A primer, kit and method for identifying procyprinus, procyprinus paltothyus, procyprinus paltothyus, procyprinus paltothyus and their hybrids

Abstract

The present application relates to the field of biotechnology, and more particularly to a primer, kit and method for identifying Pelteobagrus vachelli, Pelteobagrus nitidus, Leiocassis longirostris and their hybrids, wherein the forward and reverse primer sequences in the primer are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The present application uses fin strip micro samples for DNA extraction, and then completes species identification through PCR amplification combined with agarose gel electrophoresis technology. The detection result has high accuracy and strong genetic marker specificity, and is not subject to the growth of the fish body. The fish body can be sampled and identified at each breeding stage, thereby providing important technical support for aquatic breeding management.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to primers, kits and methods for identifying yellow catfish, yellow catfish, long-snout catfish and their hybrids. Background Technology

[0002] Yellow catfish (Tachysurus fulvidraco), yellow catfish (Tachysurus vachellii), and long-snout catfish (Leiocassis longirostris) are all important freshwater economic fish species in my country, belonging to the order Siluriformes and family Bagridae. Traditional morphological identification methods rely on experience and have a high error rate, easily leading to chaotic aquaculture management or mixed germplasm resources. Hybrids, in particular, often have morphological characteristics similar to their parents, making accurate identification by the naked eye difficult in aquaculture environments. In recent years, with the development of hybridization breeding technology, the complexity of morphological identification has further increased due to the hybrid offspring of different species.

[0003] Obtaining DNA molecular markers by comparing specific differences in DNA sequences among species is one of the efficient and stable methods for rapidly identifying similar species. However, current technologies lack rapid identification methods for yellow catfish, yellow catfish, long-snout catfish, and their hybrids. Using morphological methods to identify closely related species may lead to significant difficulties and identification errors. Therefore, there is an urgent need to design and develop primers, kits, and methods that can stably and efficiently identify DNA molecular markers for yellow catfish, yellow catfish, long-snout catfish, and their hybrids, providing important technical support for breeding management during the seedling and growth stages. Summary of the Invention

[0004] In view of this, the present invention proposes primers, reagent kits and methods for identifying yellow catfish, yellow catfish, long-snout catfish and their hybrids.

[0005] The technical solution of this invention is implemented as follows:

[0006] In a first aspect, the present invention provides primers for identifying yellow catfish, yellow catfish (Pelteobagrus vachelli), longsnout catfish, and their hybrids, wherein the forward and reverse primer sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The hybrids include: hybrids of yellow catfish and yellow catfish (Pelteobagrus vachelli), hybrids of yellow catfish and longsnout catfish, and hybrids of longsnout catfish and yellow catfish (Pelteobagrus vachelli).

[0007] Secondly, the present invention provides the application of the primers in the identification of yellow catfish, yellow catfish, long-snout catfish and their hybrids.

[0008] Thirdly, the present invention provides a kit for identifying yellow catfish, yellow catfish, long-snout catfish, and their hybrids, the kit including the primers mentioned above. Furthermore, the kit also includes PCR reaction reagents.

[0009] Fourthly, the present invention provides the application of the kit in identifying yellow catfish, yellow catfish, long-snout catfish and their hybrids.

[0010] Fifthly, the present invention also provides a method for identifying yellow catfish, yellow catfish, long-snout catfish, and their hybrids, comprising the following steps:

[0011] Extract DNA from the sample to be identified;

[0012] The extracted DNA to be tested was amplified by PCR using the primers described in claim 1.

[0013] The PCR amplification products were detected by agarose gel electrophoresis, and the sample type was identified based on the position of the bands after electrophoresis.

[0014] Furthermore, the method for determining the sample type based on the position of the bands after electrophoresis is as follows:

[0015] If a 412bp band is amplified, the corresponding species is yellow catfish;

[0016] If a 526bp band is amplified, the corresponding species is *Pelteobagrus vachelli*.

[0017] If a 572bp band is amplified, the corresponding species is the long-snouted catfish;

[0018] If two bands of 412bp and 526bp are amplified, the corresponding species is a hybrid of yellow catfish and yellow catfish.

[0019] If two bands of 412bp and 572bp are amplified, the corresponding species is a hybrid of yellow catfish and long-snout catfish.

[0020] If two bands of 572bp and 526bp are amplified, the corresponding species is a hybrid of the long-snout catfish and the yellow catfish.

[0021] Furthermore, the sample to be identified is fish fin tissue.

[0022] Furthermore, the PCR amplification reaction system is 10 μL, which includes: 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, 5 μL of 2×TaqMasterMix, 1 μL of DNA template and 3 μL of ddH2O.

