A method for fixing rice heterosis using DMP gene
By knocking out the OsPAIR1, OsREC8, OsOSD1, and OsDMP genes in rice and combining CRISPR/Cas9 with Agrobacterium transformation technology, we successfully constructed an apomixis system with a high fruit set rate, solving the problem of low efficiency in fixing hybrid vigor in rice and improving agricultural production efficiency.
Patent Information
- Application Number
- CN202510976754.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-16
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2045-07-16
AI Technical Summary
When existing technologies are used to construct an apomixis system in rice through gene editing, the fruit set rate is low and the cloning efficiency needs to be improved, making it impossible to effectively fix hybrid vigor.
The rice OsPAIR1, OsREC8, OsOSD1 and OsDMP genes were knocked out using CRISPR/Cas9 technology, combined with Agrobacterium-mediated transformation into hybrid rice, and homozygous mutant plants were screened. Flow cytometry and genome sequencing technologies were used to identify plants with fixed hybrid vigor.
It has achieved an apomixis system with a high fruit set rate, significantly improved agricultural production efficiency and quality, and has broad application prospects.
Smart Images

Figure CN120485274B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the fields of biotechnology and plant breeding, and relates to a method for fixing rice heterosis by utilizing DMP gene. Background Art
[0002] Apomixis, a form of asexual reproduction involving clonal propagation, holds the core value of its ability to stabilize the desirable traits of hybrid crops. Successfully incorporating this characteristic into hybrid crop breeding systems would completely resolve the problem of trait segregation in hybrid offspring, ensuring the stable preservation of valuable hybrid vigor from generation to generation. This would not only revolutionize the hybrid seed production process, significantly improve breeding efficiency, and significantly reduce seed production risks and costs, but would also unprecedentedly broaden the scope of application of hybrid vigor.
[0003] Currently, the construction of an apomixis system mainly relies on two technical paths: (1) Four-gene knockout - using gene editing technology to precisely knock out four key endogenous genes (i.e., MiMe system-related genes plus a haploid-inducing gene) at the same time. The advantage of this strategy is that it only requires gene editing to achieve homozygous mutations of four genes. The operation process is relatively direct and simple, and the performance consistency between strains with different genetic backgrounds is high. (2) Three-gene knockout + ectopic expression - knocking out three endogenous genes related to the MiMe system and simultaneously ectopically expressing key parthenogenesis genes. The challenge of this path is that the expression levels of the ectopically expressed genes may vary significantly between different strains, which in turn leads to instability and fluctuation in the efficiency of the apomixis system.
[0004] A comprehensive comparison of the two construction pathways reveals that directly knocking out four endogenous genes through gene editing to stabilize heterosis has demonstrated significant advantages in practical breeding applications due to its relative ease of operation and greater consistency of results. However, this strategy currently faces challenges such as low seed set and improved cloning efficiency. This highlights the urgency of further exploring new and efficient genetic resources to enhance the practical value of this system.
[0005] In the study of the mechanism of inducing haploid formation, members of the DMP gene family have been confirmed to play a core role in multiple species. Chinese patent CN111996209B discloses that mutations in the AtDMP8 and AtDMP9 genes from Arabidopsis thaliana can produce parthenogenetic haploid induction capabilities. Chinese patent CN111996209A discloses that the SlDMP gene from tomato can be used to regulate the haploid induction capability of plants. Chinese patent CN111763687B shows that in the important crop corn, functional studies on its homologous gene ZmDMP were conducted, and it was also found that this gene has the potential to induce haploids.
