Gene for regulating and controlling dehydration rate and flowering period of corn kernels and application of gene

Abstract

The invention relates to the technical field of molecular inheritance and genetic engineering, in particular to a gene ZmGDR1 for regulating and controlling the dehydration rate and the flowering phase of corn kernels and application of the gene ZmGDR1, and the gene ZmGDR1 has a polynucleotide sequence as shown in SEQ ID NO: 1 or an amino acid sequence as shown in SEQ ID NO: 4. The ZmGDR1 provided by the invention can effectively regulate and control the water content and the dehydration rate of corn kernels, and meanwhile, the flowering period of corn is advanced, so that a new gene resource is provided for cultivating a new variety of early-maturing and rapid-dehydration corn.

Description

Technical Field

[0001] The present application relates to the field of molecular genetics and genetic engineering technology, and in particular to a gene for regulating the dehydration rate and flowering period of corn kernels and its application. Background Art

[0002] Maize (Zea mays L.) is one of the world's most important grain crops. To reduce the costs of corn harvesting and post-harvest kernel dehydration, mechanized corn kernel harvesting is an inevitable trend in modern agricultural development (Li Shaokun et al., 2016). A lower kernel moisture content (e.g., 15-25% at harvest) can prevent kernel breakage during mechanical harvesting, thereby improving grain yield and quality. However, the kernel moisture content of current maize hybrids in my country varies between 25-40% at harvest, severely limiting the use of mechanical harvesting and increasing drying and storage costs (Chai Zongwen et al., 2017).

[0003] Grain dehydration rate (GDR) is a key factor determining corn moisture content at harvest. Numerous studies have shown that GDR is associated with various agronomic traits, including bracts, pedicel, seed coat, cob size, and cob color (Cavalieri et al., 1985; Crane et al., 1959; Liang et al., 2022). Some studies have obtained some quantitative trait loci (QTLs) that control maize grain moisture content and dehydration rate, such as q45dGM1-1, qHTGM2-2, qAUDDC2-1 and qAUDDC10-1 located on chromosomes 1, 2 and 10 (Zhang J, Zhang F, Tang B, et al. Molecular mapping of quantitative trait loci for grain moisture at harvest and field grain drying rate in maize (Zea mays L.) [J]. Physiol Plant, 2020, 169 (1): 64-72.), and qGwc1.1 and qGwc1.2 located on chromosome 1 (Liu J, Yu H, Liu Y, et al. Genetic dissection of grainwater content and dehydration rate related to mechanical harvest in maize [J]. BMC Plant Biol, 2020, 20(1): 118.), but it did not clone the genes that control the moisture content of corn kernels and its changes.

[0004] In addition, the corn flowering period is also an important determinant of the corn growth cycle. The early flowering period of corn shortens the corn growth cycle. The early-maturing corn varieties proposed in this way provide operational space for land rotation planning and avoidance of severe climate (such as the extremely cold weather in the Northeast).

[0005] Therefore, it is of great significance to agricultural production to identify and propose genes that can effectively regulate the dehydration rate and flowering period of corn kernels, and to genetically modify corn based on them to propose early-maturing corn varieties with accelerated corn kernel dehydration rate and earlier flowering period. Summary of the Invention

[0006] The present application solves at least one of the problems of the related art from the following aspects.

[0007] To this end, the embodiments of the present application provide the use of a nucleic acid in promoting early maturity of corn, wherein the nucleic acid is used to (i) regulate the moisture content and / or dehydration rate of corn kernels; and / or (ii) regulate the flowering period of corn, wherein the nucleic acid: a. has a polynucleotide sequence as shown in any one of SEQ ID NO: 1 to SEQ D NO: 3; b. encodes a polynucleotide sequence as shown in SEQ ID NO: 4; c. is a polynucleotide sequence that can hybridize with the polynucleotide sequence described in a or b under stringent hybridization conditions, which still has the function of (i) regulating the moisture content and / or dehydration rate of corn kernels; and / or (ii) regulating the flowering period of corn; or d. is a polynucleotide sequence that has at least 90%, at least 95% or at least 99% identity with the polynucleotide sequence described in any one of ac, which still has the function of (i) regulating the moisture content and / or dehydration rate of corn kernels; and / or (ii) regulating the flowering period of corn.

[0008] The embodiments of the present application also provide an expression cassette, a recombinant expression vector or a recombinant cell, wherein the expression cassette, the recombinant expression vector or the recombinant cell comprises a nucleic acid as defined in any embodiment of the present application.

[0009] In some embodiments, the expression cassette, recombinant expression vector or recombinant cell is a recombinant eukaryotic expression cassette, a recombinant eukaryotic expression vector or a recombinant plant cell, respectively. In some embodiments, the recombinant eukaryotic expression cassette or recombinant eukaryotic expression vector is a recombinant plant expression cassette or a recombinant plant expression vector.

