Cells and compositions for treating cancer

Abstract

The presently disclosed subject matter provides cells, compositions and methods for enhancing an immune response against tumor antigens. The present invention relates to cells comprising a first antigen-recognizing receptor (e.g., a chimeric antigen receptor (CAR)) and a second antigen-recognizing receptor (e.g., a TCR-like fusion molecule). These cells have improved activity and / or efficiency.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to U.S. Provisional Application No. 63 / 418,302, filed October 21, 2022, the contents of which are incorporated herein by reference in their entirety, and claims priority to that U.S. Provisional Application.

[0003] sequence list

[0004] The sequence list conforming to WIPO standard ST.26 is hereby incorporated by reference. The sequence list was submitted as an electronic document via the PatentCenter, encoded as XML in UTF-8 text. The electronic document, created on October 23, 2023, is named “072734_1497_SL.xml” and has a size of 235,322 bytes. Technical Field

[0005] The subject matter disclosed in this application provides compositions and methods for targeting an immune response to cells carrying tumor antigens. It relates to compositions (e.g., modified immune-responding cells) comprising a first antigen recognition receptor (e.g., a chimeric antigen receptor (CAR)) and a second antigen recognition receptor (e.g., a TCR-like fusion molecule), wherein said compositions mediate an immune response against cells carrying the first and / or second antigens. Background Technology

[0006] Target heterogeneity can limit the therapeutic success of certain CAR therapies in cancers such as B-cell tumors and other malignancies. Several approaches to address target heterogeneity in CAR-based therapies have been described and include the use of dual CARs (T cells co-expressing two CARs), tandem CARs (T cells expressing a single bispecific CAR), and pooled single CAR-T cells (T cells expressing a single CAR). The clinical efficacy of such CAR therapies remains under investigation, and emerging preclinical data suggest that these approaches may require fine-tuning of combined CAR signaling to balance effectors and memory functions, thereby avoiding premature differentiation and eventual depletion. Therefore, there is an urgent need for new concepts to address target heterogeneity. Summary of the Invention

[0007] The subject matter disclosed in this application provides compositions comprising (e.g., modified immune response cells): (1) a CAR targeting a first antigen; and (2) a TCR-like fusion molecule targeting a second antigen. The subject matter disclosed in this application further provides the use of these compositions in: reducing tumor burden, treating and / or preventing growths or tumors, preventing and / or treating pathogen infections, preventing and / or treating autoimmune diseases, and / or preventing and / or treating infectious diseases.

[0008] In some embodiments, the CAR includes an extracellular antigen-binding domain that binds to a first antigen and an intracellular signaling domain capable of delivering an activation signal to the cell. In some embodiments, the intracellular signaling domain of the CAR includes a CD3ζ polypeptide. In some embodiments, the CD3ζ polypeptide is a natural CD3ζ polypeptide or a modified CD3ζ polypeptide. In some embodiments, the modified CD3ζ polypeptide includes a natural ITAM1, an ITAM2 variant consisting of two loss-of-function mutations, and an ITAM3 variant consisting of two loss-of-function mutations. In some embodiments, the modified CD3ζ polypeptide includes the amino acid sequence shown in SEQ ID NO:22. In some embodiments, the intracellular signaling domain of the CAR further includes at least one co-stimulatory signaling region. In some embodiments, the at least one co-stimulatory signaling region includes at least an intracellular domain of a co-stimulatory molecule or a portion thereof. In some embodiments, the co-stimulatory molecule is selected from the group consisting of: CD28, 4-1BB, OX40, CD27, CD40, CD154, CD97, CD11a / CD18, ICOS, DAP-10, CD2, CD150, CD226, and NKG2D. In some embodiments, the co-stimulatory molecule comprises amino acids 180 to 220 of SEQ ID NO:7. In some embodiments, the CAR comprises a transmembrane domain.

[0009] In some embodiments, the TCR-like fusion molecule comprises: i) a first antigen-binding chain comprising an antigen-binding fragment of the heavy chain variable region (VH) of the antibody; and ii) a second antigen-binding chain comprising an antigen-binding fragment of the light chain variable region (VL) of the antibody; wherein the first antigen-binding chain and the second antigen-binding chain a) each comprise a TRAC peptide or a TRBC peptide, and b) bind to the second antigen, wherein the TCR-like fusion molecule binds to the second antigen in an HLA-independent manner. In some embodiments, at least one of the TRAC peptide and the TRBC peptide is endogenous. In some embodiments, the first antigen-binding chain and the second antigen-binding chain are approximately 1 × 10⁻⁶. -8 The first antigen-binding chain binds to the second antigen at a dissociation constant (KD) of M or smaller. In some embodiments, the first antigen-binding chain and the second antigen-binding chain bind at a dissociation constant of approximately 5 × 10⁻⁶. -9 A dissociation constant (M) or smaller binds to the second antigen.

[0010] In some embodiments, the first antigen-binding chain comprises an antigen-binding fragment of the antibody's VH and a TRBC peptide, and the second antigen-binding chain comprises an antigen-binding fragment of the antibody's VL and a TRAC peptide. In some embodiments, the first and second antigen-binding chains are capable of associating with the CD3ζ peptide. In some embodiments, the first and second antigen-binding chains are capable of activating the CD3ζ peptide upon binding to a second antigen. In some embodiments, activation of the CD3ζ peptide can activate cells.

[0011] In some embodiments, the cells further include gene disruption at the TRAC and / or TRBC loci. In some embodiments, the cells further include gene disruption at the CD70 locus. In some embodiments, the cells further include gene disruption at the TRAC, TRBC, and / or CD70 loci.

[0012] In some embodiments, the cells further include genetic modifications to the TRAC gene and / or the TRBC gene. In some embodiments, the cells further include genetic modifications to the CD70 gene. In some embodiments, the cells further include genetic modifications to the TRAC gene, the TRBC gene, and / or the CD70 gene.

[0013] In some embodiments, the immune response cells are lymphoid or myeloid cells. In some embodiments, the lymphoid cells are selected from the group consisting of T cells, B cells, natural killer (NK) cells, and dendritic cells. In some embodiments, the cells are T cells. In some embodiments, the T cells are derived from induced pluripotent stem cells. In some embodiments, the T cells are CD8+ cells. + T cells. In some embodiments, CD8 + T cells are independent of CD4.

[0014] In some embodiments, the T cells are selected from the group consisting of cytotoxic T lymphocytes (CTLs), γδ T cells, tumor-infiltrating lymphocytes (TILs), regulatory T cells, and natural killer T (NKT) cells. In some embodiments, the T cells are CD62L cells. + In some embodiments, the T cells are CD45RA. + In some embodiments, the T cells are CD45RA. + and CD62L + .

[0015] In some embodiments, CAR and / or TCR-like fusion molecules are integrated into a locus within the genome of an immune-responding cell. In some embodiments, the locus is selected from the group consisting of: TRAC locus, TRBC locus, TRDC locus, and TRGC locus. In some embodiments, the locus is a TRAC locus or a TRBC locus. In some embodiments, the locus is a TRAC locus.

[0016] In some embodiments, the first antigen and / or the second antigen are tumor antigens or pathogen antigens. In some embodiments, the tumor antigen is selected from the group consisting of: CD19, CD70, IL1RAP, ABCG2, AChR, ACKR6, ADAMTS13, ADGRE2, ADGRE2 (EMR2), ADORA3, ADRA1D, AGER, ALS2, antigens of cytomegalovirus (CMV) infected cells (e.g., cell surface antigens), ANO9, AQP2, ASIC3, ASPRV1, ATP6V0A4, B3GNT4, B7-H3, BCMA, BEST4, C3orf35, CADM3, CAIX, CAPN3, CCDC155, CCR1, CD10, CD1 17. CD123, CD133, CD135(FLT3), CD138, CD20, CD22, CD244(2B4), CD25, CD26, CD30, CD300LF, CD312, CD32, CD321, CD33, CD34, CD36, CD38, CD41, CD 44. CD44V6, CD47, CD49f, CD56, CD7, CD71, CD74, CD8, CD82, CD96, CD98, CD99, CDH13, CDHR1, CEA, CEACAM6, CHST3, CLEC12A, CLEC1A, CLL1, CNIH2, C OL15A1, COLEC12, CPM, CR1, CX3CR1, CXCR4, CYP4F11, DAGLB, DARC, DFNB31, DGKI, EGF1R, EGFR-VIII, EGP-2, EGP-40, ELOVL6, EMB, EMC10, EMR2, ENG, EpCAM, EphA2, EPHA4, ERBB, ERBB2, Erb-B3, Erb-B4, E-selectin, EXOC3L4, EXTL3, FAM186B, FBP, FCGR1A, FKBP1B, FLRT1, folate receptor-α, FOLR2, FRMD5, GABRB2 GAS2, GD2, GD3, GDPD3, GNA14, GNAZ, GPR153, GPR56, GYPA, HEPHL1, HER-2, hERT, HILPDA, HLA-DR, HOOK1, hTERT, HTR2A, ICAM1, IGFBP3, IL10RB, IL20RB, IL23R, ILDR1, interleukin-13 receptor subunit α-2 (IL-13Rα2), ITFG3, ITGA4, ITGA5, ITGA8, ITGAX, ITGB5, ITGB8, JAM3, KCND1, KCNJ5, KCNK13, KCNN4, KCNV2KDR, KIF19, KIF26B, κ-light chain, L1CAM, LAX1, LEPR, Lewis Y (CD174), Lewis Y (LeY), LILRA2, LILRA6, LILRB2, LILRB3, LILRB4, LOXL4, LPAR2, LRRC37A3, LRRC8E, LRRN2, LLRTM2, LTB4R, MAGE-A1, MAGEA3, MANSC1, MART1, GP100, MBOAT1, MBOAT7, melanoma antigen family A, mesothelin (MSLN), MFAP3L, MMP25, MRP1, MT-ND1, mucin 1 (MUC1), mucin 16 (MUC16), MYADM, MYADML2, NGFR, N KCS1, NKG2D ligand, NLGN3, NPAS2, NY-ESO-1, carcinoembryonic antigen (h5T4), OTOA, P2RY13, p53, PDE3A, PEAR1, PIEZO1, PLXNA4, PLXNC1, PNPLA3, PPFIA4, PPP2R5B, PRAME, PRAME, prostate stem cell antigen (PSCA), prostate-specific membrane antigen (PSMA), proteinase 3 (PR1), PSD2, PTPRJ, RDH16, receptor tyrosine protein kinase Erb-B2, RHBDL3, RNF173, RNF183, ROR 1. RYR2, SCIN, SCN11A, SCN2A, SCNN1D, SEC31B, SEMA4A, SH3PXD2A, SIGLEC11, SIRPB1, SLC16A6, SLC19A1, SLC22A5, SLC25A36, SLC25A41, SLC30A1, SLC34A3, SLC43A3, SLC44A1, SLC44A3, SLC45A3, SLC6A16, SLC6A6, SLC8A3, SLC9A1, SLCO2B1, SPAG17, STC1, STON2, SUN3, survivin, S USD2, SYNC, TACSTD2, TAS1R3, TEX29, TFR2, TIM-3 (HAVCR2), TLR2, TMEFF2, TMEM145, TMEM27, TMEM40, TMEM59L, TMEM89, TMPRSS5, TNFRSF14, TNFRSF1B, TRIM55, TSPEAR, TTYH3, tumor-associated glycoprotein 72 (TAG-72), tyrosinase, vascular endothelial growth factor R2 (VEGF-R2), VLA-4, Wilms tumor protein (WT-1), WNT4, WT1, and ZDHHC11.