[0006] However, in rice, one of the world's most important food crops, no clear research reports or functional validation of DMP homologous genes have been reported, and whether they have the function of inducing haploidy remains unknown. This is because the roles of DMPs in different plants vary. For example, in Arabidopsis, most DMP genes are associated with apoptosis. For example, AtDMP1, AtDMP3, and AtDMP4 primarily regulate plant senescence, AtDMP7 primarily regulates fruit dehiscence, and AtDMP2 regulates leaf abscission (Kasaras A, Kunze R. Expression, localization and phylogeny of a novel family of plant-specific membrane proteins. Plant Biol (Stuttg). 2010 Sep;12 Suppl 1:140-52.). This suggests that DMP proteins are not solely responsible for regulating haploidy induction in plants, and it is clear that there is no unique correspondence between the function of regulating haploidy induction in plants and DMP proteins. Therefore, those skilled in the art cannot directly link OsDMP genes to the function of regulating haploidy induction in plants, and further research is needed.
[0007] At the same time, the amino acid sequence of the primary structure of a protein is the basis of its spatial structure, and the spatial structure of a protein is the basis of its function. Whether proteins with high homology have similar spatial structures and similar functions mainly depends on the differences in amino acid residues that play a key role in maintaining their spatial structure, function, and activity, and whether these differences are sufficient to change their spatial conformation and corresponding biological functions and activities. If some or even one of the key amino acids in the amino acid sequence of a protein changes, it will lead to great changes in the spatial structure and biological activity or function of the protein.A large number of literature reports have shown that a change in a single base in a gene may lead to significant phenotypic changes (JiaoY, Wang Y, Xue D, Wang J, Yan M, Liu G, Dong G, Zeng D, Lu Z, Zhu X, Qian Q,Li J. Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice. Nat Genet. 2010 Jun;42(6):541-4;Peng LM, Chen XP, Sun J, Guo YJ, Li L,Mo L, Xie W, Li YJ, Yang TL, Li CC. Influence of ALDH2 Glu504Lys polymorphismon nitroglycerin response in chronic heart failure and involvement ofCalcitonin Gene Related Peptide (CGRP). Int J Clin Pharmacol Ther. 2012 Oct;50(10):701-11;Kobayashi Y, Kuroda K, Kimura K, Southron-Francis JL, FuruzawaA, Kimura K, Iuchi S, Kobayashi M, Taylor GJ, Koyama H. Amino acidpolymorphisms in strictly conserved domains of a P-type ATPase HMA5 are involved in the mechanism of copper tolerance variation in Arabidopsis. PlantPhysiol. 2008 Oct;148(2):969-80).
[0008] In summary, whether DMP homologs in rice can induce haploids remains to be studied. Addressing this gap in rice DMP gene function, the present invention creatively combines rice DMP genes (OsDMPs) with the MiMe system to construct an apomictic reproduction system. Two specific OsDMP genes were used to construct an apomictic reproduction system that successfully induced and generated clones. This breakthrough directly validates the function of OsDMPs in inducing haploids in rice and lays the foundation for the application of apomictic reproduction systems. Summary of the Invention
[0009] The present invention primarily addresses the problem of overcoming the shortcomings of the prior art by providing a method for fixing rice heterosis using the DMP gene, which can achieve permanent fixation of rice heterosis. To achieve the above object, the present invention comprises the following steps:
[0010] Step 1, constructing an expression cassette for CRISPR / Cas9 knockout of four target sites of rice genes OsPAIR1, OsREC8, OsOSD1, and OsDMP, wherein: the OsDMP gene is OsDMP8 or OsDMP13; the CDS sequences of the five genes OsPAIR1, OsREC8, OsOSD1, OsDMP8, and OsDMP13 are shown in SEQ ID NOs. 1-5; the target sequences of the five genes OsPAIR1, OsREC8, OsOSD1, OsDMP8, and OsDMP13 are shown in SEQ ID NOs. 6-10;
[0011] Step 2: transforming the expression cassette into hybrid rice through Agrobacterium-mediated method to obtain T0 generation plants;
[0012] Step 3: Screen T0 generation plants in which all four genes, OsPAIR1, OsREC8, OsOSD1, and OsDMP, are homozygous knockout, and obtain seeds through self-pollination;
[0013] Step 4: Germinate the seeds obtained by self-pollination in step 3, and use flow cytometry and genome sequencing technology to detect plants with homozygous knockout of the four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP to screen plants with fixed hybrid vigor.