[0023] Furthermore, the reaction procedure for the PCR amplification is as follows:

[0024] First, pre-denature at 95℃ for 3-5 minutes;

[0025] Then it enters the cyclic amplification phase: 95℃ for 40s, 60℃ for 30s, 72℃ for 60s, 30-35 cycles;

[0026] Finally, keep warm at 72℃ for 7 minutes.

[0027] The beneficial effects of the present invention include at least the following:

[0028] The specific primers, detection kits, and methods provided by this invention can accurately identify yellow catfish, yellow catfish (Pelteobagrus vachelli), longsnout catfish, and their hybrids. This method involves extracting DNA from a small sample of fin rays, followed by PCR amplification combined with agarose gel electrophoresis to complete species identification. This invention offers high accuracy and strong genetic marker specificity, with advantages such as accuracy, reliability, low cost, and simple operation. Furthermore, it allows for sampling and testing at various stages of aquaculture, including the seedling and rearing periods, providing crucial technical support for aquaculture breeding management. Attached Figure Description

[0029] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0030] Figure 1 This is a schematic diagram of primer design in an embodiment of the present invention;

[0031] Figure 2 This is a graph showing the gel electrophoresis results of the PCR amplification products in Example 1 of the present invention;

[0032] Figure 3 This is a graph showing the gel electrophoresis results of the PCR amplification products in Example 2 of the present invention. Detailed Implementation

[0033] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0034] Table 1 Sequence Information Table

[0035] name SEQIDNO Sequence (5'-3') Length (bp) forward primer 1 TGCCATCATTGTTGTCTTCA 20 reverse primer 2 ATCAGTCGTGGCTCTGTTCC 20

[0036] Primer design principles:

[0037] In the assembled and annotated genome sequence of *Pelteobagrus vachelli*, the *aaas* gene sequence of *Pelteobagrus vachelli* was aligned with the publicly published genomes of *Pelteobagrus vachelli* and *Catfish bream* in the NCBI database to obtain the corresponding sequences. Then, the three corresponding differential sequences were arranged according to base pairs, and the differential positions were marked, such as... Figure 1 As shown, primers for accurately identifying the species of yellow catfish, yellow catfish, long-snout catfish, and their hybrids can be designed based on the differences in this DNA sequence. The forward primer sequence is shown in SEQ ID NO: 1, and the reverse primer sequence is shown in SEQ ID NO: 2 (Table 1).

[0038] Example 1

[0039] 1. Materials and Methods

[0040] (1) Sample collection: 10 each of 2-year-old yellow catfish, yellow catfish, long-snout catfish and their hybrids were collected.

[0041] (2) Genomic DNA extraction: DNA was extracted using the alkaline lysis method. The specific steps included:

[0042] (a) Take 10-50 mg of fresh fin tissue, cut it into small pieces and place it in a 1.5 mL centrifuge tube.

[0043] (b) Prepare 50mM NaOH using 0.1g NaOH and 50mL ddH2O.

[0044] (c) Add 100 μL of 50 mM NaOH to a 1.5 mL centrifuge tube containing fin tissue, heat in a 94 °C water bath for 2 h, shaking once every 30 min until lysis is complete.

[0045] (d) Add 5 μL of Tris-HCl to a 1.5 mL centrifuge tube for alkali neutralization, then centrifuge to collect the supernatant. Transfer the supernatant to a new centrifuge tube and store at 4 °C.

[0046] (3) Measure DNA concentration: Adjust the DNA concentration to 50 ng / μL.

[0047] (4) Primer preparation: Taking the gene sequence of *Pelteobagrus vachelli* as an example, after the assembly and annotation of the *Pelteobagrus vachelli* genome is completed, it is aligned with the publicly published genomes of *Pelteobagrus vachelli* and *Catfish bream* in the NCBI database to obtain the corresponding sequences. Then, the three corresponding differential sequences are arranged according to base pairs, and the differential positions are marked, such as... Figure 1As shown, primers can be designed based on the differences in this DNA sequence to accurately identify the species of yellow catfish, yellow catfish, long-snout catfish, and their hybrids. The forward primer sequence is: TGCCATCATTGTTGTCTTCA; the reverse primer sequence is: ATCAGTCGTGGCTCTGTTCC.