[0017] In some embodiments, the first antigen is selected from the group consisting of: CD312, CD19, CD20, CD22, CD276, and CAIX. In some embodiments, the second antigen is selected from the group consisting of: CD70, CD19, CD20, and CD22.

[0018] In some embodiments, the first antigen and the second antigen are CD312 and CD70. In some embodiments, the extracellular antigen-binding domain of the CD312-targeting CAR comprises: VH, which contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:73, CDR2 comprising the amino acid sequence shown in SEQ ID NO:74, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:75; and VL, which contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:76, CDR2 comprising the amino acid sequence shown in SEQ ID NO:77, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:78. In some embodiments, the CD70-targeting TCR-like fusion molecule comprises: a first antigen-binding chain containing CDR1 comprising the amino acid sequence shown in SEQ ID NO:133, CDR2 comprising the amino acid sequence shown in SEQ ID NO:134, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:135; and a second antigen-binding chain containing CDR1 comprising the amino acid sequence shown in SEQ ID NO:136, CDR2 comprising the amino acid sequence shown in SEQ ID NO:137, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:138.

[0019] In some embodiments, the first antigen and the second antigen are CD276 and CD70. In some embodiments, the extracellular antigen-binding domain of the CD276-targeting CAR comprises: VH, which contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:85, CDR2 comprising the amino acid sequence shown in SEQ ID NO:86, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:87; and VL, which contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:88, CDR2 comprising the amino acid sequence shown in SEQ ID NO:89, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:90. In some embodiments, the CD70-targeting TCR-like fusion molecule comprises: a first antigen-binding chain containing CDR1 comprising the amino acid sequence shown in SEQ ID NO:133, CDR2 comprising the amino acid sequence shown in SEQ ID NO:134, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:135; and a second antigen-binding chain containing CDR1 comprising the amino acid sequence shown in SEQ ID NO:136, CDR2 comprising the amino acid sequence shown in SEQ ID NO:137, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:138.

[0020] In some embodiments, the first antigen and the second antigen are CAIX and CD70. In some embodiments, the first antigen and the second antigen are CD19 and CD22. In some embodiments, the first antigen and the second antigen are CD19 and CD20. In some embodiments, the first antigen and the second antigen are CD20 and CD22. In some embodiments, the first antigen and the second antigen are CD20 and CD19. In some embodiments, the first antigen and the second antigen are CD22 and CD20.

[0021] In some embodiments, the first antigen and the second antigen are CD22 and CD19. In some embodiments, the extracellular antigen-binding domain of the CD22-targeting CAR comprises: a) VH, which contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:97, CDR2 comprising the amino acid sequence shown in SEQ ID NO:98, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:99; and VL, which contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:100, CDR2 comprising the amino acid sequence shown in SEQ ID NO:101, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:102; b) VH, which contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:97, CDR2 comprising the amino acid sequence shown in SEQ ID NO:153, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:99; and VL, which contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:100, CDR2 comprising the amino acid sequence shown in SEQ ID NO:101, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:99. CDR3 containing the amino acid sequence shown in NO:102; c) VH containing CDR1 containing the amino acid sequence shown in SEQ ID NO:119, CDR2 containing the amino acid sequence shown in SEQ ID NO:120, and CDR3 containing the amino acid sequence shown in SEQ ID NO:121; and VL containing CDR1 containing the amino acid sequence shown in SEQ ID NO:122, CDR2 containing the amino acid sequence shown in SEQ ID NO:123, and CDR3 containing the amino acid sequence shown in SEQ ID NO:124; or d) V H It contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO:97, CDR2 comprising the amino acid sequence shown in SEQ ID NO:154, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:99; and V LThe molecule contains CDR1 containing the amino acid sequence shown in SEQ ID NO:100, CDR2 containing the amino acid sequence shown in SEQ ID NO:101, and CDR3 containing the amino acid sequence shown in SEQ ID NO:102. In some embodiments, the CD19-targeting TCR-like fusion molecule comprises: a first antigen-binding strand containing CDR1 containing the amino acid sequence shown in SEQ ID NO:143, CDR2 containing the amino acid sequence shown in SEQ ID NO:144, and CDR3 containing the amino acid sequence shown in SEQ ID NO:145; and a second antigen-binding strand containing CDR1 containing the amino acid sequence shown in SEQ ID NO:146, CDR2 containing the amino acid sequence shown in SEQ ID NO:147, and CDR3 containing the amino acid sequence shown in SEQ ID NO:148.

[0022] In some embodiments, the first antigen and the second antigen are selected from Table 8.

[0023] In some embodiments, the cell further comprises a chimeric co-stimulatory receptor (CCR). In some embodiments, the CCR comprises an extracellular antigen-binding domain that binds to a third antigen, and an intracellular domain capable of delivering a co-stimulatory signal to the cell but not an activation signal alone. In some embodiments, the intracellular domain of the CCR comprises at least the intracellular domain of a co-stimulatory molecule or a portion thereof. In some embodiments, the co-stimulatory molecule is selected from the group consisting of: CD28, 4-1BB, OX40, CD27, CD40, CD154, CD97, CD11a / CD18, ICOS, DAP-10, CD2, CD150, CD226, and NKG2D.

[0024] In some embodiments, the cell further comprises at least one exogenous costimulatory ligand. In some embodiments, the at least one exogenous costimulatory ligand is selected from the group consisting of: tumor necrosis factor (TNF) family members, immunoglobulin (Ig) superfamily members, and combinations thereof. In some embodiments, the TNF family members are selected from the group consisting of: 4-1BBL, OX40L, CD70, FasL, GITRL, TNF-associated apoptosis-inducing ligand (TRAIL), CD30L, LIGHT (TNFSF14), and CD40L. In some embodiments, the Ig superfamily members are selected from the group consisting of: CD80, CD86, ICOSLG, and combinations thereof. In some embodiments, the at least one exogenous costimulatory ligand comprises CD80. In some embodiments, the at least one exogenous costimulatory ligand comprises 4-1BBL. In some embodiments, the cell comprises two exogenous costimulatory ligands. In some embodiments, the at least two exogenous costimulatory ligands comprise CD80 and 4-1BBL. In some embodiments, the at least two exogenous co-stimulatory ligands comprise the amino acid sequence shown in SEQ ID NO:67 and / or the amino acid sequence shown in SEQ ID NO:69.