[0010] The embodiments of the present application also provide the use of a protein in promoting early maturity of corn, wherein the protein is used to (i) regulate the moisture content and / or dehydration rate of corn kernels; and / or (ii) regulate the flowering period of corn, wherein the protein: a. has an amino acid sequence as shown in SEQ ID NO: 4, or b. has an amino acid sequence with at least 90%, 95% or 99% identity with the amino acid sequence shown in SEQ ID NO: 4, which has the function of (i) regulating the moisture content and / or dehydration rate of corn kernels; and / or (ii) regulating the flowering period of corn.

[0011] In some embodiments, the nucleic acid, the expression cassette, the recombinant expression vector or the recombinant cell, or the protein is used to (i) reduce the moisture content of corn kernels and / or increase the dehydration rate of corn kernels; and / or (ii) advance the flowering time of corn.

[0012] The embodiments of the present application also provide a method for promoting early maturity of corn, comprising: increasing the expression level of the nucleic acid or protein defined in any embodiment of the present application in corn and / or enhancing the activity of the protein.

[0013] In some embodiments, the method comprises: (i) reducing the moisture content of corn kernels and / or increasing the dehydration rate of corn kernels; and / or (ii) advancing the flowering time of corn.

[0014] In some embodiments, one or more strong promoters, promoters and / or enhancers are introduced into corn to increase the expression level of the nucleic acid or the protein, wherein the strong promoter is optionally selected from the group consisting of CaMV 35S promoter, Cs-VMV promoter and ubiquitin promoter.

[0015] The embodiments of the present application also provide a method for breeding early-maturing corn varieties, wherein the early-maturing corn varieties have (i) reduced grain moisture content and / or increased grain dehydration rate; and / or (ii) advanced flowering period, the method comprising: increasing the expression level of the nucleic acid or protein as defined in any embodiment of the present application in corn and / or enhancing the activity of the protein.

[0016] In some embodiments, the method further comprises: selecting corn plants with (i) reduced grain moisture content and / or increased grain dehydration rate; and / or (ii) early flowering period, and continuing to cultivate until a stable line is obtained, wherein the stable line has (i) stably reduced grain moisture content and / or stably increased dehydration rate; and / or (ii) stably early flowering period; and harvesting the grains of the stable line to serve as breeding material for the corn line.

[0017] The present application also provides for the use of a substance that increases the expression of a nucleic acid or protein and / or enhances the activity of the protein as defined in any of the embodiments of the present application for promoting early maturity in corn, wherein the substance is used to (i) regulate corn kernel moisture content and / or dehydration rate; and / or (ii) regulate corn flowering time. In some embodiments, the substance comprises one or more strong promoters, promoters, and / or enhancers, wherein the strong promoter is optionally selected from the group consisting of the CaMV 35S promoter, the Cs-VMV promoter, and the ubiquitin promoter.

[0018] The embodiments of the present application also provide the use of the nucleic acid, expression cassette, recombinant expression vector or recombinant cell or protein as described in any of the above embodiments in delaying corn maturity, wherein the nucleic acid, expression cassette, recombinant expression vector or recombinant cell or protein is used to: (i) increase the moisture content of corn kernels and / or increase the dehydration rate of corn kernels; and / or (ii) delay the flowering period of corn.

[0019] The embodiments of the present application also provide a method for delaying corn maturity, comprising: inhibiting or silencing the expression of a nucleic acid as defined in any embodiment or a protein as defined in any embodiment in corn and / or reducing or inactivating the activity of the protein.

[0020] In some embodiments, the expression of a nucleic acid as defined in any embodiment or a protein as defined in any embodiment is inhibited or silenced by methods such as gene knockout or knockdown, for example, RNA interference (RNAi), gene editing by the CRISPR / Cas9 system, transcription activator-like effector nuclease (TALEN) technology, zinc finger nuclease technology, etc.

[0021] The embodiments of the present application also provide a method for breeding late-maturing corn varieties, wherein the late-maturing corn varieties have (i) increased grain moisture content and / or reduced grain dehydration rate; and / or (ii) delayed flowering, the method comprising: inhibiting or silencing the expression of a nucleic acid as defined in any embodiment or a protein as defined in any embodiment in corn and / or reducing or inactivating the activity of the protein.

