Nucleic acid detection system based on glass nanopore and nanomanipulation as well as preparation method and application of nucleic acid detection system

Abstract

The invention relates to a nucleic acid detection system based on glass nanopores and nanomanipulation as well as a preparation method and application of the nucleic acid detection system, and belongs to the technical field of biology. Aiming at the technical problems of difficulty in signal capture, incapability of realizing accurate space positioning and insufficient complex structure detection accuracy caused by too high nucleic acid translocation speed in the existing nanopore technology, a DNA chip is combined with a nanomanipulation technology. A modified glass chip of which the surface is fixed with double Gap double-stranded DNA is constructed, a glass nanopore is matched, an electric field is applied by utilizing a patch clamp system, and a piezoelectric ceramic nano displacement platform is combined to realize accurate control on a DNA structure. According to the method, fixed-point capture, multiple repeated detection and accurate distinguishing of sequences with different lengths of nucleic acid are realized, the detection limitation of a traditional nanopore technology on a complex nucleic acid structure is solved, and the method has important application value in the fields of gene diagnosis and nanopore sequencing.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a nucleic acid detection system based on glass nanopores and nanomanipulation, its preparation method and application. Background Technology

[0002] With the development of nanotechnology, nanopore technology has become an important tool for DNA sequencing and molecular detection. Traditional nanopore technology mainly relies on biological or solid nanopores, identifying DNA sequences by measuring the change in current as DNA passes through the nanopore. However, these methods have certain limitations in the accurate detection and structural identification of nucleic acids. The translocation speed of the analyte (such as DNA) within the nanopore is too fast (milliseconds to microseconds), making it difficult to capture and analyze the ionic current signal. Nanopore-based free translocation detection cannot precisely control the translocation time of molecules or perform multiple detections of the same molecule, nor can it achieve spatial localization analysis of single-molecule structures, especially lacking precision in the detection of complex structures (such as gaps or single-strand extensions in double-stranded DNA scaffolds). Therefore, there is an urgent need to develop a method that can repeatedly detect complex structures on DNA. Summary of the Invention

[0003] In view of this, one objective of the present invention is to provide a nucleic acid detection system based on glass nanopores and nanomanipulation, and another objective is to provide an application of a nucleic acid detection system based on glass nanopores and nanomanipulation in the examination of nucleic acids.

[0004] To achieve the above objectives, the present invention provides the following technical solution:

[0005] This invention provides a nucleic acid detection system based on glass nanopores and nanomanipulation. The nucleic acid detection system includes a DNA chip and a glass nanopore. Double-Gap double-stranded DNA is attached to the surface of the glass slide of the DNA chip. The double-Gap double-stranded DNA contains two single-stranded Gap sequences. The single-stranded Gap sequences bind to the nucleic acid sequence to be detected through complementary base pairing. The inner diameter of the glass nanopore is 10-17 nm. The glass nanopore is connected to the positive electrode of the patch clamp and filled with an electrolyte buffer solution. The negative electrode is placed in the DNA chip solution. The double-Gap double-stranded DNA is captured and detected by moving the glass nanopore through a nanomanipulation platform.

[0006] Preferably, the nucleic acid sequence of the double-Gap double-stranded DNA is shown in SEQ ID NO:2, and the nucleic acid sequences of the Gap complementary strand are shown in SEQ ID NO:6 and SEQ ID NO:7.

[0007] Furthermore, the preparation method of the nucleic acid detection system based on glass nanopores and nanomanipulation includes the following steps:

[0008] S1: Using circular plasmid PET28-N809 as a template, PCR amplification was performed using primers containing biotin to obtain biotin-labeled double-stranded DNA.

[0009] S2: Biotin-labeled double-stranded DNA was digested with Nt.BbvCI enzyme to form a single-stranded nick at the 5'-CCTCAGC-3' site. Then, the Gap complementary strand was added to induce the short strand to fall off, generating double-stranded DNA containing double Gap.

[0010] S3: After the enzyme digestion in step S2, add BamHI enzyme to cleave the undigested double-stranded DNA and digest at 37°C for 1 hour.

[0011] S4: Double-Gap double-stranded DNA was separated and purified by electrophoresis;

[0012] S5: The glass slide of the DNA chip is modified with PEG and streptavidin, and the 3' or 5' end of the double-Gap double-stranded DNA is modified with biotin. The double-Gap double-stranded DNA is fixed on the surface of the glass slide by the specific binding of streptavidin and biotin.

[0013] Preferably, in step S1, the biotin-labeled primer pair is primer 1 and primer 2, or primer 3 and primer 4; wherein the nucleic acid sequence of primer 1 is shown in SEQ ID NO:8, and the nucleic acid sequence of primer 2 is shown in SEQ ID NO:9, with primer 2 having a biotin-labeled 5' end; the nucleic acid sequence of primer 3 is shown in SEQ ID NO:10, and the nucleic acid sequence of primer 4 is shown in SEQ ID NO:11, with primer 4 having a biotin-labeled 5' end;

[0014] Preferably, the reaction conditions in step S2 are: 37°C for 3 hours; 90°C for 1 minute; 72°C for 5 minutes; 55°C for 5 minutes; 37°C for 20 minutes; and a total of 4 cycles from 90°C to 37°C.

[0015] Preferably, the nucleic acid sequence of the plasmid PET28-N809 is shown in SEQ ID NO:1;

[0016] Furthermore, the application of nucleic acid detection systems based on glass nanopores and nanomanipulation in nucleic acid detection;

[0017] Preferably, the nucleic acid is any one of double-stranded DNA, single-stranded DNA, or RNA;

[0018] Preferably, the application of a nucleic acid detection system based on glass nanopores and nanomanipulation in the detection of nucleic acids is characterized in that the nucleic acid sequence is as shown in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:12.

[0019] The beneficial effects of this invention are as follows:

[0020] 1. Precise control and repeatability testing capabilities

[0021] By employing a nanomanipulation platform to achieve nanoscale precision displacement control of glass nanopores, spatial localization and repeated detection of nucleic acid molecules were realized. Compared to traditional free translocation detection, this system can actively regulate the rate at which molecules pass through the nanopore, effectively solving the problem of signal capture difficulties caused by excessively rapid molecular translocation (milliseconds to microseconds), and significantly improving the interpretability of the detection data.