[0025] In some embodiments, the cell further comprises a fusion polypeptide comprising: a) an extracellular domain and a transmembrane domain of a costimulatory ligand, and b) an intracellular domain of a first costimulatory molecule. In some embodiments, the costimulatory ligand is selected from the group consisting of: members of the tumor necrosis factor (TNF) family, members of the immunoglobulin (Ig) superfamily, and combinations thereof. In some embodiments, the TNF family members are selected from the group consisting of: 4-1BBL, OX40L, CD70, GITRL, CD40L, and combinations thereof. In some embodiments, the Ig superfamily members are selected from the group consisting of: CD80, CD86, ICOSLG, and combinations thereof. In some embodiments, the costimulatory ligand is CD80. In some embodiments, the first costimulatory molecule is selected from the group consisting of: CD28, 4-1BB, OX40, ICOS, DAP-10, CD27, CD40, NKG2D, CD2, and combinations thereof. In some embodiments, the first costimulatory molecule is 4-1BB. In some embodiments, the co-stimulatory ligand is CD80 and the first co-stimulatory molecule is 4-1BB. In some embodiments, the fusion polypeptide comprises the amino acid sequence shown in SEQ ID NO:71. In some embodiments, the fusion polypeptide further comprises an intracellular domain of a second co-stimulatory molecule. In some embodiments, the second co-stimulatory molecule is selected from the group consisting of CD28, 4-1BB, OX40, ICOS, DAP-10, CD27, CD40, NKG2D, CD2, and combinations thereof. In some embodiments, the second co-stimulatory molecule is CD28. In some embodiments, the co-stimulatory ligand is CD80, the first co-stimulatory molecule is 4-1BB, and the second co-stimulatory molecule is CD28. In some embodiments, the fusion polypeptide comprises the amino acid sequence shown in SEQ ID NO:72.

[0026] In some embodiments, the cells are autologous. In other embodiments, the cells are allogeneic.

[0027] In some embodiments, the subject matter disclosed herein further provides compositions comprising the cells disclosed herein. In some embodiments, the compositions are pharmaceutical compositions further comprising pharmaceutically acceptable excipients.

[0028] In some embodiments, the subject matter disclosed in this application provides nucleic acid compositions, vectors, or lipid nanoparticles comprising: a first polynucleotide encoding a chimeric antigen receptor (CAR) targeting a first antigen; and a second polynucleotide encoding a TCR-like fusion molecule targeting a second antigen. In some embodiments, the subject matter disclosed in this application provides a vector comprising: a first polynucleotide encoding a chimeric antigen receptor (CAR) targeting a first antigen; and a second polynucleotide encoding a TCR-like fusion molecule targeting a second antigen. In some embodiments, the vector is a lentiviral vector. In some embodiments, the vector is a gamma retroviral vector.

[0029] In some embodiments, the subject matter disclosed herein provides polynucleotides encoding chimeric antigen receptors (CARs) targeting a first antigen and TCR-like fusion molecules targeting a second antigen. The subject matter disclosed herein also provides carriers and lipid nanoparticles comprising the polynucleotides disclosed herein.

[0030] In some embodiments, the subject matter disclosed herein provides compositions comprising the polynucleotides, carriers, and lipid nanoparticles disclosed herein. In some embodiments, the compositions are pharmaceutical compositions further comprising pharmaceutically acceptable excipients.

[0031] In some embodiments, the subject matter disclosed herein provides methods for generating the immune response cells disclosed herein. In some embodiments, the method includes introducing the nucleic acid composition, polynucleotide, carrier, or lipid nanoparticle disclosed herein into the immune response cells.

[0032] In some embodiments, the method further includes: generating gene disruption at the CD70 locus. In some embodiments, the method further includes: generating gene disruption at the TRAC locus. In some embodiments, gene disruption includes substitution, deletion, insertion, mutation, or a combination thereof. In some embodiments, mutation includes missense mutation, nonsense mutation, or a combination thereof. In some embodiments, deletion includes non-frameshift deletion, frameshift deletion, or a combination thereof. In some embodiments, insertion includes non-frameshift insertion, frameshift insertion, or a combination thereof. In some embodiments, gene disruption at the CD70 locus causes non-functional CD70 protein or causes knockout of CD70 gene expression. In some embodiments, gene disruption at the CD70 locus causes non-functional TRAC protein or causes knockout of TRAC gene expression.

[0033] In some embodiments, generating gene disruption includes gene editing methods, said gene editing methods including: homologous recombination, zinc finger nucleases, large-scale nucleases, transcription activator-like effector nucleases (TALENs), clustered regularly spaced short palindromic repeats (CRISPR) systems, or combinations thereof.

[0034] In some embodiments, gene disruption at the CD70 or TRAC locus is generated prior to cell activation. In some embodiments, gene disruption at the CD70 or TRAC locus is generated after cell activation. In some embodiments, a) gene disruption at the CD70 locus is generated prior to cell activation, and b) gene disruption at the TRAC locus is generated after cell activation. In some embodiments, a) gene disruption at the TRAC locus is generated prior to cell activation, and b) gene disruption at the CD70 locus is generated after cell activation.

[0035] In some embodiments, the method further includes: generating a gene modification of the CD70 gene. In some embodiments, the method further includes: generating a gene modification of the TRAC gene and / or the TRBC gene. In some embodiments, the method further includes: the gene modification of the CD70 gene causing a non-functional CD70 protein or causing knockdown of CD70 gene expression. In some embodiments, the method further includes: the gene modification of the TRAC locus causing a non-functional TRAC protein or causing knockdown of TRAC gene expression. In some embodiments, the method further includes: the gene modification of the TRBC locus causing a non-functional TRBC protein or causing knockdown of TRBC gene expression.

[0036] In some embodiments, the method further includes introducing a chimeric co-mimicking receptor (CCR). In some embodiments, the method further includes introducing at least one exogenous co-stimulatory ligand. In some embodiments, the method further includes introducing a fusion polypeptide comprising: a) an extracellular domain and a transmembrane domain of the co-stimulatory ligand, and b) an intracellular domain of the first co-stimulatory molecule.

[0037] In some embodiments, the subject matter disclosed herein provides immune response cells generated by the methods disclosed herein.

[0038] In some embodiments, the subject matter disclosed herein provides methods for reducing tumor burden, treating and / or preventing vegetations or tumors, preventing and / or treating pathogen infections, preventing and / or treating autoimmune diseases, and / or preventing and / or treating infectious diseases in subjects using the immune response cells or compositions disclosed herein.

[0039] In some embodiments, the growth or tumor is cancer. In some embodiments, the growth or tumor contains antigenic heterogeneity of a first antigen and a second antigen. In some embodiments, the second antigen has a low antigen density. In some embodiments, the second antigen is expressed on tumor cells with a low tumor cell frequency. In some embodiments, the first antigen and the second antigen are independently selected from the group consisting of: CD19, CD70, IL1RAP, ABCG2, AChR, ACKR6, ADAMTS13, ADGRE2, ADGRE2(EMR2), ADORA3, ADRA1D, AGER, ALS2, antigen of cytomegalovirus (CMV) infected cells, ANO9, AQP2, ASIC3, ASPRV1, ATP6V0A4, B3GNT4, B7-H3, BCMA, BEST4, C3orf35, CADM3, CAIX, CAPN3, CCDC155 , CCR1, CD10, CD117, CD123, CD133, CD135(FLT3), CD138, CD20, CD22, CD244(2B4), CD25, CD26, CD30, CD300LF, CD312, CD32, CD321, CD33 , CD34, CD36, CD38, CD41, CD44, CD44V6, CD47, CD49f, CD56, CD7, CD71, CD74, CD8, CD82, CD96, CD98, CD99, CDH13, CDHR1, CEA, CEACAM6, CH ST3, CLEC12A, CLEC1A, CLL1, CNIH2, COL15A1, COLEC12, CPM, CR1, CX3CR1, CXCR4, CYP4F11, DAGLB, DARC, DFNB31, DGKI, EGF1R, EGFR-VIII, EGP-2, EGP-40, ELOVL6, EMB, EMC10, EMR2, ENG, EpCAM, EphA2, EPHA4, ERBB, ERBB2, Erb-B3, Erb-B4, E-selectin, EXOC3L4, EXTL3, FAM186B FBP, FCGR1A, FKBP1B, FLRT1, folate receptor-α, FOLR2, FRMD5, GABRB2, GAS2, GD2, GD3, GDPD3, GNA14, GNAZ, GPR153, GPR56, GYPA, HEPHL1, HER-2, hERT, HILPDA, HLA-DR, HOOK1, hTERT, HTR2A, ICAM1, IGFBP3, IL10RB, IL20RB, IL23R, ILDR1, interleukin-13 receptor subunit α-2 (IL-13Rα2), ITFG3, ITGA4ITGA5, ITGA8, ITGAX, ITGB5, ITGB8, JAM3, KCND1, KCNJ5, KCNK13, KCNN4, KCNV2, KDR, KIF19, KIF26B, kappa-light chain, L1CAM, LAX1, LEPR, Lewis Y(CD174), Lewis Y (LeY), LILRA2, LILRA6, LILRB2, LILRB3, LILRB4, LOXL4, LPAR2, LRRC37A3, LRRC8E, LRRN2, LLRTM2, LTB4R, MAGE-A1, MAGEA3, MANSC1, MART1, GP100, MBOAT1, MBOAT7, Melanoma Antigen Family A, Mesothelin (MSLN), MFAP3L, MMP25, MRP1, MT-ND1, Mucin 1 (MUC1), Mucin 16 (MUC16), MYADM, MYADML 2. NGFR, NKCS1, NKG2D ligand, NLGN3, NPAS2, NY-ESO-1, onco-embryonic antigen (h5T4), OTOA, P2RY13, p53, PDE3A, PEAR1, PIEZO1, PLXNA4, PLXNC1, PNPLA3, PPFIA4, PPP2R5B, PRAME, PRAME, prostate stem cell antigen (PSCA), prostate-specific membrane antigen (PSMA), proteinase 3 (PR1), PSD2, PTPRJ, RDH16, receptor tyrosine protein kinase Erb-B2, RHBDL3, RNF173, RNF183, ROR1, RYR2, SCIN, SCN11A, SCN2A, SCNN1D, SEC31B, SEMA4A, SH3PXD2A, SIGLEC11, SIRPB1, SLC16A6, SLC19A1, SLC22 A5, SLC25A36, SLC25A41, SLC30A1, SLC34A3, SLC43A3, SLC44A1, SLC44A3, SLC45A3, SLC6A16, SLC6A6, SLC8A3, SLC9A1, SLCO2B1, SPA G17, STC1, STON2, SUN3, Survivin, SUSD2, SYNC, TACSTD2, TAS1R3, TEX29, TFR2, TIM-3 (HAVCR2), TLR2, TMEFF2, TMEM145, TMEM27, TMEM40, TMEM59L, TMEM89, TMPRSS5, TNFRSF14, TNFRSF1B, TRIM55, TSPEAR, TTYH3, Tumor-associated glycoprotein 72 (TAG-72), Tyrosinase, Vascular endothelial growth factor R2 (VEGF-R2), VLA-4Wilms tumor proteins (WT-1), WNT4, WT1, and ZDHHC11. In some embodiments, the first antigen is selected from the group consisting of: CD312, CD19, CD20, CD22, CD276, and CAIX. In some embodiments, the second antigen is selected from the group consisting of: CD70, CD19, CD20, and CD22. In some embodiments, the first and second antigens are selected from: a) CD312 and CD70; b) CD276 and CD70; c) CAIX and CD70; d) CD19 and CD22; e) CD19 and CD20; f) CD20 and CD22; g) CD20 and CD19; h) CD22 and CD20; or i) CD22 and CD19. In some embodiments, the first and second antigens are selected from Table 8.