[0022] The embodiments of the present application achieve the following beneficial effects: This application screened and located the gene ZmGDR1, which regulates the dehydration rate and flowering period of maize kernels. Modulating its expression effectively reduced kernel moisture content and accelerated dehydration. The application also found that the gene also affects the flowering period of maize, with overexpression of ZmGDR1 promoting early flowering. This application lays a theoretical foundation for identifying genes involved in kernel dehydration and elucidating the mechanisms of kernel dehydration. It also provides new genetic resources for breeding new early-maturing, rapidly dehydrating maize varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0024] Figure 1 This is an agarose gel electrophoresis diagram of the PCR product of the ZmGDR1_T02 transcript according to Example 1 of the present application; Figure 2 shows the relative expression levels of ZmGDR1 in the ZmGDR1 overexpression lines OE1 and OE2 according to Example 2 of the present application; Figure 3 The figures show the grain moisture content statistics after pollination of the ZmGDR1 overexpression lines OE1 and OE2 according to Example 3 of the present application, and the flowering period (pollination period and silking period) statistics of the ZmGDR1 overexpression lines OE1 and OE2 according to Example 6 of the present application; Figure 4 This is a gene knockout roadmap for the ZmGDR1-deficient strain according to Example 4 of the present application; Figure 5 The grain moisture content statistics after pollination of the ZmGDR1-deficient strains C1 and C2 according to Example 5 of the present application and the flowering period (pollination period and silking period) statistics of the ZmGDR1-deficient strains C1 and C2 according to Example 6 of the present application are shown. DETAILED DESCRIPTION

[0025] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0026] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. All reagents or instruments used without specifying the manufacturer are commercially available conventional products.

[0027] This application is made based on the following knowledge of the inventors: Grain dehydration rate (GDR) is a key factor determining grain moisture content at harvest. Numerous studies have shown that maize kernel dehydration rate is associated with various agronomic traits, including bract, pedicel, seed coat, cob size, and cob color (Cavalieri et al., 1985; Crane et al., 1959; Liang et al., 2022). Regarding the molecular mechanisms of maize kernel dehydration, much research has focused on understanding the genetic basis of kernel dehydration rate and kernel moisture content, both of which are complex quantitative traits. The broad-sense and narrow-sense heritabilities associated with maize GDR after physiological maturity are very high, with a broad-sense heritability of 81.45% and a narrow-sense heritability of 61.71%, indicating that GDR after physiological maturity is largely controlled by genetic factors and less influenced by environmental factors (Zhang et al., 2007). Currently, most studies on dehydration-related loci or gene functions focus on understanding the genetic basis of grain moisture content and grain dehydration rate, and using techniques such as QTL or GWAS to locate loci related to grain dehydration rate and grain moisture content.

[0028] Although many QTLs and candidate genes have been identified, there are few studies on the precise positioning of QTLs and cloning of candidate genes. Most studies remain at the initial QTL positioning stage, and the discovery and functional analysis of key genes are very limited. The molecular mechanism of corn kernel dehydration is still unclear.

[0029] To this end, the inventors of the present application, after extensive experiments, screened and located a gene in maize that is involved in regulating kernel moisture content / dehydration rate and flowering time. This gene is located at Chr3:191697538-191718032 of the maize reference genome B73. The gene ID in the B73 genome is Zm00001d043206 (https: / / maizegdb.org / gene_center / gene / Zm00001d043206). This application names it ZmGDR1, and its sequence is shown in SEQ ID NO: 1. The examples of this application further disclose methods for manipulating ZmGDR1 using genetic engineering to alter kernel dehydration rate, moisture content, and flowering time.

[0030] In the examples of the present application, unless otherwise indicated, nucleic acids are written from left to right in the 5' to 3' direction; amino acid sequences are written from left to right in the amino to carboxyl direction. Amino acids can be represented herein by their commonly known three-letter symbols or the single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Committee. Similarly, nucleotides can be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the ranges. As used herein, "nucleic acid" includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides, which hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encoding" or "encoded" when used in the context of a specific nucleic acid refers to the nucleic acid containing the necessary information to guide the translation of the nucleotide sequence into a specific protein. Codons are used to represent protein-encoding information. As used herein, the "full-length sequence" of a specific polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the specific protein. The terms "polypeptide," "polypeptide," and "protein" are used interchangeably herein to refer to polymers of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). Amino acids can be naturally occurring amino acids and, unless otherwise limited, can include known analogs of naturally occurring amino acids that can function in a manner similar to naturally occurring amino acids.

[0031] In the present application embodiment, the term " identity percentage " about nucleic acid or peptide sequence is defined as after arranging sequence to obtain maximum identity percentage and introducing breach (if necessary) to realize maximum homology percentage, the percentage of nucleotide or amino acid residue identical with known polypeptide in candidate sequence.N-terminal or C-terminal insertion or deletion should not be interpreted as affecting homology.Homology or identity on nucleotide or amino acid sequence level can be determined by BLAST (basic local alignment search tool, Basic Local Alignment Search Tool) analysis, described analysis uses the algorithm (Altschul (1997) adopted by program blastp, blastn, blastx, tblastn and tblastx, Nucleic Acids Res [nucleic acids research] 25,3389-3402 and Karlin (1990), Proc.Natl.Acad.Sci.USA [U.S. National Academy of Sciences] 87,2264-2268), described program is customized for sequence similarity search.