[0022] 2. Specific recognition of complex DNA structures

[0023] This system uses double-gap double-stranded DNA as the detection vector. Nt.BbvCI enzyme-specific cleavage combined with complementary strand replacement forms a double-stranded scaffold with clearly defined single-stranded gap sites. BamHI enzyme digestion removes unreacted intact double strands, ensuring template purity. The system accurately identifies gap structures and single-stranded extension regions, quantitatively distinguishing different single-stranded sequences by measuring changes in the area of ​​ion current trajectory, achieving pA-level current change resolution.

[0024] 3. Construction of a highly stable detection system

[0025] Glass nanopores are pretreated with piranha solution to form a hydrophilic surface, which, combined with a 2M LiCl electrolyte system, significantly reduces background noise. The DNA chip is modified with PEG-biotin / streptavidin multilayers to achieve firm immobilization of double-Gap double-stranded DNA on the substrate surface, avoiding non-specific adsorption interference and ensuring long-term stability of the detection signal.

[0026] 4. Efficient and controllable template preparation process

[0027] An innovative two-step enzyme digestion strategy (Nt.BbvCI cleavage → BamHI double-strand cleavage) was adopted, and the digestion efficiency was optimized through temperature gradient cycling (multi-stage temperature control from 37℃ to 90℃). High-purity double-Gap double-stranded DNA was finally obtained by electrophoretic purification. This preparation method exhibits good reproducibility, laying the foundation for large-scale detection applications.

[0028] 5. Multi-scenario application compatibility

[0029] The system can adapt to nucleic acid detection of different sequences, and the detection target can be flexibly switched by adjusting the gap complementary strand design. Examples 4-5 demonstrate its ability to distinguish between 114nt (S5AFP) and 58nt (S3CEA) single strands, exhibiting excellent sequence resolution performance. It can distinguish between 81nt single strands of 114nt S5AFP after gap filling and 25nt single strands of 58nt S3CEA after gap filling.

[0030] Other advantages, objectives, and features of the invention will be set forth in part in the description which follows, and in part will be apparent to those skilled in the art from the following examination, or may be learned from practice of the invention. The objectives and other advantages of the invention can be realized and obtained through the following description. Attached Figure Description

[0031] To make the objectives, technical solutions, and advantages of the present invention clearer, the preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings, wherein:

[0032] Figure 1 A schematic diagram of a system for nanomanipulating gaps and nucleic acids on a double-stranded DNA scaffold;

[0033] Figure 2 Ion current trajectory diagram for manipulating double-stranded DNA containing double gaps to escape from glass nanopores.

[0034] Figure 3 To manipulate the area of ​​the ion current trajectory change through the glass nanopore in the gap, (top) the first gap, (bottom) the second gap;

[0035] Figure 4 To illustrate the original current trajectory of B4-Gap nanomanipulation until DNA detaches from the nanopore, the diagram shows the ion current trajectory of a B4-Gap detected from bottom to top until the DNA scaffold is completely detached from the nanopore. From the time Gap-1 completely detaches from the tip of the glass nanopore to the time Gap-2 begins to pass through the tip, the time for the fragment between the two Gaps to pass through the nanopore tip is 30.68 seconds. However, from the time Gap-2 completely detaches from the tip of the glass nanopore to the time for the fragment between the two Gaps to detach the entire double-stranded DNA scaffold from the tip, the time is 63.65 seconds. This time ratio (2.07) roughly matches the ratio of the number of base pairs between the two Gaps to the number of base pairs from Gap-2 to the end of the DNA scaffold (2.01), with an error of approximately 3.0%.

[0036] In the first test, the time it took for the DNA fragment between the two gaps to pass through the tip of the glass nanopore was approximately 24.11 seconds, and the time from when Gap-2 detached from the tip of the nanopore to when the entire DNA scaffold left the nanopore was approximately 71.93 seconds. The time ratio (2.98) is roughly consistent with the ratio of the number of base pairs between the DNA fragment between the two gaps to the number of base pairs from Gap-2 to the end of the DNA scaffold (3.38), with an error of approximately 11.8%.

[0037] In the second test, the time it took for the DNA fragment between the two gaps to pass through the tip of the glass nanopore was approximately 25.80 seconds, and the time from when Gap-2 detached from the tip of the nanopore to when the entire DNA scaffold left the glass nanopore was approximately 79.76 seconds. The time ratio (3.09) is roughly consistent with the ratio of the number of base pairs between the DNA fragment between the two gaps (724 bp) to the number of base pairs from Gap-2 to the end of the DNA scaffold (2445 bp) (3.38), with an error of approximately 8.6%.

[0038] Figure 5 The original current trajectory obtained by nanomanipulating B4-Gap and the current trajectory after being filtered by a Bessel filter at 2.5 Hz.

[0039] Figure 6 The original current trajectory of two nanomanipulations of 4B-Gap until DNA was removed from the nanopore.

[0040] Figure 7 The original current trajectory obtained by nanomanipulating 4B-Gap1 and the current trajectory after being filtered by a Bessel filter at 2.5 Hz are shown in (A) Gap-1 and Gap-2; (B) Gap-1; (C) Gap-2.

[0041] Figure 8 The original current trajectory obtained by nanomanipulating 4B-Gap2 and the current trajectory after being filtered by a Bessel filter at 2.5 Hz are shown in (A) Gap-1 and Gap-2; (B) Gap-1; (C) Gap-2.

[0042] Figure 9 Ion current trajectory diagram for manipulating double-stranded DNA containing two identical nucleic acids to escape from a glass nanopore.

[0043] Figure 10 To manipulate the area of ​​the ion current trajectory change of a single chain through a glass nanopore, (left) S3AFP, (right) S5AFP;

[0044] Figure 11 The original current trajectory for nanomanipulating S5AFP and S3AFP until DNA is removed from the nanopore.

[0045] Figure 12 The original current trajectories obtained by nanomanipulating S5AFP and S3AFP and the current trajectories after being filtered by a Bessel filter at 2.5 Hz are shown in the figures: (A) S5AFP and S3AFP; (B) S5AFP; (C) S3AFP.

[0046] Figure 13 Ion current trajectory diagram for manipulating double-stranded DNA containing two nucleic acids of different lengths to escape from a glass nanopore;

[0047] Figure 14 To manipulate the area of ​​ion current trajectory changes as single chains of different lengths pass through glass nanopores, (top) S5AFP, (bottom) S3CEA;

[0048] Figure 15 The original current trajectory for nanomanipulation of S5AFP and S3CEA until DNA is removed from the nanopore.