[0040] In some embodiments, the growth or tumor is a solid tumor. In some embodiments, the solid tumor is selected from the group consisting of: melanoma, renal cell carcinoma, non-small cell lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, lung neuroendocrine carcinoma, small cell lung cancer, pancreatic cancer, breast cancer, astrocytoma, glioblastoma, laryngeal / pharyngeal carcinoma, EBV-related nasopharyngeal carcinoma, and ovarian cancer. In some embodiments, the solid tumor is melanoma.

[0041] In some embodiments, the growth or tumor is a blood cancer. In some embodiments, the growth or tumor is a bone marrow disorder. In some embodiments, the bone marrow disorder is selected from the group consisting of: myelodysplastic syndromes, myeloproliferative growths, chronic myelomonocytic leukemia or acute myeloid leukemia (AML), blastic plasmacytoid dendritic cell growths, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, chronic myeloid leukemia, and polycythemia vera. In some embodiments, the bone marrow disorder is acute myeloid leukemia (AML).

[0042] In some embodiments, the growth or tumor is a B-cell malignancy. In some embodiments, the B-cell malignancy is selected from the group consisting of: B-cell non-Hodgkin lymphoma (NHL), B-cell Hodgkin lymphoma, B-cell acute lymphoblastic leukemia (ALL), B-cell chronic lymphoblastic leukemia (CLL), multiple myeloma (MM), CLL with Richter transformation, and CNS lymphoma. In some embodiments, the B-cell malignancy is B-cell acute lymphoblastic leukemia.

[0043] In some embodiments, the growth or tumor is leukemia. In some embodiments, the leukemia is selected from the group consisting of: acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute promyelocytic leukemia (APL), mixed phenotype acute leukemia (MLL), hairy cell leukemia, B-cell prolymphoblastic leukemia, B-cell precursor acute lymphoblastic leukemia, and T-cell precursor acute lymphoblastic leukemia.

[0044] In some embodiments, the growth or tumor is a lymphoma. In some embodiments, the lymphoma is selected from the group consisting of: Hodgkin lymphoma, non-Hodgkin lymphoma, B-cell non-Hodgkin lymphoma, T-cell non-Hodgkin lymphoma, and T-cell precursor acute lymphoblastic lymphoma.

[0045] In some embodiments, the subject has a growth or recurrence of tumor. In some embodiments, the subject has received treatment that has caused residual tumor cells.

[0046] In some embodiments, the subject matter disclosed herein provides a kit comprising the cells or compositions disclosed herein. In some embodiments, the kit further comprises written instructions for: reducing tumor burden, treating and / or preventing vegetations or tumors, preventing and / or treating pathogen infections, preventing and / or treating autoimmune diseases, and / or preventing and / or treating infectious diseases. Attached Figure Description

[0047] The following detailed description, given by way of example but not intended to limit the subject matter disclosed herein to the specific embodiments described, can be understood in conjunction with the accompanying drawings.

[0048] Figure 1 FACS analysis of a CD70-targeting TCR-like fusion molecule (“70HIT”) is described, which is expressed from the TRAC locus under the control of an endogenous TRAC promoter (“TRAC-70HIT”) or from an SFG vector (“SFG-70HIT”).

[0049] Figure 2A and Figure 2B The effects of TRAC-70HIT and SFG-70HIT on the MOLM13 AML xenograft model were described. Figure 2A This demonstrates tumor quantification based on bioluminescence. Figure 2B Survival curves are shown.

[0050] Figures 3A to 3C The effects of SFG-70HIT in a patient-derived AML xenograft model were described. Figure 3AThe analysis of peripheral blood cells by FACS analysis and AML burden is shown. Figure 2B The total T cell count is shown. Figure 3C The FACS analysis on day 20 post-injection is shown.

[0051] Figure 4 FACS analysis of MOL13 wild-type and edited cells was described to model target heterogeneity in AML.

[0052] Figures 5A to 5C The impact of 70H_312C-28z1XX on the AML heterogeneity model was depicted. Figure 5A FACS analysis of the AML heterogeneity model is shown. Figure 5B This demonstrates tumor quantification based on bioluminescence. Figure 5C Survival curves are shown.

[0053] Figures 6A to 6C The impact of 70H_312C-28z1XX on AML heterogeneity models compared to alternative HIT+CAR designs is depicted. Figure 6A FACS analysis of the AML heterogeneity model is shown. Figure 6B This demonstrates tumor quantification based on bioluminescence. Figure 6C Survival curves are shown.

[0054] Figures 7A to 7C The impact of 70H_312C-28z1XX on AML heterogeneity models compared to alternative dual CAR methods is described. Figure 7A FACS analysis of the AML heterogeneity model is shown. Figure 7B This demonstrates tumor quantification based on bioluminescence. Figure 7C Survival curves are shown.

[0055] Figure 8A and Figure 8B The study demonstrated that SFG-70HIT+312CAR-1XX was associated with a less differentiated T-cell phenotype compared to CAR+CAR. Figure 8A CD8 differentiation is shown. Figure 8B CD4 differentiation is shown.

[0056] Figures 9A to 9C It was shown that SFG-70HIT+312CAR-1XX is effective across various heterogeneous phenotypes. Figure 9A FACS analysis of CD70 and CD312 in different tested heterologous phenotypes is shown. Figure 9B This demonstrates tumor quantification based on bioluminescence. Figure 9C Survival curves are shown.

[0057] Figure 10 A to Figure 10 C describes the editing strategy for manufacturing the 70H+312C platform. Figure 10 A shows the current standard. Figure 10 B illustrates a first alternative strategy that includes electroporation on day 0. Figure 10 C illustrates a sequential editing strategy for avoiding transposition.

[0058] Figure 11A and Figure 11B The effects of different editing strategies for manufacturing on the 70H+312C platform on AML tumor models were depicted. Figure 11A The impact on the MOLM13-WT model is shown. Figure 11B The impact on the AML heterogeneity model is shown.

[0059] Figures 12A to 12D The impact of the HIT+CAR strategy on solid tumor models was described. Figure 12A FACS analysis of CD70 and CD276 in the human melanoma cell line SK-MEL37 is shown. Figure 12B The effects in a lung metastatic melanoma model are shown. Figure 12C The effects are shown in an in situ skin melanoma model. Figure 12D FACS analysis of the AML heterogeneity model is shown.

[0060] Figures 13A to 13C The effects of the HIT+CAR strategy on a renal cell carcinoma model were described. Figure 13A The effects in the K5 orthotopic renal tumor model are shown. Figure 13B The effects in the K7 orthotopic renal tumor model are shown. Figure 13C Bioluminescence-based tumor quantification is shown for K5 and K7 tumor models.

[0061] Figures 14A to 14D The efficacy of the cell (HIT+CAR) activity disclosed in this paper is described in the B-ALL environment. Figure 14A Analysis is shown for the following: Nalm6 xenograft cells with wild-type (WT) levels of CD22 and CD19; first Nalm6 xenograft heterogeneous cells comprising knockout of Nalm6 cells in a 1:1 ratio (1:1) for CD19 (Nalm6-19KO) and CD22 (Nalm6-22KO); and second Nalm6 xenograft heterogeneous cells comprising WT, Nalm6-19KO, and Nalm6-22KO in a 1:1:1 ratio (1:1:1). Figure 14BSurvival curves of animals challenged with the above-described Nalm6 xenograft cells and receiving the following 5E5 T cells are shown: the cells contain a HIT receptor targeting CD19 and a 1XX CAR targeting CD22 (19-HIT+22-CAR-1XX) or a first CAR targeting CD19 and containing a 4-1BB / CD3ζ intracellular domain and a 1XX CAR targeting CD22 (19-CAR-BBz+22-CAR-1XX). Figure 14C Analysis of Nalm6 xenograft cells is shown, which include WT cells (WT), Nalm6-19KO cells (19-KO), and Nalm6-22KO cells (22-KO) at indicated percentage values. Figure 14D It shows that it contains Figure 14C Survival curves of animals that received Nalm6 xenografted cells and received 5E5 T cells containing 19-HIT+22-CAR-1XX or 19-CAR-BBz+22-CAR-1XX.