[0032] In the embodiments of the present application, the nucleic acid has a polynucleotide sequence as shown in any one of SEQ ID NOs: 1-3, or a sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, or 80% identical to any one of SEQ ID NOs: 1-3 (including endpoint values), wherein the percentage of identity generally describes the degree to which the two sequences are identical, that is, it generally describes the percentage of nucleotides that correspond to the same nucleotides in the reference sequence at their sequence positions. In some embodiments, the nucleic acid has a polynucleotide sequence as shown in any one of SEQ ID NOs: 1-3, or a sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, or 80% identical to any one of SEQ ID NOs: 1-3 (including endpoint values), wherein the percentage of identity generally describes the degree to which the two sequences are identical, that is, it generally describes the percentage of nucleotides that correspond to the same nucleotides in the reference sequence at their sequence positions. At least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.1%, at least 98.2%, at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, or at least 99%, at least 99.1% compared to any one of NOs. 1-3. , at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.91%, at least 99.92%, at least 99.93%, at least 99.94%, at least 99.95%, at least 99.96%, at least 99.97%, at least 99.98%, at least 99.99% or any value therebetween (e.g., sequence identity represented by an infinite number of decimals between two adjacent integers) but less than 100% identical nucleotide sequence, wherein the nucleic acid has one or more single nucleotide mutations compared to any one of SEQ ID NOs: 1-3, and the mutant nucleic acid still has the function of (i) regulating corn kernel moisture content and / or dehydration rate; and / or (ii) regulating corn flowering time.

[0033] In the embodiments of the present application, the protein has the amino acid sequence shown in SEQ ID NO: 4, or a sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, or 80% identical to SEQ ID NO: 4 (including endpoint values). In some embodiments, the protein is identical to SEQ ID NO: %, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, or at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.9%, or ... .4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.91%, at least 99.92%, at least 99.93%, at least 99.94%, at least 99.95%, at least 99.96%, at least 99.97%, at least 99.98%, at least 99.99% or any value therebetween (e.g., sequence identity represented by an infinite number of decimals between two adjacent integers) but less than 100%, said mutant protein still has the function of (i) regulating the moisture content and / or dehydration rate of corn kernels; and / or (ii) regulating the flowering time of corn. In some embodiments, unless otherwise specified, except for the specified mutations, the remaining amino acids of the protein are identical to those of SEQ ID NO: 4 or are conservative substitutions corresponding to the amino acids of SEQ ID NO: 4.

[0034] In the present application embodiment, the term "stringent conditions" or "stringent hybridization conditions" means conditions under which, relative to hybridization with other sequences, the probe will hybridize to its target sequence to a detectable greater extent (e.g., at least 2 times, 5 times, or 10 times the background). Stringent conditions are sequence-dependent and vary in different environments. By controlling hybridization stringency and / or controlling cleaning conditions, a target sequence that is 100% complementary to the probe can be identified (homologous probe method). Alternatively, stringent conditions can be adjusted to allow some sequence mispairings to detect lower similarity (heterologous probe method). Typically, the probe length is less than approximately 1000 or 500 nucleotides. Typically, stringent conditions are those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 M to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions can also be achieved by adding destabilizing agents such as formamide.

[0035] In the present examples, the term "quantitative trait locus" or "QTL" refers to a polymorphic locus with at least one allele that is associated with differential expression of a phenotypic trait in at least one genetic background (e.g., in at least one breeding population or progeny). A QTL can function through either a single gene mechanism or a multi-gene mechanism.

[0036] In the examples of the present application, the expression cassette refers to a DNA capable of expressing ZmGDR1 in a host cell, and the DNA may include not only a promoter for initiating transcription of the ZmGDR1 gene, but also a terminator for terminating transcription of the ZmGDR1 gene. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue-, organ- and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the ubiquitin gene Ubiqutin promoter (pUbi); the constitutive promoter 35S of the cauliflower mosaic virus (CaMV 35S promoter); a wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); a chemically inducible promoter from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); a tomato proteinase inhibitor II promoter (PIN2) or LAP promoter (both inducible by methyl jasmonate); a heat shock promoter (U.S. Pat. No. 5,187,267); a tetracycline-inducible promoter (U.S. Pat. No. 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent No. 200710099169.7)), and promoters specific for seed storage proteins (e.g., the promoters for phaseolin, napin, oleosin, and soybean beta-conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters.All references cited herein are incorporated in their entirety.Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators (see, e.g., Odell et al. (1985) Nature 313:810; Posenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0037] In the examples of the present application, a recombinant expression vector containing the ZmGDR1 gene expression cassette was constructed. The plant expression vector used can be a binary Agrobacterium vector or a Gateway system vector, such as pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pGWB411, pGWB412, pGWB405, pCAMBIA1391-Xa, or pCAMBIA1391-Xb. When using ZmGDR1 to construct a recombinant expression vector, any enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiqutin promoter (pUbi), etc. These can be used alone or in combination with other plant promoters. In addition, when using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging and can be natural or synthetic. The translation initiation region can be derived from the transcription initiation region or the structural gene.