[0014] Furthermore, in step 1, the specific method for obtaining the expression cassette is as follows:
[0015] 1) Design target sequences based on the coding region sequences of four genes: OsPAIR1, OsREC8, OsOSD1, and OsDMP;
[0016] 2) Integrate the target sequence into the SK-gRNA vector to obtain four intermediate vectors SG1, SG2, SG3, and SG4;
[0017] 3) Use the enzyme ligation method to connect the four intermediate vectors SG1, SG2, SG3, and SG4 to the backbone vector pC1300-Cas9 containing the CRISPR / Cas9 expression element to obtain the expression cassette.
[0018] Furthermore, in step 2, a genetic transformation method mediated by Agrobacterium EHA105 strain is used.
[0019] Furthermore, the genetically transformed hybrid rice variety is the indica-japonica hybrid rice variety Chunyou 84.
[0020] Furthermore, in step three, the specific steps for screening T0 generation plants in which all four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP are homozygous knockout are as follows: first, according to the gene sequences of OsPAIR1, OsREC8, OsOSD1 and OsDMP, Hi-TOM detection primers PAIR1-Hi-F / R, REC8-Hi-F / R, OSD1-Hi-F / R, DMP-Hi-F / R are designed; then, the T0 generation transgenic plants are amplified; finally, the mutation types of the four genes in all plants are detected using the Hi-TOM system to screen transgenic plants in which the four genes are homozygous knockout.
[0021] Furthermore, in step 4, flow cytometry and genome sequencing technology are used to detect plants in which the four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP are homozygous knockout to screen plants with fixed heterosis. The specific steps are as follows:
[0022] 1) Flow cytometry was used to measure the ploidy of the progeny of plants homozygous for knockout of all four genes: OsPAIR1, OsREC8, OsOSD1, and OsDMP. Plants with diploid ploidy were selected.
[0023] 2) The diploid plants are tested using genome sequencing technology to select plants with fixed genotypes.
[0024] The protein encoded by the OsDMP8 gene is the protein shown in SEQ ID NO.11;
[0025] The protein encoded by the OsDMP13 gene is the protein shown in SEQ ID NO.12.
[0026] Beneficial effects of the present invention:
[0027] Currently, few apomictic systems have been developed through gene editing, and their seed set rates are generally low. High-seed-setting apomictic systems are typically achieved through ectopic expression of parthenogenetic genes and the combination of MiMe. This invention directly knocks out four endogenous genes (OsPAIR1, OsREC8, OsOSD1, and OsDMP) through gene editing, resulting in an apomictic system with a high seed set rate. This provides a new solution for the construction of apomictic systems, significantly improving the efficiency and quality of agricultural production. It has considerable economic value and broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 is the vector map;
[0029] Figure 2 To detect mutation types in transgenic plants;
[0030] Figure 3 The data are the seed setting rate and cloning efficiency of transgenic plants;
[0031] Figure 4 is the phenotype of transgenic T0 plants;
[0032] Figure 5 screening for diploids for flow cytometry;
[0033] Figure 6 for genome sequencing data;
[0034] Figure 7 This is the phenotype diagram of the cloned plants. DETAILED DESCRIPTION
[0035] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.
