Recombinant bovine rotavirus strain as well as preparation method and application thereof

Abstract

The invention discloses a recombinant bovine rotavirus strain as well as a preparation method and application thereof, and belongs to the technical field of bovine rotavirus vaccines. The invention aims to provide a multi-combined vaccine which takes bovine rotavirus as a carrier and can prevent calf and piglet diarrhea. The invention provides an attenuated bovine rotavirus rescue plasmid combination, which is characterized in that a pT7 vector is used as a starting vector, and the starting vector is respectively connected with a pT7 / VP1BLR plasmid, a pT7 / VP2BLR plasmid, a pT7 / VP3BLR plasmid, a pT7 / VP4BLR plasmid, a pT7 / VP6BLR plasmid, a pT7 / VP7BLR plasmid, a pT7 / NSP1BLR plasmid, a pT7 / NSP2BLR plasmid, a pT7 / NSP3BLR plasmid, a pT7 / NSP4BLR plasmid and a pT7 / NSP5BLR plasmid which are obtained by sequences as shown in SEQ ID NO.2-12. A research and development thought is provided for constructing a multi-combined vaccine.

Description

Technical Field

[0001] The present invention belongs to the technical field of bovine rotavirus vaccines, and in particular relates to a recombinant bovine rotavirus strain and a preparation method and application thereof. Background Art

[0002] Neonatal diarrhea is a leading cause of calf mortality, accounting for over 50% of all calf deaths. This can lead to decreased growth performance in calves that survive diarrhea and reduced milk production in adult dairy cows, resulting in significant economic losses and potential threats to the dairy industry. Neonatal diarrhea can be caused by a variety of pathogens, including viruses, bacteria, and protozoa, and multiple pathogens can be involved simultaneously. Among these pathogens, bovine rotavirus (BRV), bovine coronavirus (BCoV), and Clostridium perfringens (Cp) are the most common.

[0003] Rotavirus (RV), a member of the genus Rotavirus in the family Reoviridae, is a major pathogen causing acute gastrointestinal infections in infants and a variety of young animals. BCoV is an enveloped, single-stranded, positive-sense RNA virus belonging to the order Nidovirales, family Coronaviridae, subfamily Orthocoronavirinae, and genus Betacoronavirus. It is a pathogen that causes diarrhea in newborn calves, winter dysentery in adult cattle, and respiratory diseases in dairy cows and calves. Clostridium perfringens is a common environmental bacterium. When stressed, the body's immune system weakens, allowing the bacterium to multiply and produce toxins (primarily alpha-toxins), leading to diarrhea in calves and sudden death in adult cattle. Porcine epidemic diarrhea virus (PEDV) is a major cause of diarrhea in piglets. Therefore, developing a combined vaccine is a critical technical challenge for the prevention and control of diarrhea in newborn calves and piglets. Summary of the Invention

[0004] The purpose of the present invention is to provide a multi-component vaccine which uses bovine rotavirus as a carrier and can prevent diarrhea in calves and piglets.

[0005] The present invention provides an attenuated bovine rotavirus rescue plasmid combination. The bovine rotavirus rescue plasmids are obtained by using a pT7 vector as a starting vector and respectively connecting the sequences shown in SEQ ID NOs. 2-12 to obtain 11 plasmids, namely pT7 / VP1BLR, pT7 / VP2BLR, pT7 / VP3BLR, pT7 / VP4BLR, pT7 / VP6BLR, pT7 / VP7BLR, pT7 / NSP1BLR, pT7 / NSP2BLR, pT7 / NSP3BLR, pT7 / NSP4BLR and pT7 / NSP5BLR.

[0006] The present invention provides an attenuated bovine rotavirus rescue system, comprising an attenuated bovine rotavirus strain rescued by utilizing the above-mentioned rescue plasmid combination.

[0007] It is further defined that the attenuated bovine rotavirus rescue system is to transfect the above rescue plasmid combination into BHK-21-T7 cells, harvest the culture and propagate the virus on Marc-145 cells to rescue the attenuated bovine rotavirus strain.

[0008] The present invention provides an application of the rescue plasmid or the rescue system in preparing an attenuated bovine rotavirus vaccine or medicine.

[0009] The present invention provides a recombinant bovine rotavirus strain, which is obtained by connecting the ends of the coding gene of the sequence shown in SEQ ID NO.10 in the pT7 / NSP3BLR plasmid in the above-mentioned attenuated bovine rotavirus strain to the sequences shown in SEQ ID NO.13, SEQ ID NO.14, and then to the sequences shown in SEQ ID NO.15, SEQ ID NO.16 or SEQ ID NO.17 respectively.

[0010] The present invention provides a use of the above-mentioned recombinant bovine rotavirus strain in the preparation of a bovine rotavirus and bovine coronavirus combined vaccine or medicine.

[0011] The present invention provides a recombinant bovine rotavirus strain, which is obtained by connecting the ends of the coding gene of the sequence shown in SEQ ID NO.10 in the pT7 / NSP3BLR plasmid in the above-mentioned attenuated bovine rotavirus strain to SEQ ID NO.13, SEQ ID NO.14, and then to the sequence shown in SEQ ID NO.18.

[0012] The present invention provides a use of the above-mentioned recombinant bovine rotavirus strain in the preparation of a bovine rotavirus and porcine epidemic diarrhea virus combined vaccine or medicine.

[0013] The present invention provides a recombinant bovine rotavirus strain, which is obtained by connecting the ends of the coding gene of the sequence shown in SEQ ID NO.10 in the pT7 / NSP3BLR plasmid in the above-mentioned attenuated bovine rotavirus strain to SEQ ID NO.13, SEQ ID NO.14, and then to the sequence shown in SEQ ID NO.19.

[0014] The present invention provides an application of the above-mentioned recombinant bovine rotavirus strain in the preparation of a bovine rotavirus and Clostridium perfringens combined vaccine or medicine.