[0038] In the examples of the present application, in order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used may be processed, such as by adding a gene encoding an enzyme or luminescent compound that can be expressed in plants (such as a GUS gene or a luciferase gene), an antibiotic resistance marker (such as a gentamicin marker or a kanamycin marker), or a chemical resistance marker gene (such as a herbicide resistance gene).

[0039] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0040] Unless otherwise specified, the quantitative analysis experiments in the following examples were performed three times, and the results were averaged.

[0041] The maize recipient material inbred line used in the following examples of this application is B73-329, which is described in the article "Wei Li, et al. Maize ZmR PH1 encodes a microtubule-associated protein that controls plant and ear hight. Plant Biotechnology Journal (2020) 18, pp. 1345-1347"; the Agrobacterium strain is EHA105; the cDNA of B73 used as an amplification template and the vectors pBCXUN-Myc and pBUE411 were provided by the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University. The above materials are available to the public from the applicant and may be used to replicate the experiments of the present invention and may not be used for other purposes.

[0042] Example 1 1.1 Screening of ZmGDR1 The grain weight and moisture content of 700 elite temperate inbred lines from China and abroad, B73-329, were measured 31 days after pollination and 45 days after pollination, yielding a total of 660 available inbred line data on grain moisture content. The specific dehydration rate was calculated based on the moisture content, and basic statistics were performed. This phenotypic data was then used for GWAS analysis (Uffelmann, E., Huang, Q.Q., Munung, N. Set et al.. Genome-wide association studies. Nat Rev Methods Primers 1, 59 (2021).), where corn kernel moisture content = (fresh weight - dry weight) / fresh weight × 100%.

[0043] Analysis revealed a significant locus on maize chromosome 3 that is significantly associated with the dehydration rate per unit mass, with a LOD greater than 8.0. We found that within 50 kilobases upstream and downstream of this locus, there is only one gene, Zm00001d043206, which we named grain dehydration rate related 1 (ZmGDR1). Its sequence is shown in SEQ ID NO: 1. We identified ZmGDR1 as a candidate gene for the dehydration trait in maize.

[0044] 1.2 Cloning of ZmGDR1 B73 kernels 15 days after pollination were quickly frozen in liquid nitrogen and ground. Total RNA was then extracted using TRIpure Reagent (Adlai Biotech). First-strand cDNA was synthesized using the TRUEscript 1st Strand cDNA Synthesis Kit (Adlai Biotech) and used as a template to amplify the ZmGDR1 transcript. PCR amplification was performed using primers specific for the ZmGDR1_T02 transcript (F1: TTGATTTCTGAAGAAGATCTTCCAATACTAATGCCTGCGCAAAAGCGC, SEQ ID NO: 5; R1: CGGGGAAATTCGGATCCCCAATACTGTCTCGAGTTTTCAAAGC, SEQ ID NO: 6) designed based on the maize B73 genome reference sequence (https: / / maizegdb.org / gene_center / gene / Zm00001d043206). PCR products were obtained.

[0045] use The ZmGDR1 transcript gene sequence was amplified using the Max Super Fidelity DNA Polymerase Kit (Novagen). The reaction system was performed according to the reagent instructions. The PCR amplification program was as follows: 95°C for 3 min; 95°C for 15 s, 58°C for 15 s, and 72°C for 40 s, for 40 cycles; and 72°C for 5 min. The PCR product was electrophoresed on a 1.5% agarose gel. The electrophoresis results are shown in Figure 2. Figure 1 As shown. The gel was cut and the gel was recovered using the Gel Extraction Kit (Kangwei Century Biotechnology Co., Ltd.) to obtain the purified fragment. The recovered gene fragment was ligated with the overexpression tag vector pBECXUN-Myc. The 10 μL recombination reaction system consisted of: 1 μL of the recovered ZmGDR1 gene fragment, 3 μL of pGADT7, and 2 μL of 5×CEII Buffer. II 1 μL, ddH2O to 10 μL; ligation at 37°C for 30 min. Take 5 μL of the ligation product (pBECXUN-Myc-GDR1) and transform it into Escherichia coli DH5α using the heat shock method. Positive clones are screened on LB solid plates containing 50 mg / L ampicillin. Five single clones are selected for sequencing. Gene sequence alignment is performed based on the sequencing results. The correct transcript is obtained, thus obtaining the ZmGDR1_T02 transcript gene. Sequencing results show that the cDNA sequence of this gene is 1293 bp in length (SEQ ID NO: 2), of which the coding region sequence (i.e., CDS) is shown in SEQ ID NO: 3. The ZmGDR1_T02 protein sequence encoded by SEQ ID NO: 3 is shown in SEQ ID NO: 4.

