Lung adenocarcinoma methylation marker combination, lung adenocarcinoma detection kit and application thereof

Abstract

The invention provides a lung adenocarcinoma methylation marker combination. The lung adenocarcinoma methylation marker combination is composed of ALX3, HOXD13, SLC66A1 and MICOS10. The invention also provides a lung adenocarcinoma detection kit. The kit comprises a lung adenocarcinoma detection reagent capable of specifically detecting the methylation level of CpG dinucleotide sites in the nucleotide sequences of partial regions of the nucleotide sequences of the four target genes ALX3, HOXD13, SLC66A1 and MICOS10 in a biological sample. Lung adenocarcinoma is detected and diagnosed through combined methylation detection of a plurality of lung adenocarcinoma methylation detection markers, the accuracy of lung adenocarcinoma detection is improved, and a new strategy and method are provided for early diagnosis of lung adenocarcinoma.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a marker combination for lung adenocarcinoma methylation detection and a lung adenocarcinoma detection kit. Background Art

[0002] Lung adenocarcinoma is one of the main types of non-small cell lung cancer (NSCLC), accounting for approximately 40% of lung cancer cases. Lung cancer is one of the most morbid and mortality-prone malignancies worldwide. Lung adenocarcinoma is highly invasive and metastatic, and most patients are diagnosed in the advanced stage, resulting in an extremely poor prognosis. Therefore, early diagnosis and accurate prognostic assessment are crucial for improving patient survival and therapeutic outcomes.

[0003] Currently, the diagnosis of lung adenocarcinoma relies primarily on imaging studies (such as CT and PET-CT) and histopathology. While imaging studies can detect lung nodules or tumors, they struggle to distinguish between benign and malignant lesions, and the detection rate for early-stage microtumors is low. Histopathology, the gold standard for diagnosing lung adenocarcinoma, requires invasive procedures (such as biopsy or surgical resection), carries certain risks and complications, and its application is limited for patients with early-stage microtumors or when insufficient tissue can be obtained.

[0004] In recent years, liquid biopsy technologies (such as circulating tumor cells (CTCs) and circulating tumor DNA (ctDNA) detection in the blood) have become a research hotspot. However, their application in the early diagnosis and prognostic assessment of lung adenocarcinoma still faces challenges. For example, the sensitivity and specificity of ctDNA detection in early lung cancer are low, and the testing cost is high. While CTC detection technology has considerable potential, it still faces technical bottlenecks in clinical application, making large-scale implementation difficult.

[0005] DNA methylation is an important epigenetic modification involved in gene expression regulation and cell differentiation. In recent years, with the advancement of epigenetic research, the application of DNA methylation markers in early tumor diagnosis and prognostic assessment has gradually attracted attention. Studies have shown that the promoter regions of multiple genes are abnormally methylated in lung adenocarcinoma. Therefore, the early screening and diagnosis of lung adenocarcinoma by detecting abnormal DNA methylation is a new research and development direction for lung adenocarcinoma diagnostic technology. Summary of the Invention

[0006] In view of the existing technology, the purpose of the present invention is to provide a lung adenocarcinoma methylation marker combination and a lung adenocarcinoma detection kit. Several genes in the marker combination are closely related to the occurrence, development and prognosis of lung adenocarcinoma. The provided detection kit has high sensitivity and high specificity for detecting several genes in the marker combination. By jointly detecting the methylation levels of multiple genes, the readiness and detection rate of early screening for lung adenocarcinoma are significantly improved.

[0007] To achieve the purpose of the invention, the technical solutions provided by the present invention are as follows: The present invention provides a lung adenocarcinoma methylation marker combination, characterized in that the lung adenocarcinoma methylation marker combination consists of ALX3, HOXD13, SLC66A1 and MICOS10.

[0008] The present invention also provides use of the lung adenocarcinoma methylation marker combination ALX3, HOXD13, SLC66A1 and MICOS10 in preparing a lung adenocarcinoma detection kit.

[0009] The present invention provides a lung adenocarcinoma detection kit, characterized in that the kit includes a lung adenocarcinoma detection reagent capable of specifically detecting the methylation level of CpG dinucleotide sites in the nucleotide sequence of a partial region of the nucleotide sequence of four target genes ALX3, HOXD13, SLC66A1, and MICOS10 in a biological sample, wherein the lung adenocarcinoma detection reagent includes: (1) an ALX3 PCR reaction solution for specifically detecting ALX3, wherein the ALX3 PCR reaction solution comprises an ALX3 forward primer having a nucleotide sequence as shown in SEQ ID No. 1, an ALX3 reverse primer having a nucleotide sequence as shown in SEQ ID No. 2, an ALX3 methylation probe having a nucleotide sequence as shown in SEQ ID No. 3, and an ALX3 unmethylation probe having a nucleotide sequence as shown in SEQ ID No. 4; (2) A HOXD13 PCR reaction solution for specifically detecting HOXD13, wherein the HOXD13 PCR reaction solution includes a HOXD13 forward primer having a nucleotide sequence as shown in SEQ ID No. 5, a HOXD13 reverse primer having a nucleotide sequence as shown in SEQ ID No. 6, a HOXD13 methylation probe having a nucleotide sequence as shown in SEQ ID No. 7, and a HOXD13 unmethylation probe having a nucleotide sequence as shown in SEQ ID No. 8; (3) a SLC66A1 PCR reaction solution for specifically detecting SLC66A1, wherein the SLC66A1 PCR reaction solution comprises a SLC66A1 forward primer having a nucleotide sequence as shown in SEQ ID No. 9, a SLC66A1 reverse primer having a nucleotide sequence as shown in SEQ ID No. 10, a SLC66A1 methylation probe having a nucleotide sequence as shown in SEQ ID No. 11, and a SLC66A1 unmethylation probe having a nucleotide sequence as shown in SEQ ID No. 12; (4) A MICOS10 PCR reaction solution for specifically detecting MICOS10, wherein the MICOS10 PCR reaction solution includes a MICOS10 forward primer having a nucleotide sequence as shown in SEQ ID No. 13, a MICOS10 reverse primer having a nucleotide sequence as shown in SEQ ID No. 14, a MICOS10 methylation probe having a nucleotide sequence as shown in SEQ ID No. 15, and a MICOS10 non-methylation probe having a nucleotide sequence as shown in SEQ ID No. 16.