[0049] Figure 16 The images show the original current trajectories obtained by nanomanipulating S5AFP and S3CEA, and the current trajectories after being filtered by a 2.5Hz Bessel filter. (A) S5AFP and S3CEA; (B) S5AFP; (C) S3CEA;

[0050] Figure 17 A schematic diagram for preparing a gap-supported double-stranded DNA scaffold;

[0051] Figure 18 Electrophoresis diagram of DNA with double gaps;

[0052] Figure 19 Ion current trajectory diagram of four nanomanipulations of a double-stranded DNA scaffold containing Gap and S3-81.

[0053] Figure 20 The area of ​​the region where the ion current trajectory changes during the first and second detections of the 81nt single chain in the repeated nanomanipulation of the Gap and 81nt single chains;

[0054] Figure 21 The area of ​​the region where the ion current trajectory changes during the third and fourth detections of the 81nt single chain in the repeated nanomanipulation of the Gap and 81nt single chains is represented.

[0055] Figure 22 The area of ​​the region where the ion current trajectory changes during the first and second detections of the Gap in the single-chain repeating nanomanipulation of Gap and 81nt.

[0056] Figure 23The area of ​​the region where the ion current trajectory changes during the third and fourth detections of the Gap single chain in the repeated nanomanipulation of Gap and 81nt single chains is represented. Detailed Implementation

[0057] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments are only schematic representations of the basic concept of the present invention. Unless otherwise specified, the following embodiments and features can be combined with each other.

[0058] The accompanying drawings are for illustrative purposes only and are schematic diagrams, not actual pictures. They should not be construed as limiting the invention. To better illustrate the embodiments of the invention, some parts in the drawings may be omitted, enlarged, or reduced, and do not represent the actual product dimensions. It is understandable to those skilled in the art that some well-known structures and their descriptions may be omitted in the drawings.

[0059] In the accompanying drawings of the embodiments of the present invention, the same or similar reference numerals correspond to the same or similar components. In the description of the present invention, it should be understood that if terms such as "upper," "lower," "left," "right," "front," and "rear" indicate the orientation or positional relationship based on the orientation or positional relationship shown in the drawings, they are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, the terms used to describe positional relationships in the drawings are only for illustrative purposes and should not be construed as limiting the present invention. For those skilled in the art, the specific meaning of the above terms can be understood according to the specific circumstances.

[0060] Example 1: Preparation of Gap-containing double-stranded DNA scaffold

[0061] like Figure 17 As shown, using the customized circular plasmid PET28-N809 as a template, the nucleic acid sequence is shown in SEQ ID NO:1, wherein:

[0062] CCATGG: NcoI restriction site;

[0063] AAGCTT: HindIII restriction site;

[0064] GCTGAGG: Nt.BbvCI restriction site;

[0065] GGATCC: BamHI restriction site;

[0066] GAATTC: EcoRI restriction site.

[0067] PCR amplification was performed using primer 1 with biotin labeling and primer 2 without biotin labeling.

[0068] The primer sequences are as follows:

[0069] Primer 1, 1023S: 5'CCAGTGAGACGGGCAACAG 3' (SEQ ID NO: 8);

[0070] Primer 2, B-1023S: 5'CCAGTGAGACGGGCAACAG 3' (SEQ ID NO:9), 5' biotin modified;

[0071] Primer 3, 5446R: 5'TTCCGCTTCCTCGCTCACT 3' (SEQ ID NO: 10);

[0072] Primer 4, B-5446R: 5'TTCCGCTTCCTCGCTCACT 3' (SEQ ID NO:11), 5' biotin modified;

[0073] PCR amplification yielded a 4687 bp biotin-labeled double-stranded DNA (B4-DNA) nucleic acid sequence, as shown in SEQ ID NO:2.

[0074] CCATGG:NcoI restriction site

[0075] AAGCTT: HindIII restriction site

[0076] GCTGAGG: Nt.BbvCI restriction site, cleaves the complementary strand 5'CC / TCAGC 3'.

[0077] Double-stranded DNA was digested using Nt.BbvCI at 37°C. Nt.BbvCI is a nicking endonuclease that creates single-stranded nicks at specific DNA sequences, rather than completely cleaving the double-stranded DNA. The sequence recognized by Nt.BbvCI is 5'-CCTCAGC-3', forming a single-stranded nick between CC and TCAGC. After Nt.BbvCI recognizes and digests the specific sequence, four single-stranded nicks are formed on the upper strand of the double-stranded DNA. Adding an excess of bases complementary to the short strands formed by the single-stranded nicks causes the short strands to detach from the double-stranded DNA. Due to the efficiency of the digestion process, not all double-stranded DNA was digested. In this case, the sample contained not only double-stranded DNA with two single-stranded gaps but also intact double-stranded DNA that had not been digested.

[0078] To distinguish the undigested, intact double-stranded DNA from the target DNA fragment with two gaps, a second digestion is necessary. BamHI is a restriction endonuclease that also recognizes specific DNA sequences. However, unlike Nt.BbvCI, BamHI cleaves double-stranded DNA at the cleavage site. Its recognition sequences are 5'-GGATCC-3' and 3'-CCTAGG-5', cutting the double-stranded DNA between G and GATCC. Adding BamHI to the sample after the first digestion cleaves the undigested, intact double-stranded DNA from Nt.BbvCI, producing two shorter double strands that are clearly distinguishable from the target DNA fragment. The resulting sample is then gel-extracted to obtain the desired double-gap double-stranded DNA.

[0079] Prepare a 50 μL system for a double-stranded DNA scaffold containing two gaps (4B-Gap): 10 μL–20 μL of 4B DNA (SEQ ID NO:2) with biotinylated 3' end; 5 μL of 10×rSmartBuffer; 1 μL of Nt.BbvCI; 1.5 μL each of S5C (20 μM) and S3C (20 μM); add ddH2O to a final volume of 50 μL and mix thoroughly.

[0080] Gap complementary sequence:

[0081] S3C:GGTCACAGCAGCCGCAAGCACTGGATCCGCTGA (SEQ ID NO: 6);

[0082] S5C:GGCTGTCATCCCGACGATCAGTGAATTCGCTGA (SEQ ID NO:7);

[0083] Prepare a 50 μL system for a double-stranded DNA scaffold containing two gaps (B4-Gap): B4 DNA (SEQ ID NO:2), biotin-labeled at the 5' end, 10 μL–20 μL; 10×rSmartBuffer, 5 μL; Nt.BbvCI, 1 μL; S5C (20 μM) and S3C (20 μM) 1.5 μL each; add ddH2O to 50 μL and mix well.