[0046] cDNA sequence (SEQ ID NO: 2): ZmGDR1_T02-CDS (SEQ ID NO: 3): ZmGDR1_T02 protein sequence (SEQ ID NO: 4): Example 2 - Acquisition and identification of ZmGDR1 overexpressing transgenic maize lines The pBECXUN-Myc-GDR1 overexpression vector constructed in Example 1 was extracted using the TIANprep Rapid Mini Plasmid Kit (Tiangen Biotech (Beijing) Co., Ltd.). This overexpression vector was transformed into Agrobacterium tumefaciens strain EHA105 according to conventional methods in the art. The ZmGDR1 gene was transferred into immature embryos of the maize inbred line ND101 via Agrobacterium-mediated transfection, and T0-generation transgenic plants were obtained through tissue culture. The identified T0-generation plants were transplanted into a greenhouse at the West Campus of China Agricultural University. Positive transgenic plants were identified using PCR amplification, and strict self-pollination was performed to obtain seeds. Following the above method, three generations of self-pollination were performed to obtain the T3-generation homozygous overexpression lines OE1 and OE2.

[0047] To detect the gene expression efficiency of ZmGDR1 in the obtained strains, leaves from the background material ND101 and the overexpression strains OE1 and OE2 were extracted, quick-frozen in liquid nitrogen, and ground. Total RNA was then extracted using TRIpure Reagent Total RNA Extraction Reagent (Adlai Biotechnology). First-strand cDNA was synthesized using the TRUEscript 1st Strand cDNA Synthesis Kit (Adlai Biotechnology). The expression level of ZmGDR1 was detected by fluorescent quantitative PCR using the SuperStar Universal SYBR Master Mix RT-qPCR Kit. The results showed that compared with the background material ND101, the expression level of ZmGDR1 in both overexpression strains was significantly increased ( Figure 2 "★★★", p < 0.001; One-Way ANOVA), indicating that an overexpression line with increased expression was successfully obtained. Subsequent experiments were performed using T3 generation transgenic homozygous seeds.

[0048] Example 3 This example explores the effect of ZmGDR1 overexpression on grain dehydration. Specifically, field experiments were conducted on the obtained ZmGDR1 expression lines OE1 and OE2 to determine the moisture content of the grains. Representative plants with consistent silking period, health and no pests and diseases were selected from each plot for marking. At 25 days after pollination (25DAP), 35 days after pollination (35DAP) and 40 days after pollination (40DAP), 3 ears of each of the overexpression lines OE1, OE2 and the background material ND101 were taken, 100 grains were taken from the middle of the ear, and their fresh weight was quickly determined. They were then withered at 105°C for 30 minutes, dried at 75°C to constant weight, and weighed. The measurement results are as follows: Figure 3 As shown in the upper left bar graph (corn kernel moisture content = (fresh weight - dry weight) / fresh weight × 100%). Figure 3 The results showed that 25 days after pollination, the moisture content of the grains of the overexpression strain was significantly lower than that of the background material ND101, indicating that the dehydration of the grains of the ZmGDR1 gene overexpression strain was accelerated ("★", p < 0.1; "★★", p < 0.01; no mark indicates no significant difference, One Way ANOVA).

[0049] In addition, nuclear magnetic resonance technology can utilize the resonance phenomenon of hydrogen protons in the gradient magnetic field and radio frequency pulses to receive the resonance signal of the excited protons through the radio frequency coil. Water molecules exist in different states in corn kernels. Through the nuclear magnetic resonance instrument, nuclear magnetic signals of different states can be extracted. According to the signal intensity and signal amount in different parts of the kernels, the distribution of water in the kernels can be visualized. We used the nuclear magnetic resonance method to analyze the distribution of water in the cross section of kernels in the background material ND101 and the two overexpression lines OE1 and OE2 at 25 days after pollination, 35 days after pollination, and 40 days after pollination. We found that kernel dehydration first started from the endosperm, and gradually dehydrated from both sides of the endosperm to the center of the kernel, and finally dehydrated toward the embryo. At 25 days after pollination, the endosperm part of the kernels of the overexpression line dehydrated significantly faster than the background material ND101 - reference Figure 3 The pseudo-color image of the water signal distribution obtained by NMR (see bottom left) shows that dark blue and dark red signals represent high and low water content, respectively. The water signal distribution 25 days after pollination shows that the endosperm of the overexpression strain changes from green to blue before the background material ND101, indicating that the water content of this part of the overexpression strain begins to decline earlier than the background material ND101, indicating that it dehydrates faster.