[0010] The ALX3 PCR reaction solution, HOXD13 PCR reaction solution, SLC66A1 PCR reaction solution, and MICOS10 PCR reaction solution also include an internal reference GAPDH forward primer with a nucleotide sequence as shown in SEQ ID No. 17, an internal reference GAPDH reverse primer with a nucleotide sequence as shown in SEQ ID No. 18, and an internal reference GAPDH probe with a nucleotide sequence as shown in SEQ ID No. 19.

[0011] The lung adenocarcinoma detection reagent is characterized in that the components of the ALX3 PCR reaction solution, the HOXD13 PCR reaction solution, the SLC66A1 PCR reaction solution, and the MICOS10 PCR reaction solution are respectively composed as follows: The ALX3 PCR reaction solution includes 0.2-0.5 μmol / L each of ALX3 forward and reverse primers, 0.1-0.5 μmol / L each of ALX3 methylation probe and unmethylation probe, 0.2-0.5 μmol / L of internal reference GAPDH forward and reverse primers, 0.1-0.5 μmol / L of internal reference GAPDH probe, PCR buffer, 2-8 mmol / L of MgCl2, 0.2-0.4 mmol / L of dNTP, and 200-1000 U / ml of Taq enzyme. The HOXD13 PCR reaction solution includes 0.2-0.5 μmol / L each of HOXD13 forward and reverse primers, 0.1-0.5 μmol / L each of HOXD13 methylation probe and unmethylation probe, 0.2-0.5 μmol / L each of internal reference GAPDH forward and reverse primers, 0.1-0.5 μmol / L of internal reference GAPDH probe, PCR buffer, 2-8 mmol / L of MgCl2, 0.2-0.4 mmol / L of dNTP, and 200-1000 U / ml of Taq enzyme; The SLC66A1 PCR reaction solution includes 0.2-0.5 μmol / L each of SLC66A1 forward and reverse primers, 0.1-0.5 μmol / L each of SLC66A1 methylation probe and unmethylation probe, 0.2-0.5 μmol / L each of internal reference GAPDH forward and reverse primers, 0.1-0.5 μmol / L of internal reference GAPDH probe, PCR buffer, 2-8 mmol / L MgCl2, 0.2-0.4 mmol / L dNTP, and 200-1000 U / ml of Taq enzyme; The MICOS10 PCR reaction solution includes 0.2-0.5 μmol / L of MICOS10 forward and reverse primers, 0.1-0.5 μmol / L of MICOS10 methylation probe and unmethylation probe, 0.2-0.5 μmol / L of internal reference GAPDH forward and reverse primers, 0.1-0.5 μmol / L of internal reference GAPDH probe, PCR buffer, 2-8 mmol / L of MgCl2, 0.2-0.4 mmol / L of dNTP, and 200-1000 U / ml of Taq enzyme.

[0012] The lung adenocarcinoma detection kit also includes a positive control and a negative control. The positive control is selected from the DNA of human lung adenocarcinoma cell QBC939; the negative control is sterile water.

[0013] The lung adenocarcinoma detection kit also includes droplet-generating oil.

[0014] The NCBI database number of the ALX3 gene sequence involved in the present invention is NC_000001.11, the NCBI database number of the HOXD13 gene sequence is NC_000002.12, the NCBI database number of the SLC66A1 gene sequence is NC_000001.11, and the NCBI database number of the MICOS10 gene sequence is NC_000001.11.

[0015] The main reagent compositions and components of the lung adenocarcinoma detection kit provided by the present invention are shown in Table 1 below.