[0062] Figure 15 Survival curves of animals containing the aforementioned Nalm6 xenograft cells and receiving 1E6 T cells containing 19-HIT+22-CAR-1XX, 19-CAR-BBz+22-CAR-1XX, or T cells expressing a single receptor are shown.

[0063] Figures 16A to 16J Phenotypic and biochemical characterization of T cells in mouse models receiving 19-HIT+22-CAR-1XX or 19-CAR-BBz+22-CAR-1XX were depicted. Figure 16A The analysis of tumor burden determined by bioluminescence imaging is shown in animals attacked with 1:1:1 Nalm6 tumor cells and given different doses (5E5 or 1E6) of T cells containing 19-HIT+22-CAR-1XX or 19-CAR-BBz+22-CAR-1XX. Figure 16B This demonstrates the effect of Nalm6-GFP expressing CD19 and / or CD22 in bone marrow 10 days after administration of 5E5 T cells containing either 19-HIT+22-CAR-1XX(H+C) or 19-CAR-BBz+22-CAR-1XX(C+C). + Quantitatively. Figure 16C This demonstrates the effect of Nalm6-GFP expressing CD19 and / or CD22 in bone marrow 16 days after administration of 5E5 T cells containing either 19-HIT+22-CAR-1XX(H+C) or 19-CAR-BBz+22-CAR-1XX(C+C). + Quantitatively. Figure 16DThe study showed CD8 levels in the bone marrow and spleen of mice attacked with 1:1:1 Nalm6 tumors 10 and 16 days after administration of 5E5 T cells containing either 19-HIT+22-CAR-1XX(H+C) or 19-CAR-BBz+22-CAR-1XX(C+C). + and CD4 + T cell count. Figure 16E The study showed CD8 levels in the bone marrow and spleen of mice attacked with 1:1:1 Nalm6 tumors 10 and 16 days after administration of 5E5 T cells containing either 19-HIT+22-CAR-1XX(H+C) or 19-CAR-BBz+22-CAR-1XX(C+C). + T cell phenotype. Figure 16F The study showed CD4 counts in the bone marrow and spleen of mice attacked with 1:1:1 Nalm6 tumors 10 and 16 days after administration of 5E5 T cells containing either 19-HIT+22-CAR-1XX(H+C) or 19-CAR-BBz+22-CAR-1XX(C+C). + T cell phenotype. Figure 16G The study showed CD8 levels in the bone marrow and spleen of mice attacked with 1:1:1 Nalm6 tumors 10 and 16 days after administration of 5E5 T cells containing either 19-HIT+22-CAR-1XX(H+C) or 19-CAR-BBz+22-CAR-1XX(C+C). + T cell depletion phenotype. Figure 16H The study showed CD4 counts in the bone marrow and spleen of mice attacked with 1:1:1 Nalm6 tumors 10 and 16 days after administration of 5E5 T cells containing either 19-HIT+22-CAR-1XX(H+C) or 19-CAR-BBz+22-CAR-1XX(C+C). + T cell depletion phenotype. Figure 16I The study showed CD8 levels in the bone marrow and spleen of mice attacked with 1:1:1 Nalm6 tumors 10 and 16 days after administration of 5E5 T cells containing either 19-HIT+22-CAR-1XX(H+C) or 19-CAR-BBz+22-CAR-1XX(C+C). + Expression of cell depletion markers in T cells. Figure 16J The study showed CD4 counts in the bone marrow and spleen of mice attacked with 1:1:1 Nalm6 tumors 10 and 16 days after administration of 5E5 T cells containing either 19-HIT+22-CAR-1XX(H+C) or 19-CAR-BBz+22-CAR-1XX(C+C). + Expression of cell depletion markers in T cells. Detailed Implementation

[0064] The subject matter disclosed in this application provides compositions (e.g., modified immune cells) that can be used in immunotherapy (e.g., T-cell immunotherapy). The compositions (e.g., modified immune cells) disclosed in this application comprise: (1) a chimeric antigen receptor (CAR) targeting a first antigen; and (2) a TCR-like fusion molecule targeting a second antigen. The subject matter disclosed in this application also provides methods for producing such compositions, and methods for using such compositions to treat and / or prevent tumors (e.g., cancers, such as solid tumors or blood cancers, such as bone marrow disorders, such as acute myeloid leukemia (AML)). The subject matter disclosed in this application is based at least in part on the finding that gated targeting methods including HIT and CAR can address antigenic heterogeneity (i.e., the presence of tumor cell populations with mixed phenotypes, including tumor cells with low antigen density or low tumor cell frequency). Co-expression of HIT and CAR against two independent target antigens can enhance at least one activity of the cell, such as cytotoxicity, cell proliferation, and / or cell persistence. Furthermore, co-expression of HIT and CAR reduces the cumulative co-stimulation that drives excessive T cell differentiation and limits functional durability.

[0065] This specification and examples describe non-limiting embodiments of the subject matter disclosed in this application.

[0066] For clarity and not limitation, this detailed description is divided into the following sub-sections:

[0067] 1. Definition;

[0068] 2. Cell;

[0069] 3. Nucleic acid compositions and vectors;

[0070] 4. Preparation and application;

[0071] 5. Treatment methods;

[0072] 6. Reagent kit; and

[0073] 7. Exemplary embodiment.

[0074] 1. Definition

[0075] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The following references provide those skilled in the art with general definitions of many of the terms used in the subject matter disclosed herein: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd edition, 1994); The Cambridge Dictionary of Science and Technology (Walker, ed., 1988); The Glossary of Genetics, 5th edition, R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991).

[0076] As used herein, the terms “about” or “approximately” mean within an acceptable margin of error for a particular value, as determined by one of ordinary skill in the art, which will depend in part on how the value was measured or determined, i.e., the limitations of the measurement system. For example, “about” may mean within three or more standard deviations according to practice in the art. Alternatively, “about” may mean a range of up to 20%, for example up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly for biological systems or processes, the term may mean within orders of magnitude of the value, for example, within five times or within two times.

[0077] As used herein, a "co-stimulatory molecule" refers to a cell surface molecule, other than an antigen receptor or its ligand, that can provide a highly efficient lymphocyte response to an antigen. In some embodiments, co-stimulatory molecules can provide optimal lymphocyte activation.

[0078] As used herein, a “co-stimulatory ligand” refers to a molecule that, when bound to its receptor (e.g., a co-stimulatory molecule), produces a co-stimulatory response, such as an intracellular response, which influences the stimulation provided when an antigen recognition receptor (e.g., a chimeric antigen receptor (CAR)) binds to its target antigen.

[0079] "Immune-response cells" refers to cells that play a role in an immune response, or their ancestors or descendants. In some embodiments, immune-response cells are lymphoid cells. Non-limiting examples of lymphoid cells include T cells, natural killer (NK) cells, B cells, and stem cells from which lymphoid cells can differentiate. In some embodiments, immune-response cells are myeloid cells.

[0080] "Activating immune-response cells" refers to inducing changes in signal transduction or protein expression in cells, leading to the initiation of an immune response. For example, a signal transduction cascade occurs when the CD3 chain responds to ligand binding and aggregates with an immune receptor based on a tyrosine-based inhibitory motif (ITAM). In some embodiments, when an endogenous TCR or exogenous CAR binds to an antigen, an immune synapse forms, involving the aggregation of numerous molecules near the bound receptor (e.g., CD4 or CD8, CD3γ / δ / ε / ζ, etc.). This aggregation of membrane-bound signaling molecules leads to phosphorylation of the ITAM motif contained within the CD3 chain. This phosphorylation, in turn, initiates T cell activation pathways, ultimately activating transcription factors such as NF-κB and AP-1. These transcription factors induce overall gene expression in T cells to increase IL-2 production, which is used to master the regulation of T cell protein proliferation and expression, thereby initiating a T cell-mediated immune response.

[0081] "Stimulating immune response cells" refers to signals that lead to robust and sustained immune responses. In various embodiments, this occurs after or concurrently with the activation of immune cells (e.g., T cells) via receptors mediated by receptors including, but not limited to, CD28, CD137 (4-1BB), OX40, CD40, ICOS, DAP-10, CD27, NKG2D, CD2, CD150, and CD226. Receiving multiple stimulatory signals can be important for establishing robust and long-lasting T cell-mediated immune responses. T cells may be rapidly suppressed and unresponsive to antigens. While the effects of these co-stimulatory signals may differ, they generally result in increased gene expression to produce long-lived, proliferating, and anti-apoptotic T cells that produce robust responses to antigens for complete and sustained eradication.

[0082] As used herein, the term “antigenic heterogeneity” refers to the differential expression of many antigens (e.g., tumor antigens, such as CD70 and CD312) that cause changes in tumor cell phenotype and the distribution of tumor antigen-positive cells.