[0084] Enzyme digestion conditions: 37℃, 3 hours; 90℃, 1 minute; 72℃, 5 minutes; 55℃, 5 minutes; 37℃, 20 minutes; 4 cycles from 90℃ to 37℃. After the above enzyme digestion program is completed, add 1 μL of BamHI to each 50 μL system and incubate at 37℃ for 1 hour.

[0085] Agarose gel electrophoresis images after two rounds of enzyme digestion are shown below. Figure 18 As shown, gel extraction yielded double-stranded DNA containing Gap (B4-Gap).

[0086] Example 2: Pretreatment and Preparation of Glass Nanopores

[0087] In this embodiment, the glass nanopores were fabricated using QF100-70-7.5 glass capillaries from Sutter Chemical Company, USA. These capillaries are made of quartz glass, 7.5 cm long, with an outer diameter of 1 mm and an inner diameter of 0.7 mm, and contain a flow guide wire (Filament). The flow guide wire helps the electrolyte solution better fill the tip of the glass nanopore, connecting it to the sample cell to form a circuit.

[0088] Before drawing glass capillaries into glass nanopores, pretreatment is required to thoroughly clean the glass tube and minimize interference during signal detection. The specific experimental procedures are as follows:

[0089] (1) Immerse the quartz glass capillary in acetone solution. Since acetone is volatile, a sufficient amount of acetone solution needs to be added. Sonicate in an ultrasonic cleaner for 20 minutes.

[0090] (2) Transfer the glass capillary tube in acetone solution to deionized water at 18.2 MΩ·cm, and sonicate it twice in an ultrasonic cleaner for 20 minutes each time. After the first ultrasonic cleaning, place the glass capillary tube in clean deionized water for a second ultrasonic treatment;

[0091] (3) Immerse the glass capillary in piranha solution (98% concentrated sulfuric acid: 30% hydrogen peroxide = 3:1) for 3 hours. Piranha solution has strong oxidizing properties, which can remove organic pollutants on the glass surface. Moreover, piranha solution can generate a large number of silanol groups (-Si-OH) on the glass surface, which increases the hydrophilicity of the glass surface and is beneficial to improving the wettability of glass nanopores with electrolyte solution.

[0092] (4) In order to remove the piranha solution, the glass capillary was immersed in deionized water and ultrasonically cleaned 5 times, 10 minutes each time.

[0093] (5) Immerse the glass capillary in anhydrous ethanol and ultrasonically clean it for 20 minutes;

[0094] (6) Soak the glass capillary tube in deionized water and ultrasonically clean it twice, 10 minutes each time;

[0095] (7) Place the ultrasonically cooled glass capillary in a 90°C oven for 4 hours to dry the moisture on the glass capillary.

[0096] (8) After the dried glass capillary is cooled to room temperature, it can be used to draw glass nanopores.

[0097] (9) Fix the pretreated glass capillary tube on the guide rail of MODEL P-2000, ensuring that both ends of the glass tube are in the groove on the guide rail;

[0098] (10) Cover the protective cover, enter the corresponding program, set the corresponding parameters, heat to 630, filament value to 4, velocity value to 61, delay value to 150, pull value to 155.

[0099] (11) After setting the parameters, press the PULL key on the keyboard. At this time, the indicator light inside the protective cover turns red. After a short delay of a few seconds, the glass capillary is drawn into two identical glass nanopores with an inner diameter of about 10-17 nm.

[0100] (12) Inject 100 μL of electrolyte solution into a 1.5 mL centrifuge tube beforehand, insert the drawn glass nanopore into the centrifuge tube, and ensure that the tip of the glass nanopore enters the liquid surface.

[0101] (13) Fix the glass nanopores with a special device and inject an electrolyte solution into the inner wall of the glass nanopores using a liquid injector;

[0102] (14) Centrifuge the glass nanopores after the solution has been injected at 5000 rpm for 10 minutes to remove air bubbles at the tip of the glass nanopores and ensure that the electrolyte solution fully fills the tip of the quartz glass nanopores.

[0103] Example 3 Glass substrate modification and double-stranded DNA scaffold fixation

[0104] 1. Modification of the glass substrate

[0105] The specific experimental procedures are as follows:

[0106] (1) Place the glass slide into the slot, add Decon90 solution, and soak the glass slide in it overnight. Decon90 is an alkaline cleaning solution that can remove organic residues, inorganic salt deposits and biological contaminants from the surface of the glass slide.

[0107] (2) Sonicate in a staining tank containing Decon90 for 10 minutes, clean the glass slide with ddH2O, and then sonicate in ddH2O twice for 10 minutes each time, and rinse with water.

[0108] (3) Acetone has the effect of removing organic pollutants. Use acetone to clean the surface of the glass slide again. Since acetone is volatile, add enough acetone to cover the glass slide, sonicate for 30 minutes, and then rinse with water.

[0109] (4) Add methanol to the staining tank and submerge the glass slide. Sonicate for 30 minutes, rinse with water, drain as much water as possible, and place in a 90°C oven to evaporate all the moisture on the surface of the glass slide.

[0110] (5) Place the glass slide in the piranha solution (98% concentrated sulfuric acid: 30% hydrogen peroxide = 3:1), incubate in a 90℃ oven for 2 hours, rinse with water, drain as much water as possible, remove the glass slide and dry it with nitrogen gas;

[0111] (6) Place the glass slide in sodium ethoxide (35 mL anhydrous ethanol, 15 mL ddH2O, 2 g NaOH, dissolved by ultrasonication) and sonicate for 15 minutes. Then sonicate in ddH2O for 15 minutes, rinse with water, and dry the glass slide with high-purity nitrogen before placing it in a staining jar. Sodium ethoxide is a strong alkaline reagent that can not only clean the glass but also activate the glass surface. The main component of glass is silicon dioxide, and the surface contains a large number of silanol groups (-Si-OH). The alkalinity of sodium ethoxide can promote the deprotonation of silanol groups, forming more -Si-O-, thereby enhancing the surface reactivity and providing active sites for APTES silanization.