[0016] Table 1. Lung Adenocarcinoma Detection Kit Description Reagents Main ingredients Specification ALX3 PCR reaction solution <![CDATA[Forward and reverse primers for ALX3, methylated and unmethylated probes for ALX3, forward and reverse primers for internal reference GAPDH, probe for internal reference GAPDH, PCR buffer, dNTP, MgCl2 and Taq enzyme]]> 400uL HOXD13 PCR reaction solution <![CDATA[HOXD13 forward and reverse primers, HOXD13 methylation and unmethylation probes, reference GAPDH forward and reverse primers, reference GAPDH probe, PCR buffer, dNTP, MgCl2 and Taq enzyme]]> 400uL SLC66A1 PCR reaction solution <![CDATA[SLC66A1 forward and reverse primers, SLC66A1 methylated and unmethylated probes, internal reference GAPDH forward and reverse primers, internal reference GAPDH probe, PCR buffer, dNTP, MgCl2 and Taq enzyme]]> 400uL MICOS10 PCR reaction solution <![CDATA[Forward and reverse primers for MICOS10, methylated and unmethylated probes for MICOS10, forward and reverse primers for internal reference GAPDH, probe for internal reference GAPDH, PCR buffer, dNTP, MgCl2 and Taq enzyme]]> 400uL Droplet-generating oil Droplet-generating oil 150uL Positive control QBC939 DNA 50uL Negative control Sterile water 50uL The nucleotide sequences of the primers and probes for the target gene and the internal reference gene involved in the lung adenocarcinoma detection reagent of the present invention are shown in Table 2 below.

[0017] Table 2: Nucleotide sequences involved in lung adenocarcinoma detection reagents sequence name Oligonucleotide sequence 5'-3' serial number ALX3 forward primer CGGCGCGGGTAGCGCGA SEQ ID No. 1 ALX3 reverse primer CCTACAAATACTTAACGAACG SEQ ID No. 2 ALX3 methylation probe TTTTCGTCGTTGCGTTTTATT SEQ ID No. 3 ALX3 unmethylated probe CCCCCGCCGCTGCGCCTCACC SEQ ID No. 4 HOXD13 forward primer GGCGAAGTGCGGTTTTTACG SEQ ID No. 5 HOXD13 reverse primer CGTAAAAACCGCACTTCGCC SEQ ID No. 6 HOXD13 methylation probe CGTCGTAATTTCGCGTTTTACG SEQ ID No. 7 HOXD13 unmethylated probe CGTCGCAATCCCGCGCCCCACG SEQ ID No. 8 SLC66A1 forward primer GCGTGATGATGGTAACGAAGGGG SEQ ID No. 9 SLC66A1 reverse primer CTAAACCTATCCCCAACCGTA SEQ ID No. 10 SLC66A1 methylation probe TTTTAAGGGAAGGAGAGTGGGGGAAAGGA SEQ ID No. 11 SLC66A1 unmethylated probe CTCCCAAGGGAAGGAGAGTGGGGAAAGGA SEQ ID No. 12 MICOS10 forward primer ACGGTCGTATGTTATTGCGTT SEQ ID No. 13 MICOS10 reverse primer TGTATGTGTATGTGTGTGTGTGTGT SEQ ID No. 14 MICOS10 methylation probe TTGTATTGTATTTTAAATTTTGTATTA SEQ ID No. 15 MICOS10 unmethylated probe TTGTACTGTATTTTAAATTTTGCATTA SEQ ID No. 16 GAPDH forward primer TATCGATTATTTTTTATCGGGTTAATT SEQ ID No. 17 GAPDH reverse primer TTCTCCCCGCTTTTTTTTTTCCG SEQ ID No. 18 GAPDH probe TACGTTCGGTGCGTGTTTAGTTG SEQ ID No. 19 The ends of the ALX3 methylation probe and unmethylation probe, HOXD13 methylation probe and unmethylation probe, SLC66A1 methylation probe and unmethylation probe, MICOS10 methylation probe and unmethylation probe, and GAPDH probe are respectively labeled with a fluorescent reporter group and a fluorescent quencher group, wherein the methylation probe and unmethylation probe of the target gene and the internal reference probe are respectively labeled with different fluorescent reporter groups, and the fluorescent reporter group is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3, and CY5; the fluorescent quencher group is selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, and DABCYL.

[0018] The use of the lung adenocarcinoma methylation marker combination and the lung adenocarcinoma detection kit of the present invention in gene methylation detection comprises the following steps: S1. Extracting the test sample DNA, and subjecting the test sample DNA to bisulfite conversion treatment to deaminize the unmethylated cytosine in the nucleic acid of the target gene in the test sample and convert it into uracil, thereby obtaining a purified Bis-DNA sample; S2. Using the purified Bis-DNA sample as a template, prepare target gene PCR reaction systems with ALX3 PCR reaction solution, HOXD13 PCR reaction solution, SLC66A1 PCR reaction solution, and MICOS10 PCR reaction solution, respectively. PCR amplification and target gene methylation level detection were performed using a droplet digital PCR instrument on the four prepared target gene PCR reaction systems.

[0019] Determination of the target gene methylation level detection results in step S2 above: If the total droplet count of the test sample is greater than 10,000, the reaction is considered valid. If the sum of the methylated copy number and the unmethylated copy number of the test sample is ≥100, the test result of the sample is valid. If it is less than 100, the sample test is invalid and needs to be retested. The methylation ratio of the test sample was calculated by the following formula: methylation ratio = methylated copy number / [(methylated copy number + unmethylated copy number)] × 100%. If the methylation ratio of the target gene is ≥ 2%, the result is methylation-positive; if the methylation ratio of the target gene is < 2%, the result is methylation-negative. When any of the four target genes ALX3, HOXD13, SLC66A1, and MICOS10 is methylated positive, the test sample is judged to be positive for cancer; when all four target genes ALX3, HOXD13, SLC66A1, and MICOS10 are methylated negative, the test sample is judged to be negative for cancer.

