-3-5, and P7-3-5. The samples were then analyzed and validated on the Agilent 2100 bioanalyzer.
[0247] The results are as follows Figure 5 As shown, analysis using an Agilent 2100 bioanalyzer reveals clear intron-cleaved bands at P1-3-5, P2-3-5, P4-3-5, P5-3-5, P6-3-5, and P7-3-5 after circularization. This demonstrates that the "exon 1-exon 2" sequence (ctt-aaaat) can serve as a recognition sequence for different type I introns, successfully guiding the introns to undergo correct cleavage. This example demonstrates the broad applicability and versatility of the "exon 1-exon 2" sequence (ctt-aaaat) in the preparation of circular RNA via ribozymes.
[0248] 3. Validation by reverse transcription after circularization
[0249] Further reverse transcription and sequencing were performed on the circular RNA products obtained from the different introns to verify whether the circularization was successful.
[0250] The specific method is as follows:
[0251] Using a reverse transcription reagent (vazyme, R333), reverse transcription of RNA was performed according to the manufacturer's instructions: 1 μg of circular RNA was added to 4 μL of 5×All-in-one qRT SuperMix and 1 μL of Enzyme Mix, and reverse transcription was performed at 50℃ for 15 min and 85℃ for 5 s to obtain cDNA product.
[0252] After reverse transcription, the cDNA product was fitted with primers before and after the cross-linking site. PCR was performed using the KAPA TaqReadyMix (Merck, KK1006) PCR kit according to the reaction system in Table 5 and the procedure in Table 6. The forward primer was ACGAGGTGCCTCCTAAAGGACTG (SEQ ID NO:19), and the reverse primer was ACACGGACACCCAAAGTAGT (SEQ ID NO:20).
[0253] Table 5
[0254] Solution Volume (50 μL) 2X KAPA Taq ReadyMix 25 μL 10 μM Forward primer 2 μL 10 μM Reverse primer 2 μL Template DNA 1 μL (25 ng - 250 ng) Nuclease free water 20 μL
[0255] Table 6
[0256]
[0257] The results showed that after circularization and PCR, constructs P1-3-5, P2-3-5, P4-3-5, P5-3-5, P6-3-5, and P7-3-5 all produced PCR products that crossed the linkage site (e.g., ...). Figure 6 (As shown). Sequencing verification further confirmed that P1-3-5, P2-3-5, P4-3-5, P5-3-5, P6-3-5, and P7-3-5 can be correctly circularized (e.g., Figure 7 (As shown). The PCR results of this reverse transcription cross-linking site further demonstrate that the "exon 1 element-exon 2 element" sequence (ctt-aaaat) has broad applicability and universality in the preparation of circular RNA via ribozyme action.
[0258] 4. Quantitative detection of cyclization rate after cyclization
[0259] The circular RNA product was reverse transcribed and then quantitatively analyzed by qPCR to determine the proportion of circular RNA in the sample and to ascertain the circularization efficiency. The reverse transcription method was as described in step 3, using Novizan reverse transcription reagent (Vazyme, R333) to reverse transcribe the RNA according to the manufacturer's instructions to obtain cDNA products.
[0260] The cDNA product after reverse transcription was analyzed using real-time PCR. qPCR primers were set before and after the cross-linking site (same as step 3). The Taq Pro Universal SYBR qPCR Master Mix qPCR kit (Novizan, Q712-02) was used to perform qPCR according to the reaction system in Table 7 and the procedure in Table 8. The circular RNA was quantitatively analyzed to detect the proportion of circular RNA and to analyze the circularization efficiency of circular RNA.
[0261] Table 7
[0262] Component Volume added 2X Taq Pro Universal SYBR qPCR Master Mix 10 μL Upstream primer (10 uM) 0.4 μL Downstream primer (10 uM) 0.4 μL DNA template 1 μL [dH2O to] 20 μL
[0263] Table 8
[0264]
[0265]
[0266] Cycloning efficiency results are as follows Figure 8 As shown, the results indicate that all the vectors can be correctly cyclized and have high cyclization efficiency, but the cyclization rate varies among different vectors.
[0267] Example 4. Detection of immunogenicity
[0268] The circular RNA samples prepared in Example 1 using the natural exon of intron P6 and in Example 2 using exons P6-10-10, P6-3-10, and P6-3-5 were used... The samples were purified by chromatography using a 5 μm, 21.2 x 300 mm SEC column (Sepax, 215950-21230). The purity of the purified samples was analyzed using an Agilent 2100 bioanalyzer before further analysis. Results are as follows: Figure 9 As shown, this indicates that highly pure circular RNA samples were obtained.