[0036] Example 1: Rice apomixis system composed of OsDMP8 and MiMe system
[0037] 1. Expression Cassette Construction
[0038] A vector for knocking out the four endogenous genes OsPAIR1, OsREC8, OsOSD1, and OsDMP8 in rice was constructed. The target sites of the four endogenous genes were ligated to the backbone vector pC1300-Cas9 containing CRISPR / Cas9 expression elements to obtain an expression cassette. The specific construction method is as follows:
[0039] (1) Target sequences were designed based on the coding region sequences of the four genes OsPAIR1, OsREC8, OsOSD1, and OsDM8. The primers are as follows:
[0040] OsPAIR1++:GGCAAAGCAACCCAGTGCACCGC (SEQ ID NO.13);
[0041] OsPAIR1--:AAACGCGGTGCACTGGGTTGCTT (SEQ ID NO.14);
[0042] OsREC8++: GGCACGGAGAGCCTTAGTGCCAT (SEQ ID NO.15);
[0043] OsREC8--:AAACATGGCACTAAGGCTCTCCG (SEQ ID NO.16);
[0044] OsOSD1++: GGCACTGCCGCCGACGAGCAACA (SEQ ID NO.17);
[0045] OsOSD1--:AAACTGTTGCTCGTCGGCGGCAG (SEQ ID NO.18);
[0046] OsDMP8++: GGCAACGGCGCCCAGGGCTAAA (SEQ ID NO. 19);
[0047] OsDMP8--:AAACTTTGAGCCCTGGGGCCCGTT (SEQ ID NO. 20).
[0048] (2) Enzyme digestion of the backbone vector SK-gRNA:
[0049] COMPONENT 50 µl REACTION
[0050] SK-gRNA 2 µg
[0051] 10 x Buffer Aar I 5 µl
[0052] Aar I 1 µl
[0053] 50 x oligonucleotide 1 µl
[0054] Nuclease-free Water to 50 µl
[0055] The enzyme digestion was performed at 37°C for 5 h, and the product was purified using a recovery kit to obtain SK-gRNA.
[0056] (3) Primers anneal to form double strands
[0057] The synthesized primers (g++ and g --) were diluted with water to a concentration of 100 μM. 20 μL each of g++ and --g were mixed together and incubated at 100°C for 5 minutes. After removal, the mixture was allowed to cool naturally at room temperature.
[0058] (4) Integrate the target sequence into the SK-gRNA vector to obtain four intermediate vectors SG1, SG2, SG3 and SG4:
[0059] COMPONENT 10 µl REACTION
[0060] SK-gRNA 30 ng
[0061] 10 x T4 ligase Buffer 1 µl
[0062] T4 ligase 0.5 µl
[0063] 7 µl of primer annealing product
[0064] Nuclease-free Water to 10 µl
[0065] Ligate at 25°C for 1 hr to allow transformation.
[0066] (5) Transformation of recombinant products:
[0067] Thaw chemically competent cells for cloning on ice; add 10µl of recombinant product to 500µl of competent cells, gently tap the tube to mix, and incubate on ice for 30 minutes. Heat shock the tube in a 42°C water bath for 45 seconds, then immediately cool on ice for 2 minutes. Add 900µl of LB medium (without antibiotics) and shake at 37°C (200 rpm) for 1 hour. Centrifuge at 5,000 rpm for 1 minute, resuspend 100µl, and plate onto plates containing the desired resistance. Incubate in an inverted position at 37°C for 12-16 hours. Positive clones identified by colony PCR were sent for sequencing using primer T3: ATTAACCCTCACTAAAGGGA (SEQ ID NO. 21).
[0068] (6) Enzyme digestion of the four intermediate vectors SG1, SG2, SG3 and SG4:
[0069] COMPONENT 50 µl REACTION
[0070] SG1 1 µg
[0071] 10X rCutSmart Buffer 5 µl (1X)
[0072] KpnI-HF 20 units
[0073] BglII 20 units
[0074] Nuclease-free Water to 50 µl
[0075] The enzyme digestion was carried out at 37°C for 5 h, and the product was purified using a recovery kit to obtain SG1.
[0076] COMPONENT 50 µl REACTION
[0077] SG2 1 µg
[0078] 10X rCutSmart Buffer 5 µl (1X)
[0079] BamHI-HF 20 units
[0080] NheI-HF 20 units
[0081] Nuclease-free Water to 50 µl
[0082] The enzyme digestion was carried out at 37°C for 5 h, and the product was purified using a recovery kit to obtain SG2.