[0020] By performing methylation detection and comprehensive judgment on four target genes, new strategies and tools are provided for the early diagnosis, prognosis assessment and personalized treatment of lung adenocarcinoma.

[0021] Beneficial effects of the present invention The present invention provides a lung adenocarcinoma methylation marker combination and a lung adenocarcinoma detection kit. The marker combination is composed of four genes ALX3, HOXD13, SLC66A1 and MICOS10 that are methylated and overexpressed in lung adenocarcinoma. The lung adenocarcinoma detection kit contains a lung adenocarcinoma detection reagent that can specifically detect the methylation levels of the four target genes in a biological sample. The detection reagent has high specificity and high sensitivity to the target genes.

[0022] The lung adenocarcinoma detection reagent provided by the present invention is used with the sample DNA converted by bisulfite to perform a PCR amplification reaction of the target gene, and the screening results of lung adenocarcinoma are comprehensively judged by the combined detection of methylation of the four target genes. The four target genes are all closely related to the progression of lung adenocarcinoma. The methylation detection region of each target gene contains multiple CpGs, which reduces the randomness of base changes relative to the detection of a single base, effectively supplements the differences that may be caused by site selection and reaction system, and significantly improves the accuracy and specificity of lung adenocarcinoma screening. The combined detection of methylation of the four target genes reduces the false negative and false positive rates of single marker detection and improves the sensitivity and specificity of detection.

[0023] This non-invasive gene methylation test utilizes liquid biopsy technology to measure DNA methylation levels in blood or other body fluids, avoiding the invasiveness and risks of traditional tissue biopsies. Utilizing PCR technology, the test offers high throughput and low cost, making it suitable for large-scale clinical applications.

[0024] In summary, the lung adenocarcinoma methylation marker combination provided by the present invention can serve as a marker for early diagnosis and prognostic assessment of lung adenocarcinoma, providing an important reference for clinical treatment. The provided lung adenocarcinoma detection reagent has high specificity and sensitivity for the target gene. The provided combined gene methylation detection is an efficient, accurate, and non-invasive method for lung adenocarcinoma detection, and is expected to provide new strategies and tools for early diagnosis, prognostic assessment, and personalized treatment of lung adenocarcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 . This is the positive result and negative amplification result of the target gene methylation in Example 2 of the present invention; Figure 2 . Comparison of the ROC curves of the test results of Example 2 of the present invention and the pathological test results.

[0026] Figure 33 target gene methylation positive amplification results and negative amplification results of Example 3 of the present invention; Figure 4 . The ROC curve comparison of the test results of Example 3 of the present invention and the pathological test results; Figure 5 . is a comparison matrix between the test results of Example 3 of the present invention and the pathological test results. DETAILED DESCRIPTION

[0027] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Example 1

[0028] The present invention provides a lung adenocarcinoma methylation marker combination, characterized in that the lung adenocarcinoma methylation marker combination consists of ALX3, HOXD13, SLC66A1 and MICOS10.

[0029] The present invention also provides use of the lung adenocarcinoma methylation marker combination ALX3, HOXD13, SLC66A1 and MICOS10 in preparing a lung adenocarcinoma detection kit.

[0030] The present invention provides a lung adenocarcinoma detection kit, characterized in that the kit comprises a lung adenocarcinoma detection reagent capable of specifically detecting the methylation level of CpG dinucleotide sites in the nucleotide sequence of a partial region of the nucleotide sequence of four target genes ALX3, HOXD13, SLC66A1 and MICOS10 in a biological sample.

[0031] The lung adenocarcinoma detection kit also includes a positive control and a negative control. The positive control is selected from the DNA of human lung adenocarcinoma cell QBC939; the negative control is sterile water.

[0032] The lung adenocarcinoma detection kit also includes droplet generation oil, which is purchased from Bio-rad in the United States.

[0033] The main reagent composition and reagent components in the lung adenocarcinoma detection kit provided by the present invention are shown in Table 1.

[0034] The lung adenocarcinoma detection reagent provided by the present invention includes ALX3 PCR reaction solution, HOXD13 PCR reaction solution, SLC66A1 PCR reaction solution, and MICOS10 PCR reaction solution. The components of the above four reagents are as follows: (1) ALX3 PCR reaction solution, including ALX3 forward and reverse primers 0.2-0.5 μmol / L each, ALX3 methylation probe and unmethylation probe 0.1-0.5 μmol / L each, internal reference GAPDH forward and reverse primers 0.2-0.5 μmol / L, internal reference GAPDH probe 0.1-0.5 μmol / L, PCR buffer, MgCl2 2-8 mmol / L, dNTP 0.2-0.4 mmol / L, Taq enzyme 200-1000 U / ml; (2) HOXD13 PCR reaction solution, including HOXD13 forward and reverse primers 0.2-0.5 μmol / L each, HOXD13 methylation probe and unmethylation probe 0.1-0.5 μmol / L each, internal reference GAPDH forward and reverse primers 0.2-0.5 μmol / L each, internal reference GAPDH probe 0.1-0.5 μmol / L, PCR buffer, MgCl2 2-8 mmol / L, dNTP 0.2-0.4 mmol / L, Taq enzyme 200-1000 U / ml; (3) SLC66A1 PCR reaction solution, including SLC66A1 forward and reverse primers 0.2-0.5 μmol / L each, SLC66A1 methylation probe and unmethylation probe 0.1-0.5 μmol / L each, internal reference GAPDH forward and reverse primers 0.2-0.5 μmol / L each, internal reference GAPDH probe 0.1-0.5 μmol / L, PCR buffer, MgCl2 2-8 mmol / L, dNTP 0.2-0.4 mmol / L, Taq enzyme 200-1000 U / ml; (4) MICOS10 PCR reaction solution, including MICOS10 forward and reverse primers 0.2~0.5μmol / L each, MICOS10 methylation probe and non-methylation probe 0.1~0.5μmol / L each, internal reference GAPDH forward and reverse primers 0.2~0.5μmol / L each, internal reference GAPDH probe 0.1~0.5μmol / L, PCR buffer, MgCl2 2~8mmol / L, dNTP 0.2~0.4mmol / L, Taq enzyme 200~1000U / ml.