[0269] The purified circular RNA samples were subjected to immunogenicity detection using the following method:
[0270] One day in advance, mouse muscle cells C2C12 (ATCC) were seeded into 12-well plates. When the cells reached approximately 50% confluence, Lipofectamine was used. TM MessengerMAX TM Transfection reagent (Invitrogen) TM 1 μg of circular RNA (LMRNA008) was transfected into each well. After 24 h of transfection, the cell supernatant was collected, and the expression of mIFN-α (Biolegend, 447904) and mIFN-β (Biolegend, 439404) in the cell supernatant was detected according to the kit instructions. The transfected circular RNAs were circ-p6 (circular RNA prepared from the natural exon of intron P6), circ-p6-10-10 (circular RNA prepared from exon P6-10-10), circ-p6-3-10 (circular RNA prepared from exon P6-3-10), and circ-p6-3-5 (circular RNA prepared from exon P6-3-5). Polyl:C served as a positive control (E0518, selleck), linear-Luc(Ψ) pseudouridine-modified linear mRNA served as a linear control, and circ-con served as a commercial circular RNA control (Novoprotein MR202-M001).
[0271] The results of the immunogenicity test are as follows Figure 10 As shown, the results indicate that the circular RNA prepared using exons P6-10-10, P6-3-10, and P6-3-5 of this disclosure has extremely low immunogenicity compared to commercially available circular RNA or circular RNA prepared from natural exons. It is evident that optimization of the exon sequences of this disclosure can significantly reduce immunogenicity; in particular, the minimal "exon 1 element-exon 2 element" sequence (ctt-aaaat) determined in Example 2 exhibits the lowest immunogenicity.
[0272] Example 5. Validation of the effect of changes in the shortest exon nucleic acid combination
[0273] As seen in Examples 2 and 3 above, the smallest "exon 1-exon 2" sequence (ctt-aaaat) is universal and can achieve cyclization when used with different introns. This example further verifies the core recognition sequences of exon 1 and exon 2. Using intron 6 as an intron, the smallest "exon 1-exon 2" sequence (ctt-aaaat) is mutated and truncated using different bases (as shown in Table 9 below), and the cyclization effect of the resulting exons is verified.
[0274] Table 9
[0275]
[0276]
[0277] The vectors listed in the table were linearized, mRNA prepared, circularized, and subjected to 2100 bioanalysis according to the experimental methods described in Examples 1, 2, and 3. The circularization efficiency of the samples was detected by qPCR.
[0278] 2100 bioanalysis and qPCR results are as follows Figure 11 - Figure 12 As shown, the results indicate that when a single base is substituted or truncated on one side of the universal exon set "ctt-aaaat" of intron 6, the cyclization efficiency varies significantly. The universal exon set "ctt-aaaat" of intron 6 in this application exhibits a significantly higher cyclization efficiency than other exons.
[0279] Example 6. Immunogenicity detection of different exon combinations
[0280] Following the method in Example 4, this example tested the immunogenicity of different exon combinations in Example 5.
[0281] The results showed that the immunogenicity of the circular mRNAs formed after exon shortening was lower than that of wild-type exons.
[0282] Based on the above embodiments, this disclosure defines a universal "exon 1-exon 2" sequence for type I introns. Furthermore, the sequence of the first exon element can be at least ctt, and the sequence of the second exon element can be at least aaaat. This 8-nucleotide-long exon can still successfully guide the splicing and ligation of type I introns to form circular RNA, significantly reducing non-specific immune responses that may be caused by circular RNA. More importantly, the inventors unexpectedly discovered that regardless of the type of type I intron used, circular RNA can be formed through this "exon 1-exon 2" sequence, and the final circular sequence is fixed, indicating that this "exon 1-exon 2" sequence has broad universality and applicability.
[0283] The technical solutions described herein are not limited to the specific embodiments described above. Any technical modifications made based on the technical solutions described herein shall fall within the protection scope of this document.
Claims
1. A universal exome for preparing circular RNA, characterized in that, The universal exon group comprises: a first exon element having a nucleotide sequence truncated, mutated or modified from the sequence shown in SEQ ID NO: 5; and / or a second exon element having a nucleotide sequence truncated, mutated or modified from the sequence shown in SEQ ID NO: 4; The universal exon group has a recognition function of type I intron.
2. The universal exome of claim 1, wherein, The second exon element has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 nucleotides, and / or the first exon element has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 nucleotides; Preferably, the second exon element has 2-15 nucleotides, more preferably 5-10 nucleotides; Preferably, the first exon element has 2-15 nucleotides, more preferably 3-10 nucleotides.