[0083] COMPONENT 50 µl REACTION
[0084] SG3 1 µg
[0085] 10X rCutSmart Buffer 5 µl (1X)
[0086] XbaI 20 units
[0087] SalI-HF 20 units
[0088] Nuclease-free Water to 50 µl
[0089] The enzyme digestion was carried out at 37°C for 5 h, and the product was purified using a recovery kit to obtain SG3.
[0090] COMPONENT 50 µl REACTION
[0091] SG4 1 µg
[0092] 10X r3.1 Buffer 5 µl (1X)
[0093] XhoI 20 units
[0094] BglII 20 units
[0095] Nuclease-free Water to 50 µl
[0096] The enzyme digestion was carried out at 37°C for 5 h, and the product was purified using a recovery kit to obtain SG4.
[0097] (7) Enzyme digestion of the vector backbone pC1300-Cas9:
[0098] COMPONENT 50 µl REACTION
[0099] pC1300-Cas9 1 µg
[0100] 10X rCutSmart Buffer 5 µl (1X)
[0101] KpnI-HF 20 units
[0102] BamHI-HF 20 units
[0103] Nuclease-free Water to 50 µl
[0104] The enzyme digestion was performed at 37°C for 5 h, and the product was purified using a recovery kit to obtain pC1300-Cas9.
[0105] (8) Expression cassette construction:
[0106] COMPONENT 10 µl REACTION
[0107] pC1300-Cas9 cut 100 ng
[0108] SG1 cut 8 ng
[0109] SG2 cut 8 ng
[0110] SG3 cut 8 ng
[0111] SG4 cut 8 ng
[0112] 10 x T4 ligase Buffer 1 µl
[0113] T4 ligase 0.5 µl
[0114] Nuclease-free Water to 50 µl
[0115] Ligate at 25°C for 1 hr to allow transformation.
[0116] (9) Transformation of recombinant products:
[0117] Thaw chemically competent cells for cloning on ice; add 10µl of recombinant product to 500µl of competent cells, gently tap the tube to mix, and incubate on ice for 30 minutes. Heat shock the tube in a 42°C water bath for 45 seconds, then immediately cool on ice for 2 minutes. Add 900µl of LB medium (without antibiotics) and shake at 37°C (200 rpm) for 1 hour. Centrifuge at 5,000 rpm for 1 minute, resuspend 100µl, and plate onto a plate containing the desired resistance. Incubate the tube inverted at 37°C for 12-16 hours. Positive clones identified by colony PCR were sent for sequencing using the sequencing primer pC1300-F: acactttatgcttccggctc (SEQ ID NO. 22).
[0118] 2. Genetic Transformation
[0119] The cloned vector was sequenced correctly, and the next step was to transform the indica-japonica hybrid rice variety Chunyou 84 (CY84) using Agrobacterium tumefaciens strain EHA105-mediated genetic transformation to obtain transgenic material. The seeds were dehulled and disinfected with 75% ethanol for 1 minute. The ethanol was then discarded and disinfected with 2% sodium hypochlorite solution for 20 minutes, while being placed on a shaker. The sodium hypochlorite solution was discarded in a clean bench, and the seeds were rinsed 4-5 times with sterile water. The seeds were then placed on sterilized filter paper and dried. The seeds were then plated onto N6 mature embryo callus induction medium and cultured in the dark at 28°C for approximately one month. Embryonic calli in good condition were selected for subculture 2-3 times, and embryonic calli that were 3-5 days old after the second subculture were selected for transformation.
[0120] Embryogenic calli are immersed in activated Agrobacterium tumefaciens EHA105 culture (containing acetosyringone) carrying the target plasmid for 30 minutes. The calli are then rinsed several times with sterile water, dried in a laminar flow hood, and incubated at 19°C for 2-3 days. The calli are then transferred to a selection medium supplemented with a selection marker antibiotic for selection. Each selection process lasts for 2 weeks, and after 2-3 rounds of selection, newly grown calli are obtained. The newly grown calli are then transferred to a predifferentiation medium and cultured for 7 days. Then, they are transferred to a differentiation medium and cultured at 25°C under a light intensity of 16 hours per day for approximately 10 days. Green spots appear, and regenerated plants are obtained. The roots of the differentiated transgenic seedlings are removed and placed on rooting medium for 2-3 weeks. The parafilm is then removed, and the seedlings are hardened with water for 1 week before being transplanted.