[0035] Referring to Table 2, the lung adenocarcinoma detection reagent provided by the present invention includes the ALX3 PCR reaction solution, the base sequence of the ALX3 forward primer is shown in SEQ ID No. 1; the base sequence of the ALX3 reverse primer is shown in SEQ ID No. 2; the base sequence of the ALX3 methylation probe is shown in SEQ ID No. 3; and the base sequence of the ALX3 unmethylation probe is shown in SEQ ID No. 4. The HOXD13 PCR reaction solution, wherein the base sequence of the HOXD13 forward primer is shown in SEQ ID No. 5; the base sequence of the HOXD13 reverse primer is shown in SEQ ID No. 6; the base sequence of the HOXD13 methylation probe is shown in SEQ ID No. 7; and the base sequence of the HOXD13 unmethylation probe is shown in SEQ ID No. 8; The SLC66A1 PCR reaction solution includes the SLC66A1 forward primer having a base sequence as shown in SEQ ID No. 9; the SLC66A1 reverse primer having a base sequence as shown in SEQ ID No. 10; the SLC66A1 methylation probe having a base sequence as shown in SEQ ID No. 11; and the SLC66A1 unmethylation probe having a base sequence as shown in SEQ ID No. 12. The MICOS10 PCR reaction solution, wherein the base sequence of the MICOS10 forward primer is shown in SEQ ID No. 13; the base sequence of the MICOS10 reverse primer is shown in SEQ ID No. 14; the base sequence of the MICOS10 methylation probe is shown in SEQ ID No. 15; and the base sequence of the MICOS10 unmethylation probe is shown in SEQ ID No. 16; The base sequence of the internal reference GAPDH forward primer in the ALX3 PCR reaction solution, HOXD13 PCR reaction solution, SLC66A1 PCR reaction solution, and MICOS10 PCR reaction solution is shown in SEQ ID No. 17; the base sequence of the internal reference GAPDH reverse primer is shown in SEQ ID No. 18; and the base sequence of the internal reference GAPDH probe is shown in SEQ ID No. 19.

[0036] The nucleotide sequences of the primers and probes for the target gene and the internal reference gene involved in the lung adenocarcinoma detection reagent of the present invention are shown in Table 2.

[0037] The ALX3 PCR reaction solution, HOXD13 PCR reaction solution, SLC66A1 PCR reaction solution, and MICOS10 PCR reaction solution may contain a Taq DNA polymerase commonly used in the art. The PCR buffer, MgCl2, and dNTPs contained in the reaction solution may have varying amounts without significantly affecting the experimental results. Therefore, commercially available products commonly used in the art or custom-prepared solutions may be used. For example, the PCR buffer may be a conventional buffer containing 30-60 mmol / L Tris and 10-50 mmol / L KCl, 30-600 mmol / L Tris and 10-50 mmol / L KAc, or 30-60 mmol / L Tris and 10-50 mmol / L CsCl. These differences in amount do not significantly affect the reagents and test results described herein.

[0038] The ends of the ALX3 methylation probe and unmethylation probe, HOXD13 methylation probe and unmethylation probe, SLC66A1 methylation probe and unmethylation probe, MICOS10 methylation probe and unmethylation probe, and GAPDH probe are respectively labeled with a fluorescent reporter group and a fluorescent quencher group, wherein the methylation probe and unmethylation probe of the target gene and the internal reference probe are respectively labeled with different fluorescent reporter groups, and the fluorescent reporter group is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3, and CY5; the fluorescent quencher group is selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, and DABCYL.

[0039] A specific embodiment of the fluorescent reporter group and the fluorescent quencher group labeled at both ends of each probe in the ALX3 PCR reaction solution, HOXD13 PCR reaction solution, SLC66A1 PCR reaction solution, and MICOS10 PCR reaction solution of the present invention is shown in the following table: Probe Name 5' end fluorescent reporter group 3' end fluorescence quencher ALX3 methylation probe FAM BHQ1 ALX3 unmethylated probe VIC BHQ1 HOXD13 methylation probe FAM BHQ1 HOXD13 unmethylated probe VIC BHQ1 SLC66A1 methylation probe FAM BHQ1 SLC66A1 unmethylated probe VIC BHQ1 MICOS10 methylation probe FAM BHQ1 MICOS10 unmethylated probe VIC BHQ1 Internal reference GAPDH probe ROX BHQ1 The ALX3 PCR reaction solution, HOXD13 PCR reaction solution, SLC66A1 PCR reaction solution, and MICOS10 PCR reaction solution provided by the present invention contain specific primers and fluorescent probes for the target genes, have high specificity and sensitivity for the target genes, and can perform rapid methylation detection on the target genes in the test samples.