3. The universal exome according to claim 1 or 2, wherein The nucleotide sequence of the second exon element comprises aaaat; and / or the nucleotide sequence of the first exon element comprises ctt; Preferably, the nucleotide sequence of the second exon element is selected from aaaat, aaaatc, aaaatcc, aaaatccg, aaaatccgt or aaaatccgtt; Preferably, the nucleotide sequence of the first exon element is selected from ctt, actt, gactt, ggactt, cggactt, acggactt, tacggactt or ctacggactt; More preferably, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ctt; More preferably, the nucleotide sequence of the first exon element is aaaatccgtt, and the nucleotide sequence of the first exon element is selected from ctt; More preferably, the nucleotide sequence of the second exon element is aaaatccgtt, and the nucleotide sequence of the first exon element is selected from ctacggactt.
4. The universal exome according to claim 1 or 2, wherein The nucleotide sequence of the second exon element is caaat, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is gaaat, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is taaat, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is aaaa, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is aaat, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is aaa, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is aat, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is aat, and the nucleotide sequence of the first exon element is selected from ctt; or the nucleotide sequence of the 2nd exon element is aa, and the nucleotide sequence of the 1st exon element is selected from the group consisting of ctt; or the nucleotide sequence of the 2nd exon element is at, and the nucleotide sequence of the 1st exon element is selected from the group consisting of ctt; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of cat; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of cct; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of cgt; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of ct; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of tt; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of cta; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of ctg; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of ctc; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of caa; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of cgg; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of ccc.
5. A recombinant nucleic acid molecule for preparing a circular RNA, the recombinant nucleic acid molecule comprising: a 1st exon element having a nucleotide sequence truncated, mutated or modified from the sequence set forth in SEQ ID NO: 5; and / or a 2nd exon element having a nucleotide sequence truncated, mutated or modified from the sequence set forth in SEQ ID NO: 4; the 1st exon element and the 2nd exon element have the recognition function of a type I intron.
6. The recombinant nucleic acid molecule of claim 5, wherein, the 2nd exon element has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 nucleotides, and / or the 1st exon element has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 nucleotides; preferably, the 2nd exon element has 2-15 nucleotides, more preferably 5-10 nucleotides; preferably, the 1st exon element has 2-15 nucleotides, more preferably 3-10 nucleotides.
7. The recombinant nucleic acid molecule of claim 5 or 6, wherein, the nucleotide sequence of the 2nd exon element comprises aaaat; and / or the nucleotide sequence of the 1st exon element comprises ctt; Preferably, the nucleotide sequence of the second exon element is selected from aaaat, aaaatc, aaaatcc, aaaatccg, aaaatccgt, or aaaatccgtt; Preferably, the nucleotide sequence of the first exon element is selected from ctt, actt, gactt, ggactt, cggactt, acggactt, tacggactt, or ctacggactt; More preferably, the nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ctt; More preferably, the nucleotide sequence of the second exon element is aaaatccgtt, and the nucleotide sequence of the first exon element is selected from ctt; More preferably, the nucleotide sequence of the second exon element is aaaatccgtt, and the nucleotide sequence of the first exon element is selected from ctacggactt.
8. The recombinant nucleic acid molecule of claim 5 or 6, wherein, The nucleotide sequence of the second exon element is caaat, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is gaaat, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is taaat, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is aaaa, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is aaat, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is aaa, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is aat, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is aa, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is at, and the nucleotide sequence of the first exon element is selected from ctt; or The nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from cat; or The nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from cct; or The nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from cgt; or The nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from ct; or The nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from tt; or The nucleotide sequence of the second exon element is aaaat, and the nucleotide sequence of the first exon element is selected from cta; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of ctc; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of ctc; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of caa; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of cgg; or the nucleotide sequence of the 2nd exon element is aaaat, and the nucleotide sequence of the 1st exon element is selected from the group consisting of ccc.
9. The recombinant nucleic acid molecule of claim 5, wherein, the recombinant nucleic acid molecule further comprises a 3’ intron element and a 5’ intron element; preferably, the 3’ intron element is a 3’ intron element of a Type I intron; and / or, the 5’ intron element is a 5’ intron element of a Type I intron; more preferably, the 3’ intron element has a nucleotide sequence as set forth in any one of SEQ ID NOs: 3, 9, 11, 13, 15, or 17, or a nucleotide sequence having at least 70% sequence identity thereto; more preferably, the 5’ intron element has a nucleotide sequence as set forth in any one of SEQ ID NOs: 6, 10, 12, 14, 16, or 18, or a nucleotide sequence having at least 70% sequence identity thereto; more preferably, the 3’ intron element comprises one or more modifications of nucleotides relative to the nucleotide sequence as set forth in any one of SEQ ID NOs: 3, 9, 11, 13, 15, or 17, the modifications being selected from one or more of deletion, substitution, addition; more preferably, the 5’ intron element comprises one or more modifications of nucleotides relative to the nucleotide sequence as set forth in any one of SEQ ID NOs: 6, 10, 12, 14, 16, or 18, the modifications being selected from one or more of deletion, substitution, addition.