[0112] (7) Treatment with 3-aminopropyltriethoxysilane (APTES): Mix 29 mL of methanol, 1.5 mL of acetic acid, and 0.3 mL of APTES, add the mixture to a staining tank, seal with Parafilm, incubate at room temperature for 1 hour, sonicate with ddH2O for 5 minutes, remove the glass slide, and dry with high-purity nitrogen. APTES is a silane coupling agent that can introduce amino groups (-NH2) onto the surface of a glass substrate. The ethoxy group (-OCH2CH3) of APTES undergoes a hydrolytic condensation reaction with the silanol groups on the glass surface to form Si-O-Si bonds, thereby fixing the amino group onto the glass surface. The glass surface treated with sodium ethoxide has more activated hydroxyl groups, which is more conducive to the binding of APTES.

[0113] (8) PEG treatment: Ten glass slides were treated at once. 30 mg of methoxy polyethylene glycol succinimide ester (mPEG-SVA) and 1 mg of Biotin-PEG-NHS were dissolved in 300 μL of autoclaved 100 mM NaHCO3. PEG-SVA and Biotin-PEG-NHS formed covalent bonds through the reaction of NHS ester and amino groups, thus immobilizing PEG and biotin on the glass surface. Two glass slides were placed in a container filled with ddH2O, sandwiching 50 μL of the mixed PEG solution between them. The mixture was incubated in a clean bench at room temperature in the dark for 2 hours. This completed the modification of the glass substrate, facilitating the subsequent immobilization of double-stranded DNA scaffolds on the glass slides.

[0114] II. DNA Fixation:

[0115] After modifying the glass substrate, streptavidin was applied to the glass slide. The DNA scaffold was then immobilized on the glass substrate through the high affinity and strong specific binding of biotin at the 5' end of the double-stranded DNA scaffold to streptavidin. The interaction between biotin and streptavidin is the strongest known non-covalent interaction, exhibiting excellent stability and highly specific recognition capabilities. It is not easily affected by fluctuations in reagent concentration, changes in external environmental conditions, pH gradients, chemical denaturants, or organic solvents. Streptavidin has four biotin-binding sites. The double-stranded DNA was immobilized on the glass slide through this specific binding.

[0116] This experiment uses glass slides with a PEG:Biotin ratio of 30:1 (mPEG-SVA:Biotin-PEG-NHS = 30:1). The specific experimental procedures are as follows:

[0117] (1) Clean the PEG-modified glass slides with fresh deionized water;

[0118] (2) Drop 10 μL of streptavidin at a concentration of 10 μg / mL onto a glass slide, cover the glass slide from one side edge with another PEG-modified glass slide, and try to avoid and remove air bubbles as much as possible. Incubate at room temperature for 15 minutes.

[0119] (3) Rinse repeatedly with deionized water to remove excess streptavidin from the glass slide;

[0120] (4) Sample preparation for nanomanipulation detection of gaps:

[0121] Take 10 μL of 100 pM B4-Gap (or 4B-Gap) solution and drop it onto a glass slide. Gently lower the coverslip from one edge of the glass slide to ensure that the DNA solution fully covers the surface of the glass slide. Incubate at room temperature for 1.5 hours.

[0122] (5) Wash away excess unbound DNA on the glass slide with 1xPBS solution;

[0123] (6) Place the glass slide into a culture dish containing buffer solution for subsequent nanomanipulation detection.

[0124] Example 4: Detection of nanomanipulation using S5AFP and S3AFP

[0125] The nanomanipulation system comprises three main modules: a probe module, a displacement control module, and a signal acquisition module. The probe module mainly consists of a glass nanopore, a scaffold fixing the glass nanopore, a glass slide modified with a DNA double-stranded scaffold, and a stage containing an electrolyte buffer solution. The quartz glass nanopore serves as the probe for capturing the double-stranded DNA scaffold and for nanomanipulation. Its tip is filled with the electrolyte buffer solution and mounted on the pre-designed scaffold, allowing the glass nanopore to be fixed and aligned precisely with the center of the stage. The double-stranded DNA scaffold is bound to the surface of a polyethylene glycol-modified quartz glass substrate through a sandwich reaction involving biotin-streptavidin-biotin binding. The polyethylene glycol effectively prevents DNA molecules from being adsorbed onto the glass slide surface due to electrostatic interactions. The displacement control module includes a triaxial motorized stage and a piezoelectric system. The triaxial motorized stage provides coarse micron-level control of the relative position between the glass slide and the glass nanopore, while the piezoelectric system provides nanon-level precision control of the capture and manipulation of DNA molecules by the glass nanopore. The signal acquisition system consists of a patch-clamp signal amplifier and a digital-to-analog converter. These components are connected to the glass nanopores and the electrolyte buffer solution containing the glass slide via Ag / AgCl electrodes, and external electromagnetic noise is shielded by a Faraday cage. All equipment is placed on a vibration-damping platform to minimize interference from physical vibrations during nanomanipulation of the glass nanopores. Figure 1 As shown.

[0126] I. Sample preparation for nanomanipulation detection using S5AFP and S3AFP:

[0127] 3 μL of 10 nM B4-Gap, 1 μL of 2 μM S5AFP (5'-TCAGCGAATTCACTGATCGTCGGGATGACAGCCTCCTCCGTGACGCTCCTAACGCTGACTCAGGTGCAGTTCTCGACTCGGTCTTGATGTGGGTCCTGTCCGTCCGAACCAATC-3': SEQ ID NO: 3), 1 μL of 2 μM S3AFP (5'-TCAGCGGATCCAGTGCTTGCCGCGATGACGACCTCCTCCGTGACGCTCCTAACGCTGACTCAGGTGCAGTTCTCGACTCGGTCTTGATGTGGGTCCTGTCCGTCCGAACCAATC-3': SEQ ID NO: 4), and 1 μL of 10 mM B4-Gap were added. Mix EDTA and 4 μL of 1PBS thoroughly and incubate at 37°C for 2 hours. Take the solution of the double-stranded DNA scaffold and drop it evenly onto a glass slide. Cover the glass slide with Parafilm sealing film to avoid and remove air bubbles as much as possible, and incubate at room temperature for 1.5 hours.