[0083] As used herein, the term "low antigen density" refers to a target molecule (e.g., an antigen) having a cell surface density of less than about 5,000 molecules / cell. In some embodiments, low antigen density is a cell surface density of less than about 4,000 molecules / cell, less than about 3,000 molecules / cell, less than about 2,000 molecules / cell, less than about 1,500 molecules / cell, less than about 1,000 molecules / cell, less than about 500 molecules / cell, less than about 200 molecules / cell, or less than about 100 molecules / cell. In some embodiments, low antigen density is a cell surface density of less than about 2,000 molecules / cell. In some embodiments, low antigen density is a cell surface density of less than about 1,500 molecules / cell. In some embodiments, low antigen density is a cell surface density of less than about 1,000 molecules / cell. In some embodiments, low antigen density is a cell surface density between about 4,000 molecules / cell and about 2,000 molecules / cell, between about 2,000 molecules / cell and about 1,000 molecules / cell, between about 1,500 molecules / cell and about 1,000 molecules / cell, between about 2,000 molecules / cell and about 500 molecules / cell, between about 1,000 molecules / cell and about 200 molecules / cell, or between about 1,000 molecules / cell and about 100 molecules / cell.

[0084] As used herein, the term "low tumor cell frequency" refers to target cells having a target cell frequency of less than about 50% / tumor. In some embodiments, a low tumor cell frequency is less than about 40% / tumor, less than about 30% / tumor, less than about 20% / tumor, less than about 15% / tumor, less than about 10% / tumor, less than about 5% / tumor, less than about 2% / tumor, or less than about 1% / tumor. In some embodiments, a low tumor cell frequency is less than about 2% / tumor. In some embodiments, a low tumor cell frequency is less than about 1.5% / tumor. In some embodiments, a low tumor cell frequency is less than about 1% / tumor. In some embodiments, a low tumor cell frequency is between about 40% / tumor and about 20% / tumor, between about 20% / tumor and about 10% / tumor, between about 15% / tumor and about 10% / tumor, between about 20% / tumor and about 5% / tumor, between about 10% / tumor and about 2% / tumor, or between about 10% / tumor and about 1% / tumor.

[0085] As used herein, the term "antigen recognition receptor" refers to a receptor that can activate immune or immune response cells (e.g., T cells) in response to its binding to an antigen.

[0086] As used herein, the term “antibody” refers not only to the complete antibody molecule but also to a fragment of an antibody molecule that retains the ability to bind to immunogens. Such fragments are well known in the art and are commonly used in vitro and in vivo. Thus, as used herein, the term “antibody” refers not only to the complete immunoglobulin molecule but also to the well-known active fragments F(ab')2 and Fab. F(ab')2 and Fab fragments lacking the complete antibody’s Fe fragment are cleared from circulation more quickly and may have less nonspecific tissue binding to the complete antibody (Wahl et al., J. Nucl. Med. 24:316-325 (1983)). As used herein, antibodies include complete natural antibodies, bispecific antibodies; chimeric antibodies; Fab, Fab', single-chain variable fragments (scFv), fusion peptides, and unconventional antibodies. In some embodiments, an “antibody” is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains linked by disulfide bonds. Each heavy chain contains a heavy chain variable region (abbreviated herein as V). H ) and heavy chain constant (C H The heavy chain constant region contains three domains: CH1, CH2, and CH3. Each light chain contains a light chain variable region (abbreviated as V in this paper). L ) and light chain constant C L The light chain constant region contains a structural domain, C. L V H and V L The region can be further subdivided into highly variable regions known as complementarity-determining regions (CDRs), interspersed with more conservative regions known as framework regions (FRs). Each V H and V L It consists of three CDRs and four FRs arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain binding domains that interact with the antigen. The constant regions of the antibody can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1 q) of the classical complement system.

[0087] As used herein, “CDR” is defined as the complementarity-determining region (CDR) amino acid sequence of an antibody, which is a hypervariable region of the immunoglobulin heavy and light chains. See, for example, Kabat et al., Sequences of Proteins of Immunological Interest, 4th USDepartment of Health and Human Services, National Institutes of Health (1987). Typically, antibodies comprise three heavy chain and three light chain CDRs or CDR regions in the variable region. The CDR provides most of the contact residues for the antibody to bind to the antigen or epitope. In some embodiments, the Kabat system is used to describe CDR regions (Kabat, EA, et al. (1991) Sequences of Proteins of Immunological Interest, 5th ed., USDepartment of Health and Human Services, Publication No. 91-3242). In some embodiments, the PyIgClassify system is used to describe CDR regions (Adolf-Bryfogle et al., Nucleic acids research 43.D1 (2015): D432-D438).

[0088] As used herein, the term "connector" should be understood to mean a functional group (e.g., a chemical substance or polypeptide) that covalently attaches two or more polypeptides or nucleic acids to link them together. As used herein, "peptide connector" refers to a linker used to couple two proteins together (e.g., for coupling V...). H and V L One or more amino acids (domains). In some embodiments, the linker is a G4S linker. In some embodiments, the linker comprises or consists of the amino acid sequence shown in SEQ ID NO:1, which is provided below:

[0089] GGGGSGGGGSGGGGS[SEQ ID NO:1]

[0090] In some embodiments, the connector comprises or consists of the amino acid sequence shown in SEQ ID NO:2, which is provided below:

[0091] GGGGSGGGGSGGGSGGGGS[SEQ ID NO:2]

[0092] In some embodiments, the connector comprises or consists of the amino acid sequence shown in SEQ ID NO:3, which is provided below:

[0093] GGGGSGGGGSGGGGSGGGSGGGGS[SEQ ID NO:3]

[0094] In some embodiments, the connector comprises or consists of the amino acid sequence shown in SEQ ID NO:4, which is provided below:

[0095] GGGGSGGGGSGGGGSGGGGSGGGSGGGGS[SEQ ID NO:4]

[0096] In some embodiments, the connector comprises or consists of the amino acid sequence shown in SEQ ID NO:5, which is provided below:

[0097] GGGGS [SEQ ID NO:5]

[0098] In some embodiments, the connector comprises or consists of the amino acid sequence shown in SEQ ID NO:6, which is provided below:

[0099] GGGGSGGGGS[SEQ ID NO:6]

[0100] As used in this article, the term "single-chain variable fragment" or "scFv" refers to a covalently linked structure that forms a V. H ::V L The heavy chain of heterodimeric immunoglobulins (V H ) and light chains (V L A fusion protein of the variable region of V. H and V L Direct binding or binding via a peptide-encoded linker (e.g., 10, 15, 20, or 25 amino acids), the peptide-encoded linker will bind V H N-terminus and V L Connect the C end, or connect the V end. H C-terminus and V L The linker is attached to the N-terminus. The linker is typically enriched with glycine for flexibility and serine or threonine for solubility. Despite the removal of the constant region and the introduction of the linker, scFv proteins retain the specificity of the original immunoglobulin. Single-chain Fv polypeptide antibodies can be formed from proteins containing V... H and V LNucleic acid expression of the coding sequence, as described by Huston et al. (Proc. Nat. Acad. Sci. USA, 85:5879-5883, 1988). See also U.S. Patent Nos. 5,091,513, 5,132,405, and 4,956,778; and U.S. Patent Nos. 20050196754 and 20050196754. Antagonistic scFvs with inhibitory activity have been described (see, for example, Zhao et al., Hyrbidoma (Larchmt) 2008 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 Aug 12; Shieh et al., J Imunol 2009 183(4):2277-85; Giomalli et al., Thromb Haemost 2007 97(6):955-63; Fife et al., J Clin Invst 2006 116(8):2252-61; Brocks et al., Immunotechnology 1997 3(3):173-84; Moosmayer et al., Ther Immunol 1995 2(10:31-40). Agonistic scFvs with stimulatory activity have been described (see, for example, Peter et al., J Bioi Chern 2003). 25278(38):36740-7; Xie et al., Nat Biotech 1997 15(8):768-71; Ledbetter et al., Crit Rev Immunol 1997 17(5-6):427-55; Ho et al., BioChim Biophys Acta 2003 1638(3):257-66).

[0101] As used herein, the term "affinity" refers to a measure of binding strength. Affinity can depend on the proximity of the stereochemical match between the antibody binding site and the antigenic determinant, the size of the contact area between them, and / or the distribution of charged and hydrophobic groups. As used herein, the term "affinity" also includes "affinity," which refers to the strength of the antigen-antibody bond after the formation of a reversible complex. Methods for calculating the affinity of an antibody for an antigen are known in the art, including but not limited to various antigen binding experiments, such as functional assays (e.g., flow cytometry assays).

[0102] As used herein, the term "chimeric antigen receptor" or "CAR" refers to a molecule comprising an extracellular antigen-binding domain and a transmembrane domain, the extracellular antigen-binding domain being fused to an intracellular signaling domain capable of activating or stimulating immune or immune-response cells. In some embodiments, the extracellular antigen-binding domain of the CAR comprises an scFv. The scFv may be derived from the fusion of variable heavy and light chain regions of an antibody. Alternatively or additionally, the scFv may be derived from Fab' (instead of from an antibody, e.g., obtained from a Fab library). In some embodiments, the scFv is fused to the transmembrane domain and then to the intracellular signaling domain. In some embodiments, the CAR is selected to have high binding affinity or affinity for the antigen.