[0121] 3. Mutation Detection of Transgenic T0 Plants
[0122] The method for screening T0 generation plants with homozygous mutations in the four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP8 is as follows:
[0123] Hi-TOM detection primers were designed based on the gene sequences of OsPAIR1, OsREC8, OsOSD1, and OsDMP8. The primer sequences are as follows:
[0124] PAIR1-Hi-F: ggagtgagtacggtgtgccttcttgcgcgcgagaagagtctc (SEQ ID NO. 23);
[0125] PAIR1-Hi-R: gagttggatgctgagtggggagatgtagtgcgtgggtcttg (SEQ ID NO. 24);
[0126] REC8-Hi-F: ggagtgagtacggtgtgcttgggttagtgaggagat (SEQ ID NO. 25);
[0127] REC8-Hi-R: gagttggatgctgagtggtgcgatcggaactatggagac (SEQ ID NO. 26);
[0128] OSD1-Hi-F: ggagtgagtacggtgtgctatcaggaggacgacgtcgccg (SEQ ID NO. 27);
[0129] OSD1-Hi-R: gagttggatgctgagtggctcctcctcttgggtgtagc (SEQ ID NO. 28);
[0130] DMP8-Hi-F: GGATGAGTACGGTGTGCGATCCCTGTCAATTCTCTCTA (SEQ ID NO. 29);
[0131] DMP8-Hi-R:GAGTTGGATGCTGAGTGGGGCTTCTTCTTCTTGTCATC (SEQ ID NO. 30).
[0132] The above four pairs of primers were used to perform PCR amplification on T0 generation transgenic plants, and the mutation types of the four genes in all plants were detected using the Hi-TOM system to screen transgenic plants with homozygous mutations in all four genes.
[0133] 4. Plant ploidy and genotype identification
[0134] Flow cytometry and genome sequencing technologies were used to test the offspring of T0 homozygous mutant materials in all four genes to screen plants with fixed heterosis, specifically:
[0135] (1) Flow cytometry was used to identify the ploidy of offspring plants with homozygous mutations in all four genes. The specific experimental procedures were as follows:
[0136] Cut fresh, 10-day-old rice leaves, 4-5 cm long, into a glass dish. Add 1 ml of Plant Lysis Buffer LB01 and mince the tissue quickly with a razor blade. Aspirate the lysate from the dish and filter through a 50 µm nylon mesh into a centrifuge tube. Label the tube cap with the sample. Centrifuge at 1,200 rpm for 5 minutes at 4°C in a benchtop refrigerated centrifuge. Gently remove the tube, slowly aspirate the supernatant, and add 450 µl of LB01, 25 µl of pre-chilled PI, and 25 µl of RNase A. Stain at 4°C in the dark for 10 minutes. Detect on a BD Accuri C6. If the cell is diploid, the peak should be consistent with that of the wild-type cell.
[0137] The specific reagent formula is:
[0138] Lysis buffer LB01: Tris 363.4 mg, Na2EDTA 148.9 mg, Sperminetetrahydrochloride 34.8 mg, KCl 1.193 g, NaCl 233.8 mg, Triton X-100 200 µl. Dose to 200 mL. Adjust the pH to 7.5 with 1 M HCl. Add 220 µl of β-mercaptoethanol in a fume hood. Sterilize by filtration using a 0.22 µm filter in a laminar flow hood, aliquot, and store at -20°C.
[0139] Propidium iodide (PI) stock solution (1 mg / ml): Weigh 50 mg of powder and dissolve it in 50 mL of ddH2O. Sterilize the solution by filtration using a 0.22 μm filter in a clean bench and aliquot the solution. Store at -20°C.