[0040] The use of the lung adenocarcinoma methylation marker combination and the lung adenocarcinoma detection kit of the present invention in gene methylation detection comprises the following steps: S1. Extract the test sample DNA, and treat the test sample DNA with bisulfite to deaminize the unmethylated cytosine in the nucleic acid of the target gene in the test sample and convert it into uracil, thereby obtaining a purified Bis-DNA sample.

[0041] S1.1. Extract DNA from test samples: Extract DNA from human fecal exfoliated cells. After extraction, use a Nano-500 micro-spectrophotometer to measure the DNA concentration and OD260 / OD280. The OD260 / OD280 ratio should be between 1.7 and 2.0.

[0042] S1.2. Treat the test sample DNA with bisulfite to obtain a purified Bis-DNA sample. The Bis-DNA sample should be tested promptly or stored at -20°C for testing. The storage period generally does not exceed 4 months. If it exceeds 4 months, it should be stored at -80°C.

[0043] S2. Using the purified Bis-DNA sample as a template, prepare target gene PCR reaction systems with ALX3 PCR reaction solution, HOXD13 PCR reaction solution, SLC66A1 PCR reaction solution, and MICOS10 PCR reaction solution, respectively. PCR amplification and target gene methylation level detection were performed using a droplet digital PCR instrument on the four prepared target gene PCR reaction systems.

[0044] S2.1. Preparation of target gene PCR reaction system ALX3 gene PCR reaction system components: ALX3 PCR reaction solution volume 15 uL, Bis-DNA template volume 3-5 uL, purified water up to volume 20 uL; The HOXD13 gene PCR reaction system consists of the following components: HOXD13 PCR reaction solution (15 μL), Bis-DNA template (3-5 μL), and purified water (up to 20 μL). The SLC66A1 gene PCR reaction system consists of the following components: SLC66A1 PCR reaction solution (15 μL), Bis-DNA template (3-5 μL), and purified water (up to 20 μL). MICOS10 gene PCR reaction system components: MICOS10 PCR reaction volume 15 μL, Bis-DNA template volume 3-5 μL, purified water up to a volume of 20 μL; According to the components of the above four reaction systems, four target gene PCR reaction systems were prepared in test tubes, with the volume of each reaction system being 20 uL.

[0045] S2.2. Target gene PCR amplification and methylation level detection The four prepared target gene PCR reaction systems were used to perform PCR amplification reactions and target gene methylation level detection using a droplet digital PCR instrument.

[0046] When using a droplet digital PCR instrument to perform related operations, the fluorescence detection channel, amplification cycle parameters, etc. are selected or set accordingly as needed.

[0047] In the above step S2, the target gene methylation level detection result is determined as follows: If the total droplet count of the test sample is greater than 10,000, the reaction is considered valid. If the sum of the methylated copy number and the unmethylated copy number of the test sample is ≥100, the test result of the sample is valid. If it is less than 100, the sample test is invalid and needs to be retested. The methylation ratio of the test sample was calculated by the following formula: methylation ratio = methylated copy number / [(methylated copy number + unmethylated copy number)] × 100%. If the methylation ratio of the target gene is ≥ 2%, the result is methylation-positive; if the methylation ratio of the target gene is < 2%, the result is methylation-negative. When any of the four target genes ALX3, HOXD13, SLC66A1, and MICOS10 is methylated positive, the test sample is judged to be positive for cancer. When all four target genes ALX3, HOXD13, SLC66A1, and MICOS10 are methylated negative, the test sample is judged to be negative for cancer.

[0048] By performing methylation detection and comprehensive judgment on four target genes, new strategies and tools are provided for the early diagnosis, prognosis assessment and personalized treatment of lung adenocarcinoma.

[0049] Example 2 Example 2 is an application experiment of the lung adenocarcinoma methylation marker combination and lung adenocarcinoma detection kit of the present invention.

[0050] This experiment used the method provided by the application of the lung adenocarcinoma methylation marker combination and the lung adenocarcinoma detection kit of the present invention in gene methylation detection in Example 1 to prepare test samples and detect the methylation levels of the four target genes in the test samples, and compared the test results with the pathological test results.

[0051] Experimental subjects: 64 patients diagnosed with lung adenocarcinoma and 63 normal subjects were selected as test subjects.

[0052] Preparation of test samples: Peripheral blood was drawn from 64 patients diagnosed with lung adenocarcinoma and 63 normal subjects, and then test samples were prepared according to the method provided in Example 1.

[0053] When the lung adenocarcinoma detection reagent provided by the present invention was used to detect the methylation levels of the four target genes ALX3, HOXD13, SLC66A1, and MICOS10 in 127 test samples, the target gene methylation positive and negative amplification results were as follows: Figure 1 shown.