[0128] II. Nanopore Capture: Data was recorded using Clampex software in "gap-free" mode. The culture dish with a glass slide was fixed on the sample stage, and the glass nanopore (14.7 nm) was fixed directly above the glass slide. The patch-clamp system was connected via an Ag / AgCl electrode, with a 300 mV bias voltage output at the trans end. The sampling frequency was set to 25 kHz, the low-pass filter frequency to 1 kHz, the step size of the piezoelectric ceramic motor was set to 1 nm / ms, the delay to 100 ms, and the actual motor movement speed to 10 nm / s. The displacement of the glass nanopore was controlled using nanomanipulation technology, gradually bringing it closer to the glass slide. When the glass nanopore entered the 2 M LiCl, 10 mM Tris, pH 7.4 buffer solution above the glass slide, the patch-clamp collected a stable ion current. The distance between the nanopore and the glass slide was controlled to reach a critical point. Then, the nanomanipulation system was used to scan a 5 μm × 5 μm plane around the critical point until double-stranded DNA was successfully captured.

[0129] III. Structure Recognition: A nanomanipulation system was used to slowly move a glass nanopore upwards from the bottom of the double-stranded DNA to identify the DNA structure. After detecting the gap structure, the data was processed, and the time it took for different structures to pass through the nanopore, the amplitude of the ion current change, and the area of ​​the ion current trajectory change region were analyzed.

[0130] The target ion current trajectory was filtered using the built-in Bessel filter in Clampfit software to reduce interference, with a filtering frequency of 2.5 Hz.

[0131] This calculation measures the area of ​​the region where the ion current trajectory (after Bessel filtering) changes as a structure or material passes through the tip of a glass nanopore. Since the data are discrete values ​​and the trajectory is an irregular, non-closed curve, the built-in Matlab function `polyarea` is used to calculate the area of ​​the closed region formed by the ion current trajectory curve during material detection in nanomanipulation.

[0132] Before calculating the area, the range of data needs to be determined. A certain percentage of the baseline change before and after the structure or material enters the glass nanopore is used as the starting point for the structure or material passing through the nanopore tip. Ion current trajectory data, including time and corresponding ion current amplitude, is exported from Clampfit software. The current trajectory starts with a steady current before the structure or material passes through the nanopore tip and ends with a steady current after it leaves the nanopore, with the times arranged in ascending order. Therefore, the data needs to be filtered. A Matlab program is used to calculate the average of the first 10% of the steady-state current data before the structure or material enters the glass nanopore and the last 10% of the steady-state current data after the structure or material leaves the nanopore. These averages are used as baseline current amplitudes, denoted as A and B, respectively. A and B are then multiplied by a certain percentage, denoted as C and D. The data segment from the first 10% of the data to the first value equal to C is deleted. The data segment from the last 10% of the data to the first value of D is also deleted. While deleting data, it is ensured that the time of the final data starts from 0. That is, after removing the beginning and end and taking the middle, the ion current trajectory data of the structure or material from entering to leaving the glass nanopore is obtained.

[0133] Based on the noise of the ion current, a baseline rise of 0.02% before and after the gap enters the glass nanopore was used as the starting point for the gap to pass through the nanopore tip. Using the time and current at the start of the calculation of GAP-1 passing through the glass nanopore as a baseline, the time for GAP-1 to pass through the glass nanopore tip was 23.83 s, the ion current blocking amplitude was 4.49 pA, and ΔI / IO = 0.07%. Figure 3 As shown, the area of ​​the ion current trajectory change region when GAP-1 passes through the tip of the glass nanopore is 4.80. Taking the time and current of GAP-2 passing through the glass nanopore as the starting point for calculation, the time for GAP-2 to pass through the tip of the glass nanopore is 15.98 s, and the ion current blocking amplitude is 3.98 pA. ΔI / IO = 0.06%. Figure 3As shown, the area of ​​the region where the ion current trajectory changes when GAP-2 passes through the tip of the glass nanopore is 6.85. Figure 2 It can be seen that the behavior of Gap through glass nanopores is highly consistent in nanomanipulation detection.

[0134] Nucleic acid detection: A piezoelectric ceramic motor is used to control a glass nanopore to move upwards from the bottom of a double-stranded DNA pore. When the nucleic acid on the double-stranded DNA passes through the tip of the glass nanopore, a distinguishable change occurs in the ion current trajectory, thus enabling the detection of nucleic acid. Nucleic acid is identified by manipulating the glass nanopore.

[0135] Based on the noise of the ion current, a baseline decrease of 0.05% before and after S5AFP and S3AFP enter the glass nanopore was used as the starting point for nucleic acid passage through the nanopore tip. Using the time and current at the start of calculations for S5AFP passing through the glass nanopore as a baseline, the time for S5AFP to pass through the glass nanopore tip was 19.05 s, the ion current blocking amplitude was 13.76 pA, and ΔI / IO = 0.23%. Figure 5 As shown, the area of ​​the ion current trajectory change region when S5AFP passes through the tip of the glass nanopore is 27.64. Taking the initial calculation of the time and current when S3AFP passes through the glass nanopore as a baseline, the time for S3AFP to pass through the tip of the glass nanopore is 26.12 s, the ion current blocking amplitude is 9.87 pA, and ΔI / IO = 0.16%. Figure 10 As shown, the area of ​​the region where the ion current trajectory changes when S3AFP passes through the tip of the glass nanopore is 24.08. Combined with... Figure 9 It can be seen that in nanomanipulation detection, nucleic acids of the same chain length exhibit high consistency when passing through glass nanopores.

[0136] Depend on Figure 11-12 It can be seen that from the time S5AFP completely detaches from the tip of the glass nanopore on the DNA scaffold to the time S3AFP begins to pass through the tip, the time for the double-stranded fragment between the two single strands to pass through the tip of the nanopore is 30.22 seconds; while from the time S3AFP completely detaches from the tip of the glass nanopore to the time the fragment between the entire double-stranded DNA scaffold detaches from the glass nanopore, the time for it to pass through the tip of the nanopore is 60.74 seconds. The time ratio (2.01) is almost consistent with the ratio of the number of base pairs between the two DNA fragments and the fragment from S3AFP to the end of the DNA scaffold (2.01), with an error of about 0%.

[0137] Example 5: Detection of nanomanipulation of S5AFP and S3CEA

[0138] Sample preparation for nanomanipulation detection using S5AFP and S3CEA:

[0139] Mix 1 μL of 2 μM S5AFP (SEQ ID NO:3) solution, 1 μL of 2 μM S3CEA (5'-TCAGCGGATCCAGTGCTTGCCGCGATGACGACCCTCCTCCATACCAGCTTATTCAATT-3': SEQ ID NO:5) solution, 3 μL of 10 nM B4-Gap solution, 1 μL of 10 mM EDTA solution, and 4 μL of 1 PBS solution thoroughly. Incubate at 37°C for 2 hours. Take the solution from the double-stranded DNA scaffold and drop it evenly onto a glass slide. Cover the glass slide with Parafilm sealing film, avoiding and removing air bubbles as much as possible. Incubate at room temperature for 1.5 hours.