[0103] As used herein, the terms "substantially identical" or "substantially homologous" mean that a polypeptide or nucleic acid molecule exhibits at least about 50% identity or homology with a reference amino acid sequence (e.g., any amino acid sequence described herein) or a reference nucleic acid sequence (e.g., any nucleic acid sequence described herein). In some embodiments, such sequences are at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or at least about 100% identical or homologous to the amino acid or nucleic acid sequence used for comparison.

[0104] Sequence identity can be measured using sequence analysis software, such as the BLAST, BESTFIT, GAP, or PILEUP / PRETTYBOX sequence analysis packages available at the Genetic Computing Group, University of Wisconsin-Madison Biotechnology Center, 1710 University Avenue, Wisconsin-Madison, 53705. Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and / or other modifications. Conserved substitutions typically include those within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary method for determining the degree of identity, the BLAST program can be used, with probability scores between e-3 and e-100 indicating closely related sequences.

[0105] The percentage of homology between two amino acid sequences can be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl. Biosci., 4:11-17 (1988)) (incorporated into the ALIGN program (version 2.0)) with a PAM120 weighted residue table, a vacancy length penalty of 12, and a vacancy penalty of 4. Alternatively, the percentage of homology between two amino acid sequences can be determined using the algorithm of Needleman and Wunsch (J. Mol. Biol. 48:444-453 (1970)) (incorporated into the GAP program in the GCG software package (available at www.gcg.com) with a Blossom 62 matrix or a PAM250 matrix and vacancy weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6. Alternatively or additionally, the amino acid sequence of the currently disclosed subject can be further used as a “query sequence” to search public databases to, for example, identify relevant sequences. Such searches can be performed using the XBLAST program (version 2.0) of Altschul et al. (1990) J.Mol.Biol.215:403-10. A BLAST protein search can be performed using the XBLAST program with a score of 50 and a word length of 3 to obtain amino acid sequences homologous to specific sequences disclosed herein (e.g., heavy and light chain variable region sequences). For vacancy-based alignments for comparative purposes, vacancy-based BLAST can be used, as described in: Altschul et al. (1997) Nucleic Acids Res.25(17):3389-3402. When using both the BLAST program and the vacancy-based BLAST program, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.

[0106] As used herein, the term "conserved sequence modification" refers to an amino acid modification that does not significantly affect or alter the binding properties of the antigen recognition receptor (e.g., the extracellular antigen-binding domain of a CAR) containing an amino acid sequence disclosed in this application. Conserved modifications can include amino acid substitutions, additions, and deletions. Modifications can be introduced into the extracellular antigen-binding domain of the currently disclosed CAR using standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Amino acids can be grouped according to their physicochemical properties, such as charge and polarity. Conserved amino acid substitution is the substitution of an amino acid residue by an amino acid from the same group. For example, amino acids can be classified by charge: positively charged amino acids include lysine, arginine, and histidine; negatively charged amino acids include aspartic acid and glutamic acid; and neutrally charged amino acids include alanine, asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In addition, amino acids can be classified by polarity: polar amino acids include arginine (basic polar), asparagine, aspartic acid (acidic polar), glutamic acid (acidic polar), glutamine, histidine (basic polar), lysine (basic polar), serine, threonine, and tyrosine; nonpolar amino acids include alanine, cysteine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, and valine. Therefore, one or more amino acid residues within the CDR region can be substituted by other amino acid residues from the same group, and the retained function of the altered antibody (i.e., the function described in (c) through (l) above) can be tested using the functional assays described herein. In some embodiments, no more than one, two, three, four, or five residues within a specific sequence or CDR region are altered.

[0107] "Disease" means any symptom, disease, or ailment that impairs or interferes with the normal function of cells, tissues, or organs (e.g., growths and cell pathogen infections).

[0108] "Effective amount" refers to an amount sufficient to have a therapeutic effect. In a particular embodiment, "effective amount" is an amount sufficient to stop, reduce, or inhibit the continued proliferation, growth, or metastasis (e.g., invasion or migration) of vegetations.

[0109] "Endogenous" refers to nucleic acid molecules or polypeptides that are normally expressed in cells or tissues.

[0110] "Exogenous" refers to nucleic acid molecules or peptides that are not endogenously present in cells. Therefore, the term "exogenous" encompasses any recombinant nucleic acid molecules or peptides expressed in cells, such as foreign, heterologous, and overexpressed nucleic acid molecules and peptides. "Exogenous" nucleic acids refer to nucleic acids that are not present in naturally occurring wild-type cells; for example, exogenous nucleic acids may differ from their endogenous counterparts in sequence, location / localization, or both. For clarity, exogenous nucleic acids may have the same or different sequences relative to their natural endogenous counterparts; they can be introduced into the cell itself or its progenitor cells through genetic engineering and may optionally be linked to alternative control sequences, such as non-natural promoters or secretory sequences.

[0111] "Increase" means a positive change of at least about 5%. The change can be about 5%, about 10%, about 25%, about 30%, about 50%, about 75%, about 100%, or more.

[0112] "Reduction" means a negative change of at least about 5%. The change can be about 5%, about 10%, about 25%, about 30%, about 50%, about 75%, or even about 100%.

[0113] The terms "isolated," "purified," or "biopure" refer to materials that are, to varying degrees, free from the normally associated components found in their native state. "Isolated" indicates the degree of separation from the original source or surrounding environment. "Purified" indicates a higher degree of separation than isolation. "Purified" or "biopure" proteins are sufficiently free of other materials such that any impurities do not materially affect the protein's biological properties or cause other adverse consequences. That is, a nucleic acid or peptide is purified if it is substantially free of cellular material, viral material, or culture medium when produced using recombinant DNA technology, or substantially free of chemical precursors or other chemicals during chemical synthesis. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high-performance liquid chromatography. The term "purified" can also mean that the nucleic acid or protein produces essentially a single band in the electrophoresis gel. For proteins that can be modified (e.g., phosphorylation or glycosylation), different modifications can produce different isolated proteins, which can be purified individually.

[0114] "Separated cells" refers to cells that are separated from the molecular and / or cellular components of their natural companion cells.

[0115] As used herein, the term "antigen-binding domain" refers to a domain that can specifically bind to a particular antigenic determinant or group of antigenic determinants present on a cell.

[0116] "Variation" or "malignant tumor" refers to a disease characterized by the pathological proliferation of cells or tissues and their subsequent migration to or invasion of other tissues or organs. Vesicle growth is typically uncontrolled and progressive, and occurs under conditions that do not induce or cause the cessation of normal cell proliferation. Vesicles can affect a variety of cell types, tissues, or organs, including but not limited to organs or tissues or cell types selected from: bladder, bone, brain, chest, cartilage, glial tissue, esophagus, fallopian tubes, gallbladder, heart, intestine, kidney, liver, lungs, lymph nodes, nerve tissue, ovary, pancreas, prostate, skeletal muscle, skin, spinal cord, spleen, stomach, testes, thymus, thyroid gland, trachea, genitourinary tract, ureter, urethra, uterus, and vagina. Vesicles include cancers such as sarcomas, carcinomas, or plasmacytomas (malignant tumors of plasma cells). In some embodiments, the vegetation is cancer.

[0117] "Specific binding" means a polypeptide or fragment thereof that recognizes and binds to the biological molecule of interest (e.g., a polypeptide), but substantially does not recognize and bind to other molecules in a sample (e.g., a biological sample naturally containing the polypeptide disclosed in this application).

[0118] As used herein, the term "tumor antigen" refers to an antigen (e.g., a polypeptide) that is uniquely or differentially expressed on tumor cells compared to normal or non-negative cells. In some embodiments, tumor antigens include any polypeptide expressed by a tumor that can activate or induce an immune response via an antigen recognition receptor or that can inhibit an immune response via receptor-ligand binding.

[0119] The terms “comprises” and “comprising” are intended to have the broad meanings given to them under U.S. patent law and can mean “includes”, “including”, etc.

[0120] As used herein, “treatment” refers to a clinical intervention that attempts to alter the course of disease in the individual or cells receiving the treatment, and may be performed for prevention or in the course of clinicopathology. The efficacy of treatment includes, but is not limited to, preventing the onset or recurrence of disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, improving or alleviating the disease state, and alleviating or improving prognosis. By preventing the progression of disease or symptoms, treatment can prevent the deterioration of the condition in affected or diagnosed or suspected subjects, and treatment can also prevent the onset of the condition or symptoms in subjects at risk of or suspected of having the condition.

[0121] In this document, “individual” or “subject” refers to a vertebrate, such as a human, or a non-human animal, such as a mammal. Mammals include, but are not limited to, humans, primates, farm animals, livestock, rodents, and pets. Non-limiting examples of non-human animal subjects include: rodents such as mice, rats, hamsters, and guinea pigs; rabbits; dogs; cats; sheep; pigs; goats; cattle; horses; and non-human primates such as apes and monkeys. As used herein, the term “immunocompromised” refers to a subject suffering from an immunodeficiency. Subjects are highly susceptible to opportunistic infections, which are infections caused by organisms that would not normally cause disease in individuals with a healthy immune system but would affect individuals with a weakened or suppressed immune system.

[0122] As used herein, a “functional fragment” of a molecule or polypeptide includes a molecule or polypeptide fragment that retains at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% of the major function of the molecule or polypeptide.

[0123] Other aspects of the subject matter currently disclosed are described in the following disclosure and are within the scope of the subject matter currently disclosed.