10. The recombinant nucleic acid molecule of claim 5, wherein, the recombinant nucleic acid molecule further comprises a functional element, the functional element comprising a coding region and a non-coding region, the coding region comprising a translation initiation element, a coding element, and optionally a terminator or a termination cassette, the non-coding region comprising one or more internal ribosome entry sites (IRES); preferably, the translation initiation element further comprises an untranslated region (UTR) or a fragment thereof; preferably, the coding element encodes one or more of an antigen, an antigen-binding fragment, a fluorescent protein, a protein having a disease-treating activity, or a protein having a gene-editing activity; preferably, an intervening element is comprised between the translation initiation element and the coding element; more preferably, the intervening element is selected from at least one of (i) a transcriptional level regulatory element, (ii) a translational level regulatory element, (iii) a purification element.
11. The recombinant nucleic acid molecule of any one of claims 7-10, the recombinant nucleic acid molecule comprising, in the 5’ to 3’ direction, operably linked: the 3' intron element, the 2nd exon element, the functional element, the 1st exon element, and the 3' intron element; Preferably, the recombinant nucleic acid molecule is DNA or RNA. Preferably, the 5' end of the recombinant nucleic acid molecule further comprises a promoter.
12. A circular nucleic acid molecule precursor, the circular nucleic acid molecule precursor being obtained by in vitro transcription of the recombinant nucleic acid molecule of any one of claims 5-11.
13. A circular nucleic acid molecule, the circular nucleic acid molecule being produced from the recombinant nucleic acid molecule of any one of claims 5-11 or the circular nucleic acid molecule precursor of claim 12; Preferably, the circular nucleic acid molecule is a circular RNA molecule; More preferably, the circular nucleic acid molecule is a circular mRNA molecule.
14. The circular nucleic acid molecule of claim 13, the circular nucleic acid molecule comprising a 2nd exon element, a functional element, and a 1st exon element operably linked; Preferably, the circular nucleic acid molecule comprises a nucleotide sequence of cttaaaat.
15. An expression vector comprising the universal exonome of any one of claims 1-4 or the recombinant nucleic acid molecule of any one of claims 5-11.
16. A host cell comprising the universal exonome of any one of claims 1-4 or the recombinant nucleic acid molecule of any one of claims 5-11, the circular nucleic acid molecule precursor of claim 12, the circular nucleic acid molecule of claim 13 or 14, or the expression vector of claim 15.
17. A method of forming a circular nucleic acid molecule, the method comprising incubating the recombinant nucleic acid molecule of any one of claims 5-11 or the circular nucleic acid molecule precursor of claim 12 under circularization conditions; Preferably, the circular nucleic acid molecule is a circular RNA molecule; More preferably, the circular nucleic acid molecule is a circular mRNA molecule.
18. A composition comprising the universal exonome of any one of claims 1-4 or the recombinant nucleic acid molecule of any one of claims 5-11, the circular nucleic acid molecule precursor of claim 12, or the circular nucleic acid molecule of claim 13 or 14; Preferably, the composition further comprises a carrier encapsulating the recombinant nucleic acid molecule, the circular nucleic acid molecule precursor, or the circular nucleic acid molecule; Preferably, the composition further comprises a lipid nanoparticle or a lipid polyplex encapsulating the recombinant nucleic acid molecule, the circular nucleic acid molecule precursor, or the circular nucleic acid molecule.
19. A vaccine formulation comprising the recombinant nucleic acid molecule of any one of claims 5-11, the circular nucleic acid molecule precursor of claim 12, the circular nucleic acid molecule of claim 13 or 14, or the composition of claim 18.
20. Use of the universal exon of any one of claims 1-4 or the recombinant nucleic acid molecule of any one of claims 5-11, the precursor of a circular nucleic acid molecule of claim 12, the circular nucleic acid molecule of claim 13 or 14, or the composition of claim 18 in the manufacture of a circular RNA vaccine or drug.
21. The use according to claim 20, wherein the circular RNA vaccine or drug is useful in infectious disease prevention or treatment, tumor immunity, gene therapy, protein replacement therapy, and cell therapy.