[0140] Nanopore capture: Data was recorded using Clampex software in "gap-free" mode. The culture dish with a glass slide was fixed on the sample stage, and the glass nanopore was fixed directly above the glass slide. The patch-clamp system was connected via an Ag / AgCl electrode, with a 300mV bias voltage output at the trans end. The sampling frequency was set to 25kHz, the low-pass filter frequency to 1kHz, the step size of the piezoelectric ceramic motor was set to 1nm / ms, the delay to 100ms, and the actual motor movement speed to 10nm / s. The displacement of the glass nanopore was controlled using nanomanipulation technology, gradually bringing it closer to the glass slide. When the glass nanopore entered the 2M LiCl, 10mM Tris, pH 7.4 buffer solution above the glass slide, the patch-clamp collected a stable ionic current. The distance between the nanopore and the glass slide was controlled to reach a critical point. Then, the nanomanipulation system was used to scan a 5μm × 5μm plane around the critical point until double-stranded DNA was successfully captured.

[0141] Structure identification: A nanomanipulation system was used to slowly move a glass nanopore upwards from the bottom of the double-stranded DNA to identify the DNA structure. After detecting the gap structure, the data was processed, and the time it took for different structures to pass through the nanopore, the amplitude of the ion current change, and the area of ​​the ion current trajectory change region were analyzed.

[0142] The target ion current trajectory was filtered using the built-in Bessel filter in Clampfit software to reduce interference, with a filtering frequency of 2.5 Hz.

[0143] This calculation measures the area of ​​the region where the ion current trajectory (after Bessel filtering) changes as a structure or material passes through the tip of a glass nanopore. Since the data are discrete values ​​and the trajectory is an irregular, non-closed curve, the built-in Matlab function `polyarea` is used to calculate the area of ​​the closed region formed by the ion current trajectory curve during material detection in nanomanipulation.

[0144] Before calculating the area, the range of data needs to be determined. A certain percentage of the baseline change before and after the structure or material enters the glass nanopore is used as the starting point for the structure or material passing through the nanopore tip. Ion current trajectory data, including time and corresponding ion current amplitude, is exported from Clampfit software. The current trajectory starts with a steady current before the structure or material passes through the nanopore tip and ends with a steady current after it leaves the nanopore, with the times arranged in ascending order. Therefore, the data needs to be filtered. A Matlab program is used to calculate the average of the first 10% of the steady-state current data before the structure or material enters the glass nanopore and the last 10% of the steady-state current data after the structure or material leaves the nanopore. These averages are used as baseline current amplitudes, denoted as A and B, respectively. A and B are then multiplied by a certain percentage, denoted as C and D. The data segment from the first 10% of the data to the first value equal to C is deleted. The data segment from the last 10% of the data to the first value of D is also deleted. While deleting data, it is ensured that the time of the final data starts from 0. That is, after removing the beginning and end and taking the middle, the ion current trajectory data of the structure or material from entering to leaving the glass nanopore is obtained.

[0145] Based on the noise of the ion current, a baseline rise of 0.02% before and after the gap enters the glass nanopore was used as the starting point for the gap to pass through the nanopore tip. Using the time and current at the start of the calculation of GAP-1 passing through the glass nanopore as a baseline, the time for GAP-1 to pass through the glass nanopore tip was 23.83 s, the ion current blocking amplitude was 4.49 pA, and ΔI / IO = 0.07%. Figure 3 As shown, the area of ​​the ion current trajectory change region when GAP-1 passes through the tip of the glass nanopore is 4.80. Taking the time and current of GAP-2 passing through the glass nanopore as the starting point for calculation, the time for GAP-2 to pass through the tip of the glass nanopore is 15.98 s, and the ion current blocking amplitude is 3.98 pA. ΔI / IO = 0.06%. Figure 3 As shown, the area of ​​the region where the ion current trajectory changes when GAP-2 passes through the tip of the glass nanopore is 6.85. Figure 2 It can be seen that the behavior of Gap through glass nanopores is highly consistent in nanomanipulation detection.

[0146] Nucleic acid detection: A piezoelectric ceramic motor is used to control a glass nanopore to move upwards from the bottom of a double-stranded DNA pore. When the nucleic acid on the double-stranded DNA passes through the tip of the glass nanopore, a distinguishable change occurs in the ion current trajectory, thus enabling the detection of nucleic acid. Nucleic acid is identified by manipulating the glass nanopore.

[0147] Based on the noise of the ion current, a baseline decrease of 0.01% before and after S5AFP and S3AFP enter the glass nanopore was used as the starting point for nucleic acid passage through the nanopore tip. Using the time and current at the start of calculations for S5AFP passing through the glass nanopore as a baseline, the time for S5AFP to pass through the glass nanopore tip was 29.31 s, the ion current blocking amplitude was 5.87 pA, and ΔI / IO = 0.11%. Figure 7 As shown, the area of ​​the ion current trajectory change region when S5AFP passes through the tip of the glass nanopore is 66.01. Taking the initial calculation of the time and current when S3CEA passes through the glass nanopore as a baseline, the time for S3CEA to pass through the tip of the glass nanopore is 27.19 s, the ion current blocking amplitude is 2.86 pA, and ΔI / IO = 0.05%. Figure 14 As shown, the area of ​​the region where the ion current trajectory changes when S3CEA passes through the tip of the glass nanopore is 34.56. Combined with... Figure 13 It can be seen that in nanomanipulation detection, nucleic acids of different chain lengths can be well distinguished when passing through glass nanopores.

[0148] Depend on Figure 15-16 It can be seen that from the time S5AFP completely detaches from the tip of the glass nanopore on the DNA scaffold to the time S3CEA begins to pass through the tip, the time for the two double-stranded fragments to pass through the tip of the nanopore is 16.99 seconds; while the time for the fragment between the time S3CEA completely detaches from the tip of the glass nanopore and the time between the time S3CEA completely detaches from the tip of the glass nanopore is 37.22 seconds. The time ratio (2.19) is significantly different from the ratio of the number of base pairs of the DNA fragment between the two single strands to the number of base pairs of the fragment from S3CEA to the end of the DNA scaffold (2.01), with an error of about 9.6%. This may be due to the different morphologies of S5AFP and S3CEA in solution.