[0050] Example 4 - Acquisition and identification of ZmGDR1-deficient transgenic maize lines In this example, a ZmGDR1-deficient transgenic maize line was constructed to investigate the effect of ZmGDR1 deficiency on grain dehydration. Specifically, ZmGDR1 was deleted from the genome of the background material ND101 using CRISPR / Cas9 editing technology. The deletion route is shown in FIG. Figure 4 Among them, a single-target gRNA design: 5'-GCGCTGTATACCCGGTGAT-3' (SEQ ID NO: 7) was used to construct the T02 transcript knockout strain C1 (primers used: C1F: AATAATGGTCTCAGGCGGCGCTGTATACCCGGTGAT, SEQ ID NO: 8; C1F0: GGCGCTGTATACCCGGTGATGTTTTAGAGCTAGAAATAGC, SEQ ID NO: 9) and constructed into the pXUE411C-BG vector.

[0051] The T01 transcript knockout strain C2 was constructed using a dual-target design of gRNA1: 5'-CCACCCCCGATGATTCCGA-3' (SEQ ID NO: 10) and gRNA2: 5'-GAAGCATGGACGAGTAAGC-3' (SEQ ID NO: 11) (primers used: C2F: AATAATGGTCTCAGGCGCCACCCCCGATGATTCCGA, SEQ ID NO: 12; C2F0: GCCACCCCCGATGATTCCGAGTTTTAGAGCTAGAAATAGC, SEQ ID NO: 13; C2R0: GAAGCATGGACGAGTAAGCCGCTTCTTGGTGCC, SEQ ID NO: 14; C2F: ATTATTGGTCTCTAAACGAAGCATGGACGAGTAAGC, SEQ ID NO: 15) and constructed into the pXUE411C-BG vector.

[0052] The above vectors were transformed into Agrobacterium EHA105 strains. Transgenic operation was carried out by Agrobacterium-mediated transfer into the immature embryos of the maize inbred line ND101, and T0 generation transgenic plants were obtained by tissue culture. The screening method was the same as in Example 2, and T3 generation homozygous gene-edited strains C1 and C2 were obtained at the same time. In order to detect the genotype of ZmGDR1 in the obtained strains, the leaves of the background material ND101 and the knockout gene-edited strains C1 and C2 seedlings were extracted respectively, quick-frozen and ground with liquid nitrogen, and then the plant genomic DNA was extracted by the CTAB method. The genotype of the knockout strain was obtained by sequencing, which is referred to as the ZmGDR1 deletion type in the examples of this application.

[0053] Example 5 This example is based on the ZmGDR1-c1 and ZmGDR1-c2 deletion lines obtained in Example 4 to explore the effect of ZmGDR1 deletion on grain dehydration. Specifically, field experiments were conducted according to the experimental method in Example 3 above to obtain the grain moisture content 25 days after pollination and 40 days after pollination. The measurement results are as follows: Figure 5 Shown in the upper left bar graph. Figure 5 The results showed that the ZmGDR1-deficient plants C1 and C2 had no significant effect on grain moisture content. Figure 5 The grain phenotype and NMR water signal distribution diagrams of the background material ND101, mutant lines C1 and C2 are also shown ( Figure 5 Lower left, MRI image showing the moisture content of the grain). Figure 5 The NMR analysis also showed no significant difference trend. The above results indicate that the loss of ZmGDR1 has no significant effect on the dehydration characteristics of maize kernels.

[0054] Example 6 - Effect of Overexpression of ZmGDR1 Gene on Maize Flowering Stage This example explores the effect of ZmGDR1 on maize flowering period based on the ZmGDR1 overexpression lines OE1 and OE2 constructed in Example 2 and the deletion lines C1 and C2 constructed in Example 4. Specifically, in a field experiment, the pollen shedding and silking periods of the background material ND101, the overexpression lines OE1 and OE2, and the deletion lines C1 and C2 were statistically analyzed (the pollen shedding and silking periods are indicative of the flowering period). The statistical results are shown in Figure 2. Figure 3 and Figure 5 on the right side, where Figure 3 and Figure 5 The violin plots on the upper right side show the background material ND101, overexpression lines OE1, OE2 ( Figure 3 ) and deletion strains C1, C2 ( Figure 5 ) during the pollination and silking periods, and the corresponding phenotypes are shown on the lower right. Figure 3 and Figure 5 As shown, compared to ND101, the flowering date of the overexpression lines OE1 and OE2 was advanced, while the deletion lines C1 and C2 showed no significant changes ("★", p < 0.1; "★★★", p < 0.001; no mark indicates no significant difference, one-way ANOVA). This indicates that overexpression of the ZmGDR1 gene can significantly advance the flowering date of maize, thus having important implications for early maize maturity.