[0048] (5) PCR amplification was performed on the DNA of six species tissues using the above-mentioned forward and reverse primers. The PCR reaction system was 10 μL, including 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, 5 μL of 2×TaqMasterMix, 1 μL of fin genomic DNA, and 3 μL of ddH2O. PCR program: The above premixed solution was slightly centrifuged and placed in a PCR instrument for PCR amplification. Pre-denaturation was performed at 95℃ for 5 min, followed by cyclic amplification: 95℃ for 40 s → 60℃ for 30 s → 72℃ for 60 s, for 35 cycles, and then incubated at 72℃ for 7 min.

[0049] (6) Electrophoresis detection of PCR products: 1% agarose gel was prepared, and the PCR amplification products were mixed with Gel-red staining solution and then spotted. Electrophoresis was performed at 200V and 200A for 15 minutes. The gel was then placed on a UV gel irradiator to compare the bands.

[0050] 2. Results

[0051] The gel electrophoresis results of the primer PCR amplification products are shown in the figure below. Figure 2 As shown.

[0052] Figure 2 (a) From left to right: The first position is the marker (DL2000plus). The first to fifth bands in the electrophoresis are long-snout catfish, with an amplified band size of 572bp; the sixth to tenth bands are hybrids of long-snout catfish and yellow catfish, with amplified band sizes of 572bp and 526bp respectively; the eleventh to fifteenth bands are yellow catfish, with an amplified band size of 526bp.

[0053] Figure 2 (b) From left to right: The first position is the marker (DL2000plus). The first to fifth bands in the electrophoresis are long-snout catfish, with an amplified band size of 572bp; the sixth to tenth are hybrids of long-snout catfish and yellow catfish, with amplified band sizes of 572bp and 412bp respectively; the eleventh to fifteenth are yellow catfish, with an amplified band size of 412bp.

[0054] Figure 2(c) From left to right: The first position is the marker (DL2000plus). The first to fifth bands in the electrophoresis are yellow catfish (Pelteobagrus vachelli), with an amplified band size of 526bp; the sixth to tenth bands are hybrids of yellow catfish and yellow catfish, with amplified band sizes of 526bp and 412bp respectively; the eleventh to fifteenth bands are yellow catfish, with an amplified band size of 412bp.

[0055] The success rate of species identification is 100%, and it can quickly and accurately identify the above 6 species.

[0056] Example 2

[0057] 1. Method

[0058] (1). Species tagging: 10 each of yellow catfish, yellow catfish, long-snout catfish and their hybrids, totaling 60 fish, were implanted with PIT electronic tags to distinguish species and were raised together in the same breeding pond for identification;

[0059] (2). Sample collection: 30 fish to be identified were randomly selected from the above-mentioned fish;

[0060] (3). Extraction of fin DNA from yellow catfish, yellow catfish, long-snout catfish and their hybrids. Genomic DNA was extracted using the alkaline lysis method, with the specific steps being the same as in Example 1.

[0061] (4). Using the forward and reverse primers shown in SEQ ID NO: 1-2, PCR amplification was performed on the genomic DNA of yellow catfish, yellow catfish, long-snout catfish and their hybrids. The specific steps were the same as in Example 1.

[0062] (5) Mix the PCR amplification products with nucleic acid dyes and perform electrophoresis on a 1% agarose gel for 15 min. Place the gel on a UV gel spectrometer to observe the bands and determine the species.

[0063] 2. Results

[0064] The gel electrophoresis results of the primer PCR amplification products are as follows: Figure 3 As shown, from left to right: the first position is the marker (DL2000plus). The first, seventh, and thirteenth bands in the electrophoresis are of *Cetus scutellarioides*, with an amplified band size of 572bp; the fifth, eighth, and fifteenth bands are of *Cetus scutellarioides* and *Pelteobagrus vachelli* hybrids, with amplified band sizes of 572bp and 526bp respectively; the third and eleventh bands are of *Pelteobagrus vachelli*, with an amplified band size of 526bp; the second, ninth, and sixteenth bands are of *Pelteobagrus vachelli* and *Pelteobagrus fulvidraco* hybrids, with amplified band sizes of 526bp and 412bp respectively; the sixth, tenth, and fourteenth bands are of *Pelteobagrus fulvidraco*, with an amplified band size of 412bp; and the fourth, twelfth, and seventeenth bands are of *Cetus scutellarioides* and *Pelteobagrus vachelli* hybrids, with amplified band sizes of 572bp and 412bp respectively.

[0065] The electrophoretic band identification results were verified by combining the implanted PIT species tags. The species identification success rate was 100%, and the above 6 species could be identified quickly and accurately.