[0015] Beneficial effects: After rescuing rotavirus, an attenuated rescued rotavirus is obtained. Based on the rescued attenuated rotavirus, modification is carried out to obtain a recombinant virus strain by fusing the protein of bovine coronavirus, porcine epidemic diarrhea virus or Clostridium perfringens at the end of the NSP3 protein. One recombinant virus strain can be used as a two-in-one vaccine to prevent two diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Identification diagram for rescued virus rBLR; Figure 2 This is the result of the rBLR calf pathogenicity test; Figure 3 This is a diagram showing the results of a flexible linker screening experiment that can increase the efficiency of exogenous protein cleavage; Figure 4 The results of the strategy for designing BCoV protective antigen and constructing recombinant plasmid; Figure 5 This is a diagram showing the identification results of recombinant rotavirus rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD; Figure 6 Figure 1 is a graph showing the in vivo characteristics of rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD; Figure 7 This is a graph showing the immunogenicity evaluation results of rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD; Figure 8 Figure 1 is the result of IgG detection against BRV and BCoV in serum; Figure 9 The diagram shows the construction strategy of BLR as a broad-spectrum vector for expressing foreign proteins; Figure 10 This is a diagram showing the identification results of recombinant viruses using BLR as a broad-spectrum vector to express foreign proteins; Figure 11 Figure 1 is the in vivo characteristic results of rBLR-PEDV-CTD and rBLR-Cp-α; Figure 12 This is the result of immunogenicity evaluation of rBLR-PEDV-CTD and rBLR-Cp-α. DETAILED DESCRIPTION

[0017] The original vectors of the 11 gene segments are the same, i.e., the sequence of pT7 is: (SEQ ID NO. 1); The following sequences of different gene segments were cloned into the pT7 vector to construct 11 recombinant plasmids.

[0018] The sequences of the 11 gene segments are: VP1 (SEQ ID NO.2); VP2 (SEQ ID NO.3); VP3 (SEQ ID NO.4); VP4 (SEQ ID NO.5); VP6 (SEQ ID NO.6); VP7 (SEQ ID NO.7); NSP1 (SEQ ID NO.8): NSP2 (SEQ ID NO.9); NSP3 (SEQ ID NO.10): NSP4 (SEQ ID NO.11): NSP5 (SEQ ID NO.12) Flexible Linker (SEQ ID NO. 13); AGAAAGAGAAGGGGAAGCGGC; P2A (SEQ ID NO. 14): GCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGACGTGGAAGAAAACCCCGGTCCT; BCoV S1 CTD (SEQ ID NO.15); BCoV S1 NTD (SEQ ID NO.16); BCoV S1 RBD (SEQ ID NO.17); PEDV S1 CTD (SEQ ID NO.18); Cp-α (SEQ ID NO.19).

[0019] Example 1. Screening of highly efficient cleavage 2A peptides for efficient expression of foreign proteins in recombinant bovine rotavirus 1. Bovine Rotavirus Rescue Plasmid The original vector was pT7, purchased from Addgene (https: / / www.addgene.org / ), and its sequence is shown in SEQ ID NO.1. pT7 / VP1BLR vector: VP1 (SEQ ID NO.2) was inserted into the original vector pT7; pT7 / VP2BLR vector: VP2 (SEQ ID NO.3) was inserted into the original vector pT7; pT7 / VP3BLR vector: VP3 (SEQ ID NO.4) was inserted into the original vector pT7; pT7 / VP4BLR vector: VP4 (SEQ ID NO.5) was inserted into the original vector pT7; pT7 / VP6BLR vector: VP6 (SEQ ID NO.6) was inserted into the original vector pT7; pT7 / VP7BLR vector: VP7 (SEQ ID NO.7) was inserted into the original vector pT7; pT7 / NSP1BLR vector: NSP1 (SEQ ID NO.8) was inserted into the original vector pT7; pT7 / NSP2BLR vector: NSP2 (SEQ ID NO.9) was inserted into the original vector pT7 NO.9); pT7 / NSP3BLR vector: NSP3 (SEQ ID NO.10) inserted into the original vector pT7; pT7 / NSP4BLR vector: NSP4 (SEQ ID NO.11) inserted into the original vector pT7; pT7 / NSP5BLR vector: NSP5 (SEQ ID NO.12) inserted into the original vector pT7. The BLR strain is a further attenuated strain of the attenuated vaccine strain LLR (Patent: ZL200910161345.4) after 10 consecutive passages of adaptation in suspension MDBK cells and is designated BLR. The nucleotide sequences of SEQ ID NOs. 2-10 are derived from the BLR strain.

[0020] 2. Bovine Rotavirus Rescue System The 11 plasmids obtained in Example 1, pT7 / VP1BLR, pT7 / VP2BLR, pT7 / VP3BLR, pT7 / VP4BLR, pT7 / VP6BLR, pT7 / VP7BLR, pT7 / NSP1BLR, pT7 / NSP2BLR, pT7 / NSP3BLR, pT7 / NSP4BLR, and pT7 / NSP5BLR, were mixed. Each of the 11 plasmids, 0.6 μg, was co-transfected into BHK-21-T7 cells using Lipo3000 transfection reagent. The transfected cells were cultured for 2 days, and then Marc-145 cells were added to the cell wells and co-cultured for 2 days. The culture was harvested and virus was propagated on Marc-145 cells to obtain the rescued virus rBLR.

[0021] The results showed that the transfection complex could produce typical rotavirus CPE ( Figure 1 A), IFA showed that infected cells can effectively bind to rotavirus-specific antibodies ( Figure 1 C), the RNA electrophoresis band of the rescued virus rBLR is consistent with that of the parental BLR ( Figure 1 E), molecular tagging showed that the A base at position 334 of the rescued virus rBLR NSP3 gene mutated to G ( Figure 1 F). These results indicate that the obtained virus rBLR was rescued rather than contaminated by wild-type virus.

[0022] The rescued rBLR strain was orally inoculated into newborn calves that did not eat colostrum for pathogenicity study. The results showed that rBLR-inoculated cattle did not cause clinical diarrhea ( Figure 2 Aa) The RT-PCR method could not detect the virus in the feces and intestinal tissues of rBLR-inoculated cattle ( Figure 2 Ba), while the control virulent strain can cause clinical diarrhea after inoculation of cattle ( Figure 1 Ab), and the virus can be detected in feces and intestinal tissues ( Figure 2 Bb). Figure 1 Prove that rBLR rescue is successful, Figure 2 The results showed that rBLR was not pathogenic to calves, indicating that rBLR was an attenuated strain.

[0023] 3. After the coding genes of rotavirus VP1-VP4, VP6, VP7, NSP1, NSP2, NSP4, and NSP5 proteins were recombined, the virus could not be rescued or the rescued virus was unstable. The construction of the recombinant plasmids in this embodiment all inserted foreign genes into the NSP3 protein coding gene. Its innovation lies in adding the PKRRGSG flexible linker and P2A coding sequence between the foreign protein coding sequence and the NSP3 protein coding sequence. The addition of the flexible linker sequence significantly improved the cleavage efficiency of P2A ( Figure 3 ), thereby improving the efficiency of virus rescue and enhancing the stability of the virus, such as Figure 5 E and Figure 10 As shown in Eb, the rescued virus in this example was passaged for 10 consecutive generations, and the recombinant NSP3 gene remained stably present (after the exogenous gene was inserted, the NSP3 gene migrated from the original segment 8 to segments 4 and 5, and 5 and 6). Previous studies have shown that recombinant viruses lose the exogenous gene after 10 generations, a critical drawback for vaccine research. This example addresses this issue by introducing a flexible linker and P2A sequence.