[0140] RNase stock solution (1 mg / ml): Weigh 25 mg of RNase (IIA Sigma) and dissolve in 25 ml of ddH2O. Sterilize by filtration through a 0.22 µm filter in a laminar flow hood and aliquot. Heat at 90°C for 15 min to inactivate the DNase. Store at -20°C.
[0141] (2) Use genome sequencing technology to detect the genotype of diploid plants, specifically:
[0142] For the diploid plants identified above, DNA was extracted and libraries were constructed. Paired-end sequencing was performed using the Illumina Hiseq2500 sequencing platform, with an average sequencing depth of 10-15x for each sample. The raw data was first filtered using NGSQCtoolkit v2.3.3. The filtered data was then aligned to the reference genome to obtain single-nucleotide polymorphism (SNP) data. Finally, the SNP data was aligned to the wild-type Chunyou 84 genome to determine the genotype of the diploid plants. If the diploid plant exhibits fixed heterosis, its genome would theoretically be a heterozygous genotype consistent with Chunyou 84.
[0143] 5. Test results
[0144] A total of 7 positive strains were obtained through genetic transformation. The mutation types of four genes, OsPAIR1, OsREC8, OsOSD1 and OsDMP8, were detected using Hi-TOM detection technology. The results showed that all four genes in the MD8-6 strain had homozygous mutations ( Figure 2 The growth and development of this strain is consistent with the wild type, but the fruiting rate is significantly lower than that of the wild type ( Figure 3 , Figure 4After the seeds matured, the seeds of this strain were harvested and germinated for diploid identification. Flow cytometry was used to identify the ploidy, and one diploid was found among the 70 offspring, with a diploid ratio of 1.43% ( Figure 3 , Figure 5 Subsequently, the diploid plant genotype was tested using genome sequencing technology, and the results showed that the diploid genotype was consistent with the Chunyou 84 genotype ( Figure 6 ), which is an apomixis clone, and its growth and development are consistent with the wild type ( Figure 7 ).
[0145] Example 2: Rice apomixis system composed of OsDMP13 and MiMe system
[0146] 1. Expression Cassette Construction
[0147] The construction method is the same as in Example 1, and the primers for the OsDMP13 target sequence are as follows:
[0148] OsDMP13++: GGCAGGCGATGTCCAGATACCGAT (SEQ ID NO. 31);
[0149] OsDMP13--:AAACATCGGTATCTGGACATCGCC (SEQ ID NO. 32).
[0150] 2. Genetic Transformation
[0151] The transformation method is the same as in Example 1.
[0152] 3. Mutation Detection of Transgenic T0 Plants
[0153] The detection method is the same as in Example 1. The Hi-TOM detection primer sequences for OsDMP13 are as follows:
[0154] DMP13-Hi-F:GGAGTGAGTACGGTGTGCCAAGGAAGACAAAGCATCGG (SEQ ID NO. 33);
[0155] DMP13-Hi-R:GAGTTGGATGCTGAGTGGGCCAAGTTCGCCAACACC (SEQ ID NO. 34).
[0156] 4. Plant ploidy and genotype identification
[0157] The detection method is the same as that in Example 1.
[0158] 5. Test results:
[0159] A total of eight positive lines were obtained through genetic transformation. Hi-TOM analysis was used to identify mutations in four genes, OsPAIR1, OsREC8, OsOSD1, and OsDMP13. Results showed that line MD13-5 harbored homozygous mutations in all four genes. The growth and development of this line were consistent with those of the wild type, with a significantly lower seed set rate (61.04%). Seeds from this line were harvested upon seed maturity and germinated for diploid identification. Flow cytometry analysis revealed one diploid plant among 67 progeny, representing a diploid percentage of 1.49%. Genome sequencing of the diploid plants revealed a genotype consistent with that of Chunyou 84, indicating an apomictic clone. Growth and development of the plants were consistent with those of the wild type.