[0066] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The use of primers in identifying Pelteobagrus fulvidraco, Pelteobagrus vishnui, Leiocassis longirostris and their hybrids, characterized in that, The forward and reverse primer sequences in the primer are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively, the DNA of the sample to be identified is subjected to PCR amplification by using the primer, the PCR amplification product is subjected to agarose gel electrophoresis detection, and the sample type is judged according to the band position after electrophoresis, if a 412 bp band is amplified, the corresponding species is Pelteobagrus fulvidraco; if a 526 bp band is amplified, the corresponding species is Pelteobagrus vishnui; if a 572 bp band is amplified, the corresponding species is Leiocassis longirostris; if 412 bp and 526 bp bands are amplified, the corresponding species is the hybrid of Pelteobagrus fulvidraco and Pelteobagrus vishnui; if 412 bp and 572 bp bands are amplified, the corresponding species is the hybrid of Pelteobagrus fulvidraco and Leiocassis longirostris; if 572 bp and 526 bp bands are amplified, the corresponding species is the hybrid of Leiocassis longirostris and Pelteobagrus vishnui.

2. The use of the kit in identifying Pelteobagrus vachelli, Pelteobagrus nitidus, Leiocassis longirostris and their hybrids, characterized in that, The kit comprises primers with sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively, the DNA of the sample to be identified is subjected to PCR amplification by using the primer, the PCR amplification product is subjected to agarose gel electrophoresis detection, and the sample type is judged according to the band position after electrophoresis, if a 412 bp band is amplified, the corresponding species is Pelteobagrus fulvidraco; if a 526 bp band is amplified, the corresponding species is Pelteobagrus vishnui; if a 572 bp band is amplified, the corresponding species is Leiocassis longirostris; if 412 bp and 526 bp bands are amplified, the corresponding species is the hybrid of Pelteobagrus fulvidraco and Pelteobagrus vishnui; if 412 bp and 572 bp bands are amplified, the corresponding species is the hybrid of Pelteobagrus fulvidraco and Leiocassis longirostris; if 572 bp and 526 bp bands are amplified, the corresponding species is the hybrid of Leiocassis longirostris and Pelteobagrus vishnui.

3. A method for identifying Pelteobagrus vachli, Pelteobagrus nitidus, Leiocassis longirostris and their hybrids, characterized in that, The kit comprises primers with sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively, the DNA of the sample to be identified is subjected to PCR amplification by using the primer, the PCR amplification product is subjected to agarose gel electrophoresis detection, and the sample type is judged according to the band position after electrophoresis, if a 412 bp band is amplified, the corresponding species is Pelteobagrus fulvidraco; if a 526 bp band is amplified, the corresponding species is Pelteobagrus vishnui; if a 572 bp band is amplified, the corresponding species is Leiocassis longirostris; if 412 bp and 526 bp bands are amplified, the corresponding species is the hybrid of Pelteobagrus fulvidraco and Pelteobagrus vishnui; if 412 bp and 572 bp bands are amplified, the corresponding species is the hybrid of Pelteobagrus fulvidraco and Leiocassis longirostris; if 572 bp and 526 bp bands are amplified, the corresponding species is the hybrid of Leiocassis longirostris and Pelteobagrus vishnui. The kit comprises primers with sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively, the DNA of the sample to be identified is subjected to PCR amplification by using the primer, the PCR amplification product is subjected to agarose gel electrophoresis detection, and the sample type is judged according to the band position after electrophoresis, if a 412 bp band is amplified, the corresponding species is Pelteobagrus fulvidraco; if a 526 bp band is amplified, the corresponding species is Pelteobagrus vishnui; 4. The method of claim 3, wherein, if a 572 bp band is amplified, the corresponding species is Leiocassis longirostris; if 412 bp and 526 bp bands are amplified, the corresponding species is the hybrid of Pelteobagrus fulvidraco and Pelteobagrus vishnui; if 412 bp and 572 bp bands are amplified, the corresponding species is the hybrid of Pelteobagrus fulvidraco and Leiocassis longirostris; if 572 bp and 526 bp bands are amplified, the corresponding species is the hybrid of Leiocassis longirostris and Pelteobagrus vishnui. The sample to be identified is the fin strip tissue of fish.

5. The method of claim 3, wherein, The reaction system of the PCR amplification is 10 μL, including 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, 5 μL of 2 × TaqMasterMix, 1 μL of DNA template and 3 μL of ddH2O.

6. The method of claim 3 wherein, The reaction procedure of the PCR amplification is as follows: Firstly, pre-denaturation at 95℃ for 3-5 min; Then, enter the cyclic amplification stage: 95℃ for 40 s, 60℃ for 30 s, 72℃ for 60 s, cycle for 30-35 times; Finally, keep at 72℃ for 7 min.

Images