[0055] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0056] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. The application of nucleic acid in promoting early maturity of corn is characterized by: The nucleic acid is used for (i) regulating the moisture content and / or dehydration rate of corn kernels; and / or (ii) regulating the flowering period of corn, wherein the nucleic acid: a. having a polynucleotide sequence as shown in any one of SEQ ID NO: 1 to SEQ ID NO: 3; b. a polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 4; c. A polynucleotide sequence capable of hybridizing to the polynucleotide sequence described in a or b under stringent hybridization conditions, which still has the function of (i) regulating the moisture content and / or dehydration rate of corn kernels; and / or (ii) regulating the flowering period of corn; or d. A polynucleotide sequence that is at least 90%, at least 95% or at least 99% identical to the polynucleotide sequence described in any one of ac, which still has the function of (i) regulating the moisture content and / or dehydration rate of corn kernels; and / or (ii) regulating the flowering period of corn.

2. An expression cassette, a recombinant expression vector or a recombinant cell, characterized in that: The expression cassette, recombinant expression vector or recombinant cell comprises the nucleic acid as defined in claim 1, Optionally, the expression cassette, recombinant expression vector or recombinant cell is a recombinant eukaryotic expression cassette, a recombinant eukaryotic expression vector or a recombinant plant cell, respectively; preferably, the recombinant eukaryotic expression cassette or recombinant eukaryotic expression vector is a recombinant plant expression cassette or a recombinant plant expression vector.

3. The application of protein in promoting early maturity of corn, characterized in that: The protein is used for (i) regulating the moisture content and / or dehydration rate of corn kernels; and / or (ii) regulating the flowering period of corn, wherein the protein: a. having an amino acid sequence as shown in SEQ ID NO: 4, or b. An amino acid sequence that is at least 90%, 95% or 99% identical to the amino acid sequence shown in SEQ ID NO: 4, which has the function of (i) regulating the moisture content and / or dehydration rate of corn kernels; and / or (ii) regulating the flowering period of corn.

4. The use according to claim 1 or 3 or the expression cassette, recombinant expression vector or recombinant cell according to claim 2, characterized in that: The nucleic acid, the expression cassette, the recombinant expression vector or the recombinant cell or the protein is used for (i) reducing the moisture content of corn kernels and / or increasing the dehydration rate of corn kernels; and / or (ii) advancing the flowering period of corn.

5. A method for promoting early maturity of corn, characterized in that: The method comprises: increasing the expression level of the nucleic acid defined in claim 1 or the protein defined in claim 3 in corn and / or enhancing the activity of the protein.

6. The method according to claim 5, characterized in that The method comprises: (i) reducing the moisture content of corn kernels and / or increasing the dehydration rate of corn kernels; and / or (ii) advancing the flowering period of corn.

7. The method according to claim 5 or 6, characterized in that By introducing one or more strong promoters, accelerators and / or enhancers into corn to increase the expression level of the nucleic acid or the protein, The strong promoter is optionally selected from the group consisting of CaMV 35S promoter, Cs-VMV promoter and ubiquitin promoter.

8. A method for cultivating early-maturing corn varieties, characterized in that: The early-maturing corn variety has (i) reduced grain moisture content and / or increased grain dehydration rate; and / or (ii) early flowering, and the method comprises: increasing the expression level of the nucleic acid as defined in claim 1 or the protein as defined in claim 3 in corn and / or enhancing the activity of the protein.

9. The method according to claim 8, characterized in that The method further comprises: Selecting corn plants with (i) reduced kernel moisture content and / or increased kernel dehydration rate; and / or (ii) early flowering and continuing to cultivate until a stable line is obtained, wherein the stable line has (i) stably reduced kernel moisture content and / or stably increased dehydration rate; and / or (ii) stably early flowering; and The kernels of the stable lines are harvested to serve as propagation material for the corn lines.

10. Use of a substance that increases the expression level of the nucleic acid as defined in claim 1 or the protein as defined in claim 3 and / or enhances the activity of the protein in promoting early maturity of corn, characterized in that: The substance is used for (i) regulating the moisture content and / or dehydration rate of corn kernels; and / or (ii) regulating the flowering period of corn, The substance optionally includes one or more strong promoters, accelerators and / or enhancers, The strong promoter is optionally selected from the group consisting of CaMV 35S promoter, Cs-VMV promoter and ubiquitin promoter.

Images