[0124] 2. Cells

[0125] The subject matter disclosed in this application provides cells comprising: a) a first antigen recognition receptor targeting a first antigen, and b) a second antigen recognition receptor targeting a second antigen.

[0126] In some embodiments, the cells are selected from the group consisting of lymphoid cells and myeloid cells. In some embodiments, the cells are immune-response cells. In some embodiments, the immune-response cells are lymphoid cells.

[0127] In some embodiments, the cells are lymphoid cells. Lymphoid cells can produce antibodies, regulate the cellular immune system, detect foreign agents in the blood, detect foreign cells in the host, etc. Non-limiting examples of lymphoid cells include T cells, natural killer (NK) cells, B cells, dendritic cells, and stem cells from which lymphoid cells can differentiate. In some embodiments, the stem cells are pluripotent stem cells (e.g., embryonic stem cells).

[0128] In some embodiments, the cell is a T cell. T cells can be lymphocytes that mature in the thymus and are primarily responsible for cell-mediated immunity. T cells are involved in the adaptive immune system. The T cells disclosed in this application can be any type of T cell, including but not limited to helper T cells, cytotoxic T cells, memory T cells (including central memory T cells), stem cell-like memory T cells (or stem cell-like memory T cells), and two types of effector memory T cells: for example, T cells... EM Cells and T EMRAT cells include regulatory T cells (also known as suppressor T cells), tumor-infiltrating lymphocytes (TILs), natural killer T cells, mucosa-associated invariant T cells, and γδ T cells. Cytotoxic T cells (CTLs or killer T cells) are a subset of T lymphocytes that can induce death in infected somatic or tumor cells. T cells can be genetically modified to target specific antigens by introducing antigen recognition receptors (e.g., CARs or TCRs). T cells can be CD4+. + T cells or CD8 + T cells. In some embodiments, T cells are CD4+ cells. + T cells. In some embodiments, the T cells are CD8+ cells. + T cells. In some embodiments, CD8 + T cells are CD4-independent. In some embodiments, T cells are derived from induced pluripotent stem cells (iPSCs). In some embodiments, T cells are CD8-independent, independent of CD4. + T cells, and CD8 + T cells are derived from iPSCs.

[0129] In some embodiments, the T cells are CD62L. + T cells. In some embodiments, the T cells are CD45RA. + T cells. In some embodiments, the T cells are CD62L. + / CD45RA + T cells.

[0130] In some embodiments, the cells are NK cells. Natural killer (NK) cells can be lymphocytes that are part of cell-mediated immunity and play a role during the innate immune response. NK cells do not require prior activation to exert cytotoxic effects on target cells.

[0131] The types of human lymphocytes disclosed in this application include, but are not limited to, peripheral donor lymphocytes, such as those disclosed below: Sadelain, M., et al. 2003 Nat Rev Cancer 3:35-45 (discloses peripheral donor lymphocytes genetically modified to express CAR), Morgan, RA, et al. 2006 Science 314:126-129 (discloses peripheral donor lymphocytes genetically modified to express a full-length tumor antigen recognition T-cell receptor complex containing α and β heterodimers), Panelli, MC, et al. 2000 J Immunol 164:495-504; Panelli, MC, et al. 2000 J Immunol 164:4382-4392 (discloses lymphocyte cultures derived from tumor-infiltrating lymphocytes (TILs) in tumor biopsies), and Dupont, J., et al. 2005 Cancer Res 65:5417-5427; Papanicolaou, GA, et al. 2003 Blood 102:2498-2505 (discloses the selective in vitro expansion of antigen-specific peripheral blood leukocytes using artificial antigen-presenting cells (AAPC) or pulsed dendritic cells).

[0132] In some embodiments, the cells (e.g., T cells) are autologous. In some embodiments, the cells (e.g., T cells) are non-autologous. In some embodiments, the cells (e.g., T cells) are allogeneic. In some embodiments, the cells (e.g., T cells) are derived in vitro from engineered progenitor cells or stem cells.

[0133] In some embodiments, the cells are myeloid cells. Non-limiting examples of myeloid cells include: monocytes, macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes, and stem cells from which myeloid cells can differentiate.

[0134] In some embodiments, the stem cells are pluripotent stem cells (e.g., embryonic stem cells or induced pluripotent stem cells).

[0135] 2.1. First antigen recognition receptor

[0136] The first antigen recognition receptor targets a first antigen. The first antigen can be a tumor antigen or a pathogen antigen. In some embodiments, the first antigen recognition receptor is a chimeric receptor. In some embodiments, the chimeric receptor is a chimeric antigen receptor (CAR).

[0137] 2.1.1. First antigen

[0138] In some embodiments, the first antigen is a tumor antigen. In some embodiments, the tumor antigen is an antigen with low antigen density. In some embodiments, the tumor antigen is expressed on cells with a low tumor cell frequency.

[0139] Any tumor antigen (antigen peptide) may be used in the tumor-related examples described herein. The source of the antigen includes, but is not limited to, oncoproteins. The primary antigen may be expressed as a peptide or as a complete protein or a portion thereof. The complete protein or a portion thereof may be natural or mutagenic. Non-limiting examples of tumor antigens include: CD19, CD70, IL1RAP, ABCG2, AChR, ACKR6, ADAMTS13, ADGRE2, ADGRE2(EMR2), ADORA3, ADRA1D, AGER, ALS2, antigens of cytomegalovirus (CMV) infected cells (e.g., cell surface antigens), ANO9, AQP2, ASIC3, ASPRV1, ATP6V0A4, B3GNT4, B7-H3, BCMA, BEST4, C3orf35, CADM3, CAIX, CAPN3, CCDC155, CCR1, CD 10. CD117, CD123, CD133, CD135(FLT3), CD138, CD20, CD22, CD244(2B4), CD25, CD26, CD276, CD30, CD300LF, CD312, CD32, CD321, CD33, CD 34. CD36, CD38, CD41, CD44, CD44V6, CD47, CD49f, CD56, CD7, CD71, CD74, CD8, CD82, CD96, CD98, CD99, CDH13, CDHR1, CEA, CEACAM6, CHST3 , CLEC12A, CLEC1A, CLL1, CNIH2, COL15A1, COLEC12, CPM, CR1, CX3CR1, CXCR4, CYP4F11, DAGLB, DARC, DFNB31, DGKI, EGF1R, EGFR-VIII, EG P-2, EGP-40, ELOVL6, EMB, EMC10, EMR2, ENG, EpCAM, EphA2, EPHA4, ERBB, ERBB2, Erb-B3, Erb-B4, E-selectin, EXOC3L4, EXTL3, FAM186B, FBP, F CGR1A, FKBP1B, FLRT1, folate receptor-α, FOLR2, FRMD5, GABRB2, GAS2, GD2, GD3, GDPD3, GNA14, GNAZ, GPR153, GPR56, GYPA, HEPHL1, HER-2, hERT, HILPDA, HLA-DR, HOOK1, hTERT, HTR2A, ICAM1, IGFBP3, IL10RB, IL20RB, IL23R, ILDR1, interleukin-13 receptor subunit α-2 (IL-13Rα2), ITFG3, ITGA4, ITGA5ITGA8, ITGAX, ITGB5, ITGB8, JAM3, KCND1, KCNJ5, KCNK13, KCNN4, KCNV2, KDR, KIF19, KIF26B, kappa-light chain, L1CAM, LAX1, LEPR, Lewis Y(CD174), Lewis Y (LeY), LILRA2, LILRA6, LILRB2, LILRB3, LILRB4, LOXL4, LPAR2, LRRC37A3, LRRC8E, LRRN2, LLRTM2, LTB4R, MAGE-A1, MAGEA3, MANSC1, MART1, GP100, MBOAT1, MBOAT7, Melanoma Antigen Family A, Mesothelin (MSLN), MFAP3L, MMP25, MRP1, MT-ND1, Mucin 1 (MUC1), Mucin 16 (MUC16), MYADM, MYADML 2. NGFR, NKCS1, NKG2D ligand, NLGN3, NPAS2, NY-ESO-1, onco-embryonic antigen (h5T4), OTOA, P2RY13, p53, PDE3A, PEAR1, PIEZO1, PLXNA4, PLXNC1, PNPLA3, PPFIA4, PPP2R5B, PRAME, PRAME, prostate stem cell antigen (PSCA), prostate-specific membrane antigen (PSMA), proteinase 3 (PR1), PSD2, PTPRJ, RDH16, receptor tyrosine protein kinase Erb-B2, RHBDL3, RNF173, RNF183, ROR1, RYR2, SCIN, SCN11A, SCN2A, SCNN1D, SEC31B, SEMA4A, SH3PXD2A, SIGLEC11, SIRPB1, SLC16A6, SLC19A1, SLC22 A5, SLC25A36, SLC25A41, SLC30A1, SLC34A3, SLC43A3, SLC44A1, SLC44A3, SLC45A3, SLC6A16, SLC6A6, SLC8A3, SLC9A1, SLCO2B1, SPA G17, STC1, STON2, SUN3, Survivin, SUSD2, SYNC, TACSTD2, TAS1R3, TEX29, TFR2, TIM-3 (HAVCR2), TLR2, TMEFF2, TMEM145, TMEM27, TMEM40, TMEM59L, TMEM89, TMPRSS5, TNFRSF14, TNFRSF1B, TRIM55, TSPEAR, TTYH3, Tumor-associated glycoprotein 72 (TAG-72), Tyrosinase, Vascular endothelial growth