[0024] In order to screen out the 2A self-cleaving peptide with the highest cleavage efficiency and the shortest amino acid length, the amino acid sequences of four 2A peptides with self-cleavage function (2A peptide P2A from porcine teschovirus type 1, 2A peptide T2A from schizontopharyngeal worm virus, 2A peptide E2A from equine rhinitis virus, and 2A peptide F2A from foot-and-mouth disease virus) were first compared and analyzed. A highly conserved region was identified at the C-terminus of the four selected 2A peptides, which is involved in the self-cleavage process ( Figure 3 A). Subsequently, the genes encoding the BLRNSP3 protein and the model protein eGFP were amplified, and the amplified products were sequentially inserted into the eukaryotic expression vector pCAGGS using the Takara In-Fusion Cloning Kit. At the same time, four different 2A sequences were fused to the C-terminus of the BLR NSP3 protein, so that the BLR NSP3 ORF and eGFP were connected through different 2A peptides, resulting in the recombinant plasmid pCAGGS-BLR NSP3-X2A-eGFP with four different 2A peptides. In each recombinant plasmid, the rotavirus NSP3 gene and the eGFP protein gene were connected in an open reading frame through 2A peptides, with X representing P, T, E, and F. In addition, to promote the cleavage of the exogenous protein fused to the NSP3 carboxyl terminus, a flexible linker encoding the nucleotide sequence "Arginine-Lysine-Arginine-Arginine-Glycine-Serine-Glycine (RKRRGSG)" was added to the 5' end of the 2A sequence ( Figure 3 A) The 2A peptide with a flexible linker is designated GX2A. For example, F2A is a 2A peptide from foot-and-mouth disease virus, and GF2A is F2A with a flexible linker. These recombinant plasmids were then transfected into HEK 293T cells using PEI transfection reagent. Cell samples were collected 48 hours after transfection, and Western blotting was used to compare the expression and cleavage efficiency of the exogenous protein eGFP mediated by F2A, P2A, E2A, and T2A.

[0025] When the four types of 2A work, they will cut at the 2A recognition site (between glycine G and proline P) to produce eGFP protein, while incomplete cutting will produce NSP3-eGFP fusion protein. The higher the ratio of the amount of expressed eGFP protein to the total amount of expressed protein (eGFP protein + NSP3-eGFP fusion protein), the higher the cutting efficiency. WB analysis showed that when the four types of 2A work, their cutting efficiency and eGFP expression level are different, and the cutting function of natural 2A is inefficient. It cannot effectively cut the BLR NSP3-eGFP fusion protein, forming a large amount of fusion protein, namely NSP3-eGFP, and no independently expressed eGFP protein is formed ( Figure 3 B). After adding the flexible linker, the cleavage efficiency of P2A was significantly improved, forming a single expressed eGFP protein ( Figure 3 Ca). A thin-layer scanning imaging system was used to analyze the grayscale values of the WB images. The grayscale value of each band was used to calculate the cleavage efficiency using the formula (cleavage efficiency = grayscale value of the eGFP protein band / (grayscale value of the NSP3-eGFP fusion protein band + grayscale value of the eGFP protein band) * 100%). The ratio of the eGFP protein formed after cleavage to the total protein was compared. The results showed that GP2A had the highest ratio, followed by GT2A, GE2A, and GF2A, which were 97%, 62%, 45%, and 34%, respectively. Figure 3 Cb). GP2A had the highest cleavage efficiency, followed by GT2A, GE2A, and GF2A. These results suggest that RKRRGSG-P2A, with the highest cleavage efficiency and the shortest length, is an ideal candidate for efficient cleavage of 2A peptides for efficient expression of exogenous proteins in recombinant bovine rotavirus.

[0026] Example 2. Recombinant rotavirus containing BCoV antigen 1. Primer design and synthesis: Recombinant plasmids expressing the BCoV protective antigenic proteins S1 NTD, CTD, and RBD were constructed using the rotavirus BLR strain as a backbone vector. These plasmids were designed based on the exact sequences of the S1 NTD, S1 CTD, and S1 RBD genes of the BCoV strain previously isolated in our laboratory. Primers used were synthesized by Ruibo Xingke Biotechnology Co., Ltd. (primer sequences are shown in Table 1).

[0027] 2. Construction of recombinant plasmid: Construction of the pT7 / NSP3-2A-BCoV CTD vector: The flexible linker coding sequence (SEQ ID NO. 13), P2A coding sequence (SEQ ID NO. 14), and CTD coding sequence (SEQ ID NO. 15) were ligated to the ends of the NSP3 coding sequence in the pT7 / NSP3BLR vector. BCoV nucleic acid was extracted according to the instructions of the viral RNA extraction kit. BCoV RNA was reverse transcribed into cDNA using a reverse transcription kit. The synthesized cDNA was used as a template and primers designed and synthesized in step 1 were used to amplify the BCoVS1-CTD gene segment and the vector fragment pT7-BLR-NSP3. To achieve "auto-cleavage" expression of NSP3 and exogenous proteins and improve auto-cleavage efficiency, the flexible linker and P2A coding sequences were introduced to the ends of the NSP3 protein coding sequence in the pT7-BLR-NSP3 vector, fusion of the flexible linker, P2A, and CTD to the C-terminus of the NSP3 protein. The amplified BCoV S1-CTD gene segment and the vector fragment pT7-BLR-NSP3 were homologously recombined using the Takara In-Fusion Cloning Kit to obtain the pT7 / NSP3-2A-BCoV CTD reverse genetic recombination plasmid for the rescue of recombinant rotavirus expressing BCoV CTD ( Figure 4 ).

[0028] Construction of the pT7 / NSP3-2A-BCoV NTD vector: The flexible linker coding sequence (SEQ ID NO. 13), P2A coding sequence (SEQ ID NO. 14), and NTD coding sequence (SEQ ID NO. 16) were ligated to the ends of the NSP3 coding sequence in the pT7 / NSP3BLR vector. BCoV nucleic acid was extracted according to the instructions of the viral RNA extraction kit. BCoV RNA was reverse transcribed into cDNA using a reverse transcription kit. The synthesized cDNA was used as a template and primers designed and synthesized in step 1 were used to amplify the BCoVS1-NTD gene segment and the vector fragment pT7-BLR-NSP3. To achieve "auto-cleavage" expression of NSP3 and exogenous proteins and improve auto-cleavage efficiency, the flexible linker and P2A coding sequences were introduced to the ends of the NSP3 protein coding sequence in the pT7-BLR-NSP3 vector, fusion of the flexible linker, P2A, and NTD to the C-terminus of the NSP3 protein. The Takara In-Fusion cloning kit was used to homologously recombine the amplified BCoV S1-NTD gene segment and the vector fragment pT7-BLR-NSP3 to obtain the pT7 / NSP3-2A-BCoV NTD reverse genetic recombination plasmid for recombinant rotavirus rescue expressing BCoV NTD ( Figure 4 ).