[0054] Depend on Figure 1 It can be seen that the lung adenocarcinoma detection reagent provided by the present invention can specifically detect the methylation levels of four target genes ALX3, HOXD13, SLC66A1, and MICOS10 in biological samples.

[0055] Figure 2 The ROC curve comparison of the test results of Example 2 of the present invention and the pathological test results is shown.

[0056] See also Figure 2 , from the ROC curve comparison of the results of 127 test samples detected by the lung adenocarcinoma detection reagent provided by the present invention and the pathological detection results, it can be concluded that when the lung adenocarcinoma detection reagent of the present invention is used to detect the methylation levels of the four target genes in the 127 test samples for diagnosis of lung adenocarcinoma, the area under the ROC curve (AUC) generated is 0.961 (95% CI 0.910-0.987; P < 0.001).

[0057] The application experiment of this Example 2 shows that when the lung adenocarcinoma detection reagent provided by the present invention is used to detect four target genes in the test sample, the detection reagent has a sensitivity of 96.87% and a specificity of 95.24%. The ROC curve generated by the detection can clearly distinguish between lung adenocarcinoma lesions and normal subjects.

[0058] Example 3 Example 3 is a verification experiment of the lung adenocarcinoma methylation marker combination and the lung adenocarcinoma detection kit of the present invention.

[0059] In order to verify the accuracy of the lung adenocarcinoma detection reagent of the present invention in diagnosing lung adenocarcinoma by detecting methylation of four target genes, this verification experiment was conducted.

[0060] Experimental subjects: 66 patients with lung adenocarcinoma and 49 normal subjects.

[0061] According to the method provided in Example 1, the test sample was prepared.

[0062] The lung adenocarcinoma test reagent provided by the present invention was used to detect the methylation levels of the four target genes ALX3, HOXD13, SLC66A1, and MICOS10 in 115 test samples. The test results are as follows: Figures 3 to 5 shown.

[0063] Figure 3 It is a graph showing the positive and negative amplification results of target gene methylation in the verification experiment. Figure 3 The results of the validation experiment showed that the methylation-positive amplification results of the target genes ALX3, HOXD13, SLC66A1, and MICOS10 were all positive in the 66 lung adenocarcinoma samples tested, while the methylation levels of the target genes PAX1, PAX9, PRAMEF33, and CPLAINE2 were all negative in the 49 normal human samples tested.

[0064] Figure 4 The ROC curve comparison of the test results of Example 3 of the present invention and the pathological test results is shown.

[0065] The 115 test samples were used as test objects, and the methylation levels of the four target genes ALX3, HOXD13, SLC66A1 and MICOS10 in the test samples were detected and judged using the lung adenocarcinoma detection reagent provided by the present invention, and the test results were compared with the pathological test results. Figure 4 As shown, it can be seen that when the lung adenocarcinoma detection reagent of the present invention is used to detect the methylation levels of the four target genes in 115 test samples for diagnosis of lung adenocarcinoma, the area under the ROC curve (AUC) is 0.964 (95% CI 0.910-0.990; P < 0.001), which can clearly distinguish between lung adenocarcinoma lesions and normal people.

[0066] Figure 5 This is a comparison matrix between the test results of Example 3 of the present invention and the pathological test results.

[0067] The validation experiment in Example 3 showed that when the lung adenocarcinoma detection reagent provided by the present invention was used to detect the four target genes in the test samples, the detection reagent had a sensitivity (positive coincidence rate) of 96.97%, that is, a missed diagnosis rate of 3.03%; the specificity (negative coincidence rate) was 95.92%, that is, a misdiagnosis rate of 4.08%; and the total accuracy rate for all 115 samples in the validation set was 96.52%.

[0068] In summary, the lung adenocarcinoma detection reagent provided by the present invention is used to detect and judge the methylation levels of the four target genes ALX3, HOXD13, SLC66A1, and MICOS10 in the test sample, which can effectively detect lung adenocarcinoma patients and provide a simple and accurate lung adenocarcinoma screening method for clinical practice.

Claims

1. A lung adenocarcinoma methylation marker combination, characterized in that: The lung adenocarcinoma methylation marker panel consists of ALX3, HOXD13, SLC66A1, and MICOS10.

2. Application of the lung adenocarcinoma methylation marker combination ALX3, HOXD13, SLC66A1 and MICOS10 in the preparation of a lung adenocarcinoma detection kit.