[0149] Based on data from the nanomanipulation of gap structures and nucleic acids, it is inferred that the time of ion current trajectory can serve as a reference for the travel distance of a piezoelectric ceramic motor. When double-stranded DNA is captured at the tip of a glass nanopore, it cannot be guaranteed that the DNA remains in a position perpendicular to the glass substrate within the nanopore. However, when structures or substances on the DNA pass through the tip of the glass nanopore, the time of change in its ion current trajectory shows a certain positive correlation with the size of the structures or substances on the DNA and the distance between different structures or substances.

[0150] Example 6: Nanomanipulation Detection of Double-Stranded DNA Scaffolds Containing Gap and S3-81

[0151] Nanomanipulation revealed that Gap1 was a blank sequence, while Gap2 contained a 114 nt S3-81 double-stranded DAN scaffold. The sequence of S3-81 is as follows:

[0152] TCAGCGGATCCAGTGCTTGCCGCGATGACGACCTCCTCCATACCATCTTATTCAATTCTCCCTCCATACCATCTTATTCAATTCTCCCTCCATACCAGCTTATTCAATTCTTCT (SEQ ID NO: 12);

[0153] Using a baseline increase of 0.05% before and after gap entry into the glass nanopore as a benchmark, the starting point for gap passage through the nanopore tip was determined. MATLAB was used to analyze data from four gap passages through the glass nanopore, showing an ion current increase of 11.5767 ± 2.8737 pA, I / I O The value is 0.0011±0.0003, and the via time is 18.2908±6.1551s.

[0154] Using a baseline decrease of 0.05% before and after S3-81nt entry into the glass nanopore as a benchmark, the starting points for S3-81nt passage through the nanopore tip were determined. MATLAB was used to analyze data from four passages of 81nt single-chain ions through the glass nanopore, showing a decrease in ion current of 48.4086 ± 1.1897 pA, I / I O The value was 0.0046±0.0001, and the via time was 25.6787±4.2370s, showing good consistency and repeatability.

[0155] The area of ​​the region where the ion current trajectory changes each time Gap and S3-81 pass through the glass nanopore is as follows: Figure 19-23 As shown, the area fluctuates significantly due to the influence of baseline noise.

[0156] By combining ion current trajectory and through-pore data analysis, we demonstrated that nanomanipulation has high consistency and repeatability for nucleic acid detection on the same double-stranded DNA scaffold, proving the effectiveness of nanomanipulation for repeated detection of single molecules.

[0157] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A nucleic acid detection system based on glass nanopores and nanomanipulation, characterized by: The nucleic acid detection system includes a DNA chip and a glass nanopore. The glass surface of the DNA chip is connected to double-Gap double-stranded DNA, and the double-Gap double-stranded DNA contains two segments of Gap single-stranded sequences. The Gap single-stranded sequences bind to the nucleic acid to be tested through base complementary pairing. The inner wall diameter of the glass nanopore is 10-17nm. The glass nanopore is connected to the positive electrode of the patch clamp, and the nanopore is filled with an electrolyte buffer solution. The negative electrode is placed in the DNA chip solution. The glass nanopore is moved by a nanomanipulation platform to capture and detect the double-Gap double-stranded DNA.

2. The nucleic acid detection system based on glass nanopore and nanomanipulation according to claim 1, characterized in that: The nucleic acid sequence of the double-Gap double-stranded DNA is shown in SEQ ID NO: 2, and the nucleic acid sequences of the Gap complementary strands are shown in SEQ ID NO: 6 and SEQ ID NO:

7.

3. The method for preparing a nucleic acid detection system based on glass nanopores and nanomanipulation according to claim 1 or 2, characterized in that: The steps are as follows: S1: Using circular plasmid PET28-N809 as a template, PCR amplification was performed using a biotin-labeled primer pair to obtain biotin-labeled double-stranded DNA; S2: using Nt.BbvCI enzyme to digest the biotin-labeled double-stranded DNA to form a single-stranded nick at the 5'-CCTCAGC-3' site, and then adding the Gap complementary chain described in claim 2 to promote the shedding of the short chain to generate double-stranded DNA containing double Gap; S3: After the enzyme digestion in step S2, BamHI enzyme was added to double-strand the undigested double-stranded DNA for double-strand cut, and the digestion was carried out at 37°C for 1 hour; S4: Separate and purify double-gap double-stranded DNA by electrophoresis; S5: The glass sheet of the DNA chip is modified with PEG and streptavidin, the 3' or 5' end of the double-Gap double-stranded DNA is modified with biotin, and the double-Gap double-stranded DNA is fixed on the surface of the glass sheet through the specific binding of streptavidin and biotin.

4. The method for preparing a nucleic acid detection system based on glass nanopores and nanomanipulation according to claim 3, characterized in that: In step S1, the biotin-labeled primer pair is primer 1 and primer 2; or primer 3 and primer 4; The nucleic acid sequence of primer 1 is shown in SEQ ID NO: 8, the nucleic acid sequence of primer 2 is shown in SEQ ID NO: 9, and the 5' end of primer 2 is biotin-labeled; the nucleic acid sequence of primer 3 is shown in SEQ ID NO: 10, the nucleic acid sequence of primer 4 is shown in SEQ ID NO: 11, and the 5' end of primer 4 is biotin-labeled.

5. The method for preparing a nucleic acid detection system based on glass nanopores and nanomanipulation according to claim 3, characterized in that: The reaction conditions in step S2 are: 37°C, 3 hours; 90°C, 1 minute; 72°C, 5 minutes; 55°C, 5 minutes; 37°C, 20 minutes; 90°C to 37°C for a total of 4 cycles.

6. The method for preparing a nucleic acid detection system based on glass nanopores and nanomanipulation according to claim 3, Its characteristics are: The nucleic acid sequence of the plasmid PET28-N809 is shown in SEQ ID NO:

1.

7. Use of the nucleic acid detection system based on glass nanopore and nanomanipulation according to claim 1 or 2 in detecting nucleic acids.

8. Use of the nucleic acid detection system based on glass nanopore and nanomanipulation in nucleic acid detection according to claim 7, characterized in that: The nucleic acid is any one of double-stranded DNA, single-stranded DNA, and RNA.

9. Use of the nucleic acid detection system based on glass nanopore and nanomanipulation in nucleic acid detection according to claim 8, characterized in that: The nucleic acid sequence of the nucleic acid is shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 12.

Images