[0029] Construction of the pT7 / NSP3-2A-BCoV RBD vector: The flexible linker coding sequence (SEQ ID NO. 13), P2A coding sequence (SEQ ID NO. 14), and RBD coding sequence (SEQ ID NO. 17) were ligated to the ends of the NSP3 coding sequence in the pT7 / NSP3BLR vector. BCoV nucleic acid was extracted according to the instructions of the viral RNA extraction kit. BCoV RNA was reverse transcribed into cDNA using a reverse transcription kit. The synthesized cDNA was used as a template and primers designed and synthesized in step 1 were used to amplify the BCoVS1-RBD gene segment and the vector pT7-BLR-NSP3. To achieve "auto-cleavage" expression of NSP3 and exogenous proteins and improve auto-cleavage efficiency, the flexible linker and P2A coding sequences were introduced to the ends of the NSP3 protein coding sequence in the pT7-BLR-NSP3 vector, fusion of the flexible linker, P2A, and RBD to the C-terminus of the NSP3 protein. The amplified BCoV S1-RBD gene segment and the vector fragment pT7-BLR-NSP3 were homologously recombined using the Takara In-Fusion Cloning Kit to obtain the pT7 / NSP3-2A-BCoV RBD reverse genetic recombination plasmid for recombinant rotavirus rescue expressing BCoV RBD ( Figure 4 ).

[0030] The results showed that specific PCR amplification of the insert fragments of the recombinant plasmids pT7 / NSP3-2A-BCoV-CTD, pT7 / NSP3-2A-BCoV-NTD, and pT7 / NSP3-2A-BCoV-RBD were performed, and single bands of approximately 645 bp (BCoV S1CTD), 849 bp (BCoV S1 NTD), and 938 bp (BCoV S1 RBD) were amplified, respectively, which were consistent with the expected target bands. The recombinant plasmids were named pT7 / NSP3-2A-BCoV-CTD, pT7 / NSP3-2A-BCoV-NTD, and pT7 / NSP3-2A-BCoV-RBD, respectively. Sequencing of each recombinant plasmid confirmed that all plasmids were successfully constructed.

[0031] 3. Rescue of recombinant rotavirus expressing BCoV protective antigen protein CTD: Mix 11 plasmids, including pT7 / VP1BLR, pT7 / VP2BLR, pT7 / VP3BLR, pT7 / VP4BLR, pT7 / VP6BLR, pT7 / VP7BLR, pT7 / NSP1BLR, pT7 / NSP2BLR, pT7 / NSP3-2A-BCoV-CTD, pT7 / NSP4BLR and pT7 / NSP5BLR. Eleven plasmids, 0.6 μg each, were co-transfected into BHK-21-T7 cells using Lipo3000 transfection reagent. The transfected cells were cultured for 2 days, and then Marc-145 cells were added to the cell wells and co-cultured for 2 days. The culture was harvested and the virus was proliferated and rescued on Marc-145 cells to obtain recombinant rotavirus (rBLR-BCoV-CTD) that expresses the BCoV protective antigen protein CTD.

[0032] 4. Rescue of recombinant rotavirus expressing BCoV protective antigen protein NTD: Mix 11 plasmids, including pT7 / VP1BLR, pT7 / VP2BLR, pT7 / VP3BLR, pT7 / VP4BLR, pT7 / VP6BLR, pT7 / VP7BLR, pT7 / NSP1BLR, pT7 / NSP2BLR, pT7 / NSP3-2A-BCoV-NTD, pT7 / NSP4BLR and pT7 / NSP5BLR. Eleven plasmids, 0.6 μg each, were co-transfected into BHK-21-T7 cells using Lipo3000 transfection reagent. The transfected cells were cultured for 2 days, and then Marc-145 cells were added to the cell wells and co-cultured for 2 days. The culture was harvested and the virus was propagated on Marc-145 cells to obtain recombinant rotavirus (rBLR-BCoV-NTD) that can rescue the expression of BCoV protective antigen protein NTD.

[0033] 5. Rescue of recombinant rotavirus expressing BCoV protective antigen protein RBD: Mix 11 plasmids, including pT7 / VP1BLR, pT7 / VP2BLR, pT7 / VP3BLR, pT7 / VP4BLR, pT7 / VP6BLR, pT7 / VP7BLR, pT7 / NSP1BLR, pT7 / NSP2BLR, pT7 / NSP3-2A-BCoV-RBD, pT7 / NSP4BLR and pT7 / NSP5BLR. Eleven plasmids, 0.6 μg each, were co-transfected into BHK-21-T7 cells using Lipo3000 transfection reagent. The transfected cells were cultured for 2 days, and then Marc-145 cells were added to the cell wells and co-cultured for 2 days. The culture was harvested and the virus was propagated on Marc-145 cells to obtain recombinant rotavirus (rBLR-BCoV-CTD) that can rescue the expression of BCoV protective antigen protein RBD.