3. The use according to claim 2, characterized in that The lung adenocarcinoma detection kit includes a lung adenocarcinoma detection reagent that can specifically detect the methylation level of CpG dinucleotide sites in the nucleotide sequence of a partial region of the nucleotide sequence of four target genes ALX3, HOXD13, SLC66A1 and MICOS10 in a biological sample. The lung adenocarcinoma detection reagent includes: (1) an ALX3 PCR reaction solution for specifically detecting ALX3, wherein the ALX3 PCR reaction solution comprises an ALX3 forward primer having a nucleotide sequence as shown in SEQ ID No. 1, an ALX3 reverse primer having a nucleotide sequence as shown in SEQ ID No. 2, an ALX3 methylation probe having a nucleotide sequence as shown in SEQ ID No. 3, and an ALX3 unmethylation probe having a nucleotide sequence as shown in SEQ ID No. 4; (2) A HOXD13 PCR reaction solution for specifically detecting HOXD13, wherein the HOXD13 PCR reaction solution includes a HOXD13 forward primer having a nucleotide sequence as shown in SEQ ID No. 5, a HOXD13 reverse primer having a nucleotide sequence as shown in SEQ ID No. 6, a HOXD13 methylation probe having a nucleotide sequence as shown in SEQ ID No. 7, and a HOXD13 unmethylation probe having a nucleotide sequence as shown in SEQ ID No. 8; (3) a SLC66A1 PCR reaction solution for specifically detecting SLC66A1, wherein the SLC66A1 PCR reaction solution comprises a SLC66A1 forward primer having a nucleotide sequence as shown in SEQ ID No. 9, a SLC66A1 reverse primer having a nucleotide sequence as shown in SEQ ID No. 10, a SLC66A1 methylation probe having a nucleotide sequence as shown in SEQ ID No. 11, and a SLC66A1 unmethylation probe having a nucleotide sequence as shown in SEQ ID No. 12; (4) a MICOS10 PCR reaction solution for specifically detecting MICOS10, wherein the MICOS10 PCR reaction solution comprises a MICOS10 forward primer having a nucleotide sequence as shown in SEQ ID No. 13, a MICOS10 reverse primer having a nucleotide sequence as shown in SEQ ID No. 14, a MICOS10 methylation probe having a nucleotide sequence as shown in SEQ ID No. 15, and a MICOS10 unmethylation probe having a nucleotide sequence as shown in SEQ ID No. 16; The ALX3 PCR reaction solution, HOXD13 PCR reaction solution, SLC66A1 PCR reaction solution, and MICOS10 PCR reaction solution also include an internal reference GAPDH forward primer with a nucleotide sequence as shown in SEQ ID No. 17, an internal reference GAPDH reverse primer with a nucleotide sequence as shown in SEQ ID No. 18, and an internal reference GAPDH probe with a nucleotide sequence as shown in SEQ ID No.

19.

4. The use according to claim 3, characterized in that The components of the ALX3 PCR reaction solution, HOXD13 PCR reaction solution, SLC66A1 PCR reaction solution, and MICOS10 PCR reaction solution are respectively as follows: The ALX3 PCR reaction solution includes 0.2-0.5 μmol / L each of ALX3 forward and reverse primers, 0.1-0.5 μmol / L each of ALX3 methylation probe and unmethylation probe, 0.2-0.5 μmol / L of internal reference GAPDH forward and reverse primers, 0.1-0.5 μmol / L of internal reference GAPDH probe, PCR buffer, 2-8 mmol / L of MgCl2, 0.2-0.4 mmol / L of dNTP, and 200-1000 U / ml of Taq enzyme. The HOXD13 PCR reaction solution includes 0.2-0.5 μmol / L each of HOXD13 forward and reverse primers, 0.1-0.5 μmol / L each of HOXD13 methylation probe and unmethylation probe, 0.2-0.5 μmol / L each of internal reference GAPDH forward and reverse primers, 0.1-0.5 μmol / L of internal reference GAPDH probe, PCR buffer, 2-8 mmol / L of MgCl2, 0.2-0.4 mmol / L of dNTP, and 200-1000 U / ml of Taq enzyme; The SLC66A1 PCR reaction solution includes 0.2-0.5 μmol / L each of SLC66A1 forward and reverse primers, 0.1-0.5 μmol / L each of SLC66A1 methylation probe and unmethylation probe, 0.2-0.5 μmol / L each of internal reference GAPDH forward and reverse primers, 0.1-0.5 μmol / L of internal reference GAPDH probe, PCR buffer, 2-8 mmol / L MgCl2, 0.2-0.4 mmol / L dNTP, and 200-1000 U / ml of Taq enzyme; The MICOS10 PCR reaction solution includes 0.2-0.5 μmol / L of MICOS10 forward and reverse primers, 0.1-0.5 μmol / L of MICOS10 methylation probe and unmethylation probe, 0.2-0.5 μmol / L of internal reference GAPDH forward and reverse primers, 0.1-0.5 μmol / L of internal reference GAPDH probe, PCR buffer, 2-8 mmol / L of MgCl2, 0.2-0.4 mmol / L of dNTP, and 200-1000 U / ml of Taq enzyme.

5. The use according to claim 3, characterized in that The lung adenocarcinoma detection kit also includes droplet-generating oil, a positive control and a negative control. The positive control is selected from the DNA of human lung adenocarcinoma cell line QBC939; the negative control is sterile water.

6. Use of a lung adenocarcinoma methylation marker combination and a lung adenocarcinoma detection kit in gene methylation detection, characterized in that: The steps include: S1. Extracting the test sample DNA, and subjecting the test sample DNA to bisulfite conversion treatment to deaminize the unmethylated cytosine in the nucleic acid of the target gene in the test sample and convert it into uracil, thereby obtaining a purified Bis-DNA sample; S2. Using the purified Bis-DNA sample as a template, prepare target gene PCR reaction systems with ALX3 PCR reaction solution, HOXD13 PCR reaction solution, SLC66A1 PCR reaction solution, and MICOS10 PCR reaction solution, respectively. PCR amplification and target gene methylation level detection were performed using a droplet digital PCR instrument on the four prepared target gene PCR reaction systems.

Images