Claims
1. A method for fixing rice heterosis using the DMP gene, characterized in that: The following steps are involved: Step 1, constructing an expression cassette for CRISPR / Cas9 knockout of four target sites of rice genes OsPAIR1, OsREC8, OsOSD1 and OsDMP, wherein: the OsDMP gene is OsDMP13; the CDS sequences of the four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP13 are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.5; the target sequences of the four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP13 are shown in SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.10; Step 2: transforming the expression cassette into hybrid rice through Agrobacterium-mediated method to obtain T0 generation plants; Step 3: Screen T0 generation plants in which all four genes, OsPAIR1, OsREC8, OsOSD1, and OsDMP, are homozygous knockout, and obtain seeds through self-pollination; Step 4: Germinate the seeds obtained by self-pollination in step 3, and use flow cytometry and genome sequencing technology to detect plants with homozygous knockout of the four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP to screen plants with fixed hybrid vigor.
2. The method according to claim 1, characterized in that In step 1, the specific method for obtaining the expression cassette is as follows: 1) Design target sequences based on the coding region sequences of four genes: OsPAIR1, OsREC8, OsOSD1, and OsDMP; 2) Integrate the target sequence into the SK-gRNA vector to obtain four intermediate vectors SG1, SG2, SG3, and SG4; 3) Use the enzyme ligation method to connect the four intermediate vectors SG1, SG2, SG3, and SG4 to the backbone vector pC1300-Cas9 containing the CRISPR / Cas9 expression element to obtain the expression cassette.
3. The method according to claim 2, characterized in that In step 2, the Agrobacterium-mediated method utilizes a genetic transformation method mediated by Agrobacterium EHA105 strain.
4. The method according to claim 3, characterized in that The genetically transformed hybrid rice variety is the indica-japonica hybrid rice variety Chunyou 84.
5. The method according to claim 4, characterized in that In step 3, the specific steps for screening T0 generation plants in which the four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP were homozygous knockout were as follows: first, based on the gene sequences of OsPAIR1, OsREC8, OsOSD1 and OsDMP, Hi-TOM detection primers PAIR1-Hi-F, PAIR1-Hi-R, REC8-Hi-F, REC8-Hi-R, OSD1-Hi-F, OSD1-Hi-R, DMP13-H were designed. i-F, DMP13-Hi-R, and then the T0 generation transgenic plants were amplified. Finally, the mutation types of the four genes in all plants were detected using the Hi-TOM system to screen transgenic plants with homozygous knockout of the four genes; the nucleotide sequences of PAIR1-Hi-F, PAIR1-Hi-R, REC8-Hi-F, REC8-Hi-R, OSD1-Hi-F, OSD1-Hi-R, DMP13-Hi-F and DMP13-Hi-R are shown in SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.33 and SEQ ID NO.
34.
6. The method according to claim 5, characterized in that In step 4, flow cytometry and genome sequencing are used to detect plants in which the four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP are homozygous knocked out, and plants with fixed heterosis are screened. The specific steps are as follows: 1) Flow cytometry was used to measure the ploidy of the progeny of plants homozygous for knockout of all four genes: OsPAIR1, OsREC8, OsOSD1, and OsDMP. Plants with diploid ploidy were selected. 2) The diploid plants are tested using genome sequencing technology to select plants with fixed genotypes.
Citation Information
Patent Citations
A method for rapidly breeding maize haploid inducible lines based on gene editing technology
CN111763687B
Parthenogenetic haploid induced gene DMP and application thereof
CN111996209A
Parthenogenesis haploid inducible gene DMP and its application
CN111996209B
Method for fixing rice heterosis by using gene editing technology
CN118360330A
Method for inducing apomixis of plants and application
CN119020395A
Cited By
A method for obtaining a rice apomixis system by using a DMP gene editing
CN122466003A
A method for obtaining a rice apomixis system by using a DMP gene editing
CN122466003B