[0034] 6. Identification of Recombinant Rotaviruses Expressing BCoV Protective Antigen Proteins After amplification for one or two generations, the rescued recombinant virus, rBLR-BCoV-NTD / CTD / RBD, was biologically characterized by PCR, indirect immunofluorescence, Western blotting, and RNA electrophoresis. The genetic stability and viral growth characteristics of the recombinant rotavirus were also determined, thereby obtaining recombinant rotavirus expressing BCoV protective antigens. For PCR identification, recombinant rotavirus genomic RNA was extracted using a nucleic acid extraction kit and reverse transcribed into cDNA. Using the synthesized cDNA as a template, the recombinant rotavirus was identified and sequenced using primers specific for BCoV S1-NTD, S1-CTD, and BLR NSP3 (Table 1). For recombinant rotavirus RNA electrophoresis analysis, recombinant rotavirus was mixed with RNA extraction buffer in a 1:1 ratio, and phenol-chloroform-isoamyl alcohol was added and mixed thoroughly. The mixture was allowed to stand at room temperature for 10 minutes, centrifuged at 12,000 rpm at 4°C for 10 minutes, and 30 μL of the dark blue supernatant was collected for RNA-PAGE. Electrophoresis was performed on a 10% polyacrylamide gel at room temperature for 1 hour, then transferred to a 4°C refrigerator for electrophoresis at 10 mA for 16 hours. After the electrophoresis, the gel was fixed with the fixative for 30 minutes, rinsed three times with distilled water, and then stained with silver nitrate solution for 30 minutes. The gel was rinsed three times with distilled water, and then stained with a color developing solution for about 10 minutes until the bands were clear, thereby determining the RNA migration spectrum. For indirect immunofluorescence analysis, Marc-145 cells were cultured in 12-well dishes and infected with recombinant rotavirus at an MOI of 1. 9 hours after infection, cells were fixed with ice-cold methanol for 30 minutes, incubated in 5% BSA for 30 minutes at room temperature, washed three times with PBST, and incubated with rabbit anti-BLR polyclonal antibody and mouse anti-BCoV polyclonal antibody for 1 hour at room temperature. After washing three times with PBST, Alexa 488 anti-mouse IgG (green) and Alexa 594 anti-rabbit IgG (red) were added for 30 minutes at room temperature. After washing three times with PBST, DAPI was added for 15 minutes at room temperature and analyzed using an inverted fluorescence microscope. For Western blotting analysis, Marc-145 cells were cultured in 12-well dishes and infected with recombinant rotavirus at an MOI of 1. 9 hours after infection, cells were harvested and lysed with protein lysis buffer for 30 minutes. Proteins were separated by electrophoresis on a 10% polyacrylamide (SDS) gel and transferred to a nitrocellulose membrane. The cells were blocked with 5% skim milk for 1 h and incubated with rabbit anti-BLR polyclonal antibody, mouse anti-BCoV polyclonal antibody or rabbit monoclonal β-actin antibody at room temperature for 1 h. The cells were washed three times with PBST and incubated with HRP-labeled corresponding secondary antibody at room temperature for 1 h. The cells were washed three times with PBST and developed with ECL. The expression of BCoV protein in the recombinant rotavirus was detected using the EBLot imaging system.For genetic stability analysis, recombinant rotavirus was serially passaged on Marc-145 cell monolayers. When cells showed obvious CPE, cell samples were collected and frozen and thawed three times. Lysates were clarified by low-speed centrifugation, and their genetic stability was analyzed by RNA electrophoresis. For growth analysis, recombinant rotavirus was infected with Marc-145 cell monolayers at an MOI of 0.01. After adsorption at 37°C for 1 h, cells were washed twice with PBS and cultured in serum-free medium containing trypsin at a final concentration of 0.5 μg / mL. Cell samples were collected 0, 6, 12, 24, and 48 h after infection, frozen and thawed three times, and the TCID values were calculated. 50 The determination method detects the virus titer at each time point and calculates the TCID 50 The values of are plotted as a line graph to draw the multi-step growth curve of the recombinant rotavirus.

[0035] Results showed that after transfection with contemporary cell cultures and two freeze-thaw cycles, Marc-145 cells were inoculated and cultured for 24-48 hours before developing rotavirus-specific CPE, characterized by cell shrinkage and aggregation, blurred fine boundaries, cell surface disintegration, enlarged interstitial spaces, and shedding and death. The rescued viruses were named rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD, respectively. The complete NSP3 gene of the parental BLR virus (rBLR) and the rescued viruses (rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD) was amplified using a laboratory-established RT-PCR method. PCR products were identified by 1% agarose gel electrophoresis and sequenced. The results showed that the PCR products of rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD were bands of 1818 bp, 2022 bp, and 2111 bp, respectively, and the PCR product of the parental virus rBLR was a band of 1074 bp. Sequence analysis confirmed that the nucleotide sequences of segment 8 of the rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD recombinant rotaviruses matched the insert sequences of the pT7 / NSP3-2A-BCoV-CTD, pT7 / NSP3-2A-BCoV-NTD, and pT7 / NSP3-2A-BCoV-RBD plasmids, respectively.

[0036] RNA electrophoresis identification of the recombinant rotavirus dsRNA genomic fragments revealed that the rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD recombinant viruses rescued with pT7 / NSP3-2A-BCoV-CTD, pT7 / NSP3-2A-BCoV-NTD, or pT7 / NSP3-2A-BCoV-RBD plasmids contained segment 8 dsRNA, which migrated slower than the segment 8 dsRNA of the parental rBLR virus. These dsRNAs migrated on polyacrylamide gels close to the position of segment 4 or 5 dsRNA, consistent with the predicted band size ( Figure 5 A), indicating that rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD are rescued viruses, not wild-type virus contamination. Rabbit anti-bovine rotavirus polyclonal antibodies and mouse anti-bovine coronavirus polyclonal antibodies were used for WB and IFA detection, and it can be seen that cells inoculated with rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD all have specific bands ( Figure 5 B) and specific fluorescence ( Figure 5 C), indicating that rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD can all induce the expression of BCoV CTD, NTD, and RBD proteins.

[0037] The growth kinetics of rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD in Marc-145 cells showed that rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD viruses had similar replication kinetics to the parental rBLR ( Figure 5 D). These data indicate that rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD carry the modified BLR gene segment 7 during viral replication and express BCoV protective antigens CTD, NTD, and RBD in infected cells. In order to evaluate the genetic stability of the recombinant rotavirus, rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD were serially passaged in Marc-145 cells at an MOI of 1 for 5 rounds, and their genetic stability was analyzed by RNA electrophoresis. The results showed that the sizes of the 11 genomic segments, including the 8th segment, did not change during the 5 serial passages, indicating that these viruses have good genetic stability and can be stably passaged ( Figure 5 E).

[0038] Example 3. Evaluation of the immunogenicity of recombinant rotavirus expressing BCoV protective antigen protein 1. Effects of foreign protein gene insertion on BLR replication and pathogenicity in vivo To evaluate the effects of BCoV S1 CTD, S1 NTD, and S1 RBD gene insertion on rotavirus (RV) replication in vivo and to assess the safety of parental rBLR and recombinant viruses rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD in suckling mice. 8 TCID 50 / mL) were inoculated into 5-day-old BALB / c mice, while the healthy control group (con) was orally administered with 0.5 mL of homologous culture medium. The diarrhea rate and fecal rotavirus shedding within 10 days were compared. Like rBLR, rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD caused diarrhea in BALB / C suckling mice early after infection ( Figure 6 A), but no rotavirus was detected in the feces of BALB / C mice ( Figure 6 B). These data indicate that rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD are associated with diarrhea to a similar degree as rBLR in BALB / C mice, demonstrating that although they produce clinical diarrhea, they do not excrete toxins, indicating safety.

[0039] 2. Evaluation of the Immunogenicity of rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD in Adult BALB / C Mice To investigate the effects of rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD on the antibody response against BCoV in BALB / c mice, 25 6-week-old SPF female BALB / c mice were randomly divided into 5 groups (①rBLR-BCoV-CTD intramuscular live vaccine group; ②rBLR-BCoV-NTD intramuscular live vaccine group; ③rBLR-BCoV-RBD intramuscular live vaccine group; ④rBLR+BCoV group (rBLR+BCoV was the positive control group, and mice were injected intramuscularly for 10 min, 15 min, and 20 min, respectively) 8.5 TCID 50 / mL live virus vaccine rBLR and BCoV 0.5 mL each); ⑤ Healthy control group (healthy control refers to mice injected intramuscularly with 0.5 mL homologous culture medium), 5 mice per group, all mice were housed and managed individually. Except for the healthy control group injected intramuscularly with 0.5 mL homologous culture medium, all mice were injected intramuscularly with 10 8.5 TCID 50 / mL live virus 0.5 mL and add 10% ISA 15A adjuvant, and inject the same dose of virus solution again intramuscularly 2 weeks after immunization ( Figure 7 A); Clinical symptoms of mice in each group were observed daily from 0 to 7 days after inoculation. Mouse serum was collected weekly and neutralizing antibody levels were measured using a neutralization test as follows: bovine rotavirus and bovine coronavirus virus fluids were treated with 50 μg / ml pancreatin solution at 37°C for 1 hour. Mouse serum was diluted 2-fold starting from 1:8 in serum-free DMEM containing 10 μg / ml pancreatin. The trypsin-treated virus was diluted to 1000 TCID 50 Equal amounts of diluted virus were added to serially diluted serum samples and neutralized at 37°C for 1 hour. Marc-145 cells (for rotavirus neutralization antibody assay) or HRT-18G cells (for coronavirus neutralization antibody assay) were cultured in 96-well cell culture plates for 48 hours. The cells were washed twice with PBS. The serum-virus mixture was then added to two replicate wells of each sample in descending order of serum dilution. Positive and negative controls were also included. The cells were adsorbed at 37°C for 1 hour. Serum-free DMEM was then added for maintenance and cultured at 37°C. CPE was observed daily, and endpoint determination was performed after 5 days of incubation. Neutralizing antibody titers were calculated using the Reed-Muench method. Serum IgG antibody levels were measured using an indirect ELISA. The following protocol was used: bovine rotavirus or bovine coronavirus virus was diluted 1:4 with coating buffer, and 100 μL / well of the diluted solution was added to the ELISA-coated plate and coated overnight at 4°C. The plate was blocked with 5% BSA diluted in PBS for 1 hour at 37°C. Mouse serum was diluted 1:200 with PBST, and 100 μL / well of the plate was added to the ELISA plate and incubated at 37°C for 1 hour. HRP-conjugated goat anti-mouse IgG was added and incubated at 37°C for 1 hour. TMB substrate buffer was added and reacted in the dark for 15 minutes. The reaction was terminated with 2 M H₂SO₄. Furthermore, to detect antibodies against rotavirus and coronavirus in mouse serum collected on day 21, indirect immunofluorescence staining (IFA) was used.

[0040] The results showed that all sera of adult mice immunized with rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD reacted with RV as early as 7 days. After booster immunization on day 14, the serum anti-RV IgG titer further increased on day 21 ( Figure 7 Bb). It is worth noting that booster immunization can cause adult mice immunized with rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD to show BCoV serological positive conversion at 21 days, and the anti-BCoV specific antibody levels in the serum of mice immunized with rBLR-BCoV-NTD were higher than those in the serum of mice immunized with rBLR-BCoV-CTD and rBLR-BCoV-RBD at all time points ( Figure 7 To further detect whether the mouse serum contained antibodies against BRV or BCoV, the mouse serum collected on day 21 was identified by IFA. The sera of mice immunized with rBLR-BCoV-CTD, rBLR-BCoV-NTD, rBLR-BCoV-RBD, or rBLR+BCoV groups all showed strong reactions to BRV-infected Marc-145 cells or BCoV-infected HRT-18G cells, with the rBLR-BCoV-NTD group showing the strongest staining signal ( Figure 8 ), indicating that sera from BALB / C mice immunized with rBLR-BCoV-NTD had a strong specific response to the BCoV S1 protein. These results indicate that sera from adult mice immunized with rBLR-BCoV-NTD contain antibodies against BRV and BCoV, and that secondary booster immunization enhances immune responses to BRV and BCoV.

[0041] Further evaluation of the neutralizing activity of BRV and BCoV serum antibodies revealed that the sera of mice in each group could neutralize BRV, and the neutralizing antibody levels of each group were not much different. At the highest neutralizing antibody level, the anti-rotavirus neutralizing antibody titer of the rBLR-BCoV-NTD group was 1:1536 (Figure 6Cb, Table 2). In addition, the anti-BCoV neutralizing antibody test found that the neutralizing antibody level produced by the rBLR-BCoV-NTD group was higher than that of the rBLR-BCoV-CTD and rBLR-BCoV-RBD groups. At 28 days, the BCoV neutralizing antibody titer produced by the rBLR-BCoV-NTD group was 1:64 ( Figure 7 These results indicate that the rBLR-BCoV-NTD recombinant virus can induce high levels of antibodies against BCoV in adult BALB / C mice.

[0042] Example 4. Recombinant rotavirus expressing Clostridium perfringens alpha toxin and PEDV antigens 1. Using rotavirus BLR strain as the backbone vector, recombinant plasmids expressing Clostridium perfringens α-toxin protein (Cp-α) and PEDV protective antigen protein S1 CTD were constructed. Figure 9 ).

[0043] (1) Construction of pT7 / NSP3-2A-Cp-α vector: The ends of the NSP3 coding sequence in the vector pT7 / NSP3BLR were connected to the flexible linker coding sequence (SEQ ID NO. 13), the P2A coding sequence (SEQ ID NO. 14), and the Cp-α coding sequence (SEQ ID NO. 18).

[0044] Using Clostridium perfringens α-toxin DNA as a template, the primers designed and synthesized in step 1 were used to amplify the Cp-α gene segment and the vector fragment pT7-BLR-NSP3. In order to achieve "self-cleavage" expression of NSP3 and foreign proteins and improve the efficiency of self-cleavage, a flexible linker and P2A coding sequence were introduced at the end of the NSP3 coding sequence of the vector pT7-BLR-NSP3, so that the flexible linker, P2A and Cp-α were fused to the C-terminus of the NSP3 protein. The amplified Cp-α gene segment and the vector fragment pT7-BLR-NSP3 were homologously recombined using the Takara In-Fusion Cloning Kit, and finally the pT7 / NSP3-2A-Cp-α reverse genetic recombination plasmid was obtained ( Figure 9 ), used for the rescue of recombinant rotavirus expressing Cp-α.

[0045] (2) Construction of pT7 / NSP3-2A-PEDV CTD vector: The ends of the NSP3 coding sequence in the vector pT7 / NSP3BLR were connected to the flexible linker coding sequence (SEQ ID NO. 13), the P2A coding sequence (SEQ ID NO. 14), and the PEDV CTD coding sequence (SEQ ID NO. 18).

[0046] PEDV nucleic acid was extracted using a viral RNA extraction kit, and PEDV RNA was reverse transcribed into cDNA using a reverse transcription kit. The synthesized cDNA was used as a template and the primers designed and synthesized in step 1 were used to amplify the gene segment of PEDV S1-CTD and the vector fragment pT7-BLR-NSP3. In order to achieve "self-cleavage" expression of NSP3 and exogenous proteins and improve the self-cleavage efficiency, a flexible linker and P2A coding sequence were introduced into the end of the NSP3 coding sequence of the vector pT7-BLR-NSP3, so that the flexible linker, P2A and PEDV S1-CTD were fused to the C-terminus of the NSP3 protein. The amplified PEDV S1-CTD gene segment and the vector fragment pT7-BLR-NSP3 were homologously recombined using the Takara In-Fusion cloning kit, and finally the pT7 / NSP3-2A-PEDV CTD reverse genetic recombination plasmid was obtained ( Figure 9 ), used for the rescue of recombinant rotavirus expressing PEDV CTD.

[0047] 2. Rescue of recombinant rotavirus expressing Cp-α: 11 plasmids (pT7 / VP1BLR, pT7 / VP2BLR, pT7 / VP3BLR, pT7 / VP4BLR, pT7 / VP6BLR, pT7 / VP7BLR, pT7 / NSP1BLR, pT7 / NSP2BLR, pT7 / NSP3-2A-Cp-α, pT7 / NSP4BLR, and pT7 / NSP5BLR) were mixed evenly. 0.6 μg of each of these 11 plasmids was co-transfected into BHK-21-T7 cells using Lipo3000 transfection reagent. The transfected cells were cultured for 2 days. Marc-145 cells were then added to the wells and co-cultured for 2 days. The culture medium was harvested and virus was propagated on the Marc-145 cells to obtain recombinant rotavirus expressing Cp-α.

[0048] 3. Rescue of recombinant rotavirus expressing PEDV CTD: 11 plasmids, pT7 / VP1BLR, pT7 / VP2BLR, pT7 / VP3BLR, pT7 / VP4BLR, pT7 / VP6BLR, pT7 / VP7BLR, pT7 / NSP1BLR, pT7 / NSP2BLR, pT7 / NSP3-2A-PEDVCTD, pT7 / NSP4BLR, and pT7 / NSP5BLR, were mixed evenly. All 11 plasmids were co-transfected into BHK-21-T7 cells using Lipo3000 transfection reagent. The transfected cells were cultured for 2 days, and then Marc-145 cells were added to the wells and co-cultured for 2 days. The culture was harvested and virus was propagated on the Marc-145 cells to obtain recombinant rotavirus expressing PEDV CTD.

[0049] Results showed that after two freeze-thaw cycles of transfected contemporary cell cultures, Marc-145 cells were inoculated and cultured for 24-48 hours, rotavirus-specific CPE was observed, characterized by cell shrinkage and aggregation, blurred fine boundaries, cell surface disintegration, enlarged interstitial spaces, and shedding and death. The rescued viruses were named rBLR-Cp-α and rBLR-PEDV-CTD, respectively. The complete NSP3 gene of the parental rBLR virus and the rescued rBLR-Cp-α and rBLR-PEDV-CTD viruses was amplified using a laboratory-established RT-PCR method. PCR products were identified by 1% agarose gel electrophoresis and sequenced. Sequence analysis confirmed that the nucleotide sequences of the eighth gene segment of the rBLR-Cp-α and rBLR-PEDV-CTD recombinant rotaviruses matched the insert sequences of the corresponding recombinant plasmids. RNA electrophoresis identification of the recombinant rotavirus dsRNA genome revealed that the molecular weight of the 8th segment dsRNA of the rBLR-Cp-α and rBLR-PEDV-CTD recombinant rotaviruses was larger than that of the 8th segment RNA of the parental virus rBLR, which was consistent with the predicted band size ( Figure 9 Aa, b), indicating that these recombinant viruses are rescued viruses, rather than wild-type contamination. Western blot and IFA assays were performed using rabbit anti-bovine rotavirus polyclonal antibodies, mouse anti-PEDV S1 polyclonal antibodies, or mouse anti-Clostridium perfringens α-toxin protein polyclonal antibodies. Cells inoculated with rBLR-Cp-α and rBLR-PEDV-CTD recombinant rotaviruses showed specific bands ( Figure 9 Ba, b) and specific fluorescence ( Figure 9 C a, b). The growth kinetics of the recombinant virus in Marc-145 cells showed that the replication titer of the recombinant virus was basically consistent with that of the parent virus rBLR ( Figure 9 To evaluate the genetic stability of the recombinant rotaviruses, rBLR-Cp-α and rBLR-PEDV-CTD were serially passaged in Marc-145 cells at an MOI of 1 for five rounds, and their genetic stability was analyzed by RNA electrophoresis. The results showed that the sizes of the 11 genomic segments of the rBLR-Cp-α and rBLR-PEDV-CTD recombinant viruses remained unchanged during the five serial passages, indicating that these viruses have good genetic stability and can be stably passaged ( Figure 9 E a, b). These results indicate that the method of the present invention can be used to express different protective antigen proteins and has a broad spectrum of vectors.

[0050] 4. Safety evaluation of recombinant viruses rBLR-Cp-α and rBLR-PEDV-CTD To investigate the safety of rBLR-Cp-α and rBLR-PEDV-CTD inoculation in mice, rBLR, rBLR-Cp-α and rBLR-PEDV-CTD were orally inoculated into BALB / C suckling mice. The results showed that, like rBLR, rBLR-Cp-α and rBLR-PEDV-CTD were not significantly affected by infection in BALB / C suckling mice (5×10 8 TCID 50 / mL) and causes diarrhea in the early stage ( Figure 11 A), but no rotavirus was detected in feces ( Figure 11 B). These data indicate that rBLR-Cp-α and rBLR-PEDV-CTD are associated with diarrhea to a similar degree as rBLR in BALB / C mice, both of which can induce diarrhea but do not excrete toxins, indicating that they are safe.

[0051] 5. Evaluation of the immunogenicity of recombinant viruses rBLR-Cp-α and rBLR-PEDV-CTD In order to evaluate the immunogenicity of rBLR-Cp-α and rBLR-PEDV-CTD in adult BALB / C mice, especially the antibody response induced by rBLR-Cp-α and rBLR-PEDV-CTD to α-toxin and PEDV in BALB / C mice, the recombinant viruses were inoculated into BALB / C mice by intramuscular injection. The results showed that all sera of adult mice vaccinated with rBLR-Cp-α or rBLR-PEDV-CTD reacted with BRV as early as 7 days, and after booster immunization on day 14, the serum anti-RV IgG titer further increased on day 21 ( Figure 12 Aa). After boosting immunization, adult mice immunized with rBLR-Cp-α or rBLR-PEDV-CTD showed PEDV or Cp-α serological conversion on day 21. The OD 450 They are 0.29 and 0.36 respectively ( Figure 12 Based on these findings, we concluded that sera from adult mice immunized with rBLR-Cp-α or rBLR-PEDV-CTD contained antibodies against BRV and PEDV or Cp-α, and that secondary booster immunization enhanced the immune responses to BRV and PEDV or Cp-α.

[0052] Further evaluation of the neutralizing activity of BRV serum antibodies revealed that the serum of adult mice immunized with rBLR-Cp-α or rBLR-PEDV-CTD had the ability to neutralize BRV. The activity showed an increasing trend over time. After the second immunization on day 14, the antibody level increased further. At day 14 after the second immunization, the antibody level began to decline. At the highest level of neutralizing antibodies, the anti-rotavirus neutralizing antibody titer in the rBLR-PEDV-CTD group was 1:768, and the anti-rotavirus neutralizing antibody titer in the rBLR-Cp-α group was 1:768. ( Figure 12 B, Table 3). Furthermore, the neutralizing antibody titer against PEDV was measured in sera from mice immunized with rBLR-PEDV-CTD on day 28. The titer was 1:64, indicating that the recombinant virus rBLR-PEDV-CTD was able to produce neutralizing antibodies against PEDV in mice. Mice immunized with recombinant rotavirus rBLR-Cp-α were intraperitoneally injected with a lethal dose of Clostridium perfringens α-toxin 35 days after immunization. Clinical symptoms were observed daily, and the survival rate of mice was used to evaluate the protective effect of recombinant rotavirus rBLR-Cp-α against α-toxin. The mortality rate of each treatment group was expressed as: mortality rate (%) = (number of mice killed / total number of mice) × 100, and the cumulative mortality rate was calculated. The results showed that the protective rate against C. perfringens α-toxin in sera from mice immunized with recombinant rotavirus rBLR-Cp-α 35 days after immunization with recombinant rotavirus rBLR-Cp-α was 80% (4 / 5), while the protective rate in the group immunized with the corresponding α-toxin subunit vaccine was 100% (5 / 5). These data support the conclusion that rBLR-Cp-α or rBLR-PEDV-CTD induces antibody responses against PEDV or Cp-α in adult BALB / C mice.

[0053] Table 1 Primer sequences for amplifying BCoV protective antigen protein, Clostridium perfringens α-toxin protein, and PEDV protective antigen protein

[0054] Table 2 Average neutralizing antibody titers against BRV and BCoV in the serum of mice after inoculation with rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD

[0055] Table 3 Average titers of neutralizing antibodies against BLR in the serum of mice after vaccination with rBLR-Cp-α and rBLR-PEDV-CTD

Claims

1. A plasmid combination for rescuing attenuated bovine rotavirus, characterized in that: The bovine rotavirus rescue plasmid is based on the pT7 vector as the starting vector, and the sequences shown in SEQ ID NO. 2-12 are respectively connected to obtain the pT7 / VP1BLR, pT7 / VP2BLR, pT7 / VP3BLR, pT7 / VP4BLR, pT7 / VP6BLR, pT7 / VP7BLR, pT7 / NSP1BLR, pT7 / NSP2BLR, pT7 / NSP3BLR, pT7 / NSP4BLR and pT7 / NSP5BLR plasmids.

2. An attenuated bovine rotavirus rescue system, characterized in that: The invention comprises an attenuated bovine rotavirus strain rescued by the rescue plasmid combination according to claim 1.

3. The attenuated bovine rotavirus rescue system according to claim 2, characterized in that: The attenuated bovine rotavirus rescue system is to transfect the rescue plasmid combination described in claim 1 into BHK-21-T7 cells, harvest the culture and perform virus proliferation on Marc-145 cells to rescue the attenuated bovine rotavirus strain.

4. Use of the rescue plasmid combination according to claim 1 or the rescue system according to claim 2 or 3 in the preparation of an attenuated bovine rotavirus vaccine or drug.

5. A recombinant bovine rotavirus strain, characterized in that: The recombinant bovine rotavirus strain is obtained by connecting the ends of the coding gene of the sequence shown in SEQ ID NO.10 in the pT7 / NSP3BLR plasmid in the attenuated bovine rotavirus strain according to claim 2 to the sequence shown in SEQ ID NO.13, SEQ ID NO.14, and then to the sequence shown in SEQ ID NO.15, SEQ ID NO.16 or SEQ ID NO.

17.

6. Use of the recombinant bovine rotavirus strain according to claim 5 in the preparation of a bovine rotavirus and bovine coronavirus combined vaccine or medicine.

7. A recombinant bovine rotavirus strain, characterized in that: The recombinant bovine rotavirus strain is obtained by connecting the ends of the coding gene of the sequence shown in SEQ ID NO.10 in the pT7 / NSP3BLR plasmid in the attenuated bovine rotavirus strain according to claim 2 to SEQ ID NO.13, SEQ ID NO.14, and then to the sequence shown in SEQ ID NO.

18.

8. Use of the recombinant bovine rotavirus strain according to claim 7 in the preparation of a bovine rotavirus and porcine epidemic diarrhea virus combined vaccine or medicine.

9. A recombinant bovine rotavirus strain, characterized in that: The recombinant bovine rotavirus strain is obtained by connecting the ends of the coding gene of the sequence shown in SEQ ID NO.10 in the pT7 / NSP3BLR plasmid in the attenuated bovine rotavirus strain according to claim 2 to SEQ ID NO.13, SEQ ID NO.14, and then to the sequence shown in SEQ ID NO.

19.

10. Use of the recombinant bovine rotavirus strain according to claim 9 in the preparation of a bovine rotavirus and Clostridium perfringens combined vaccine or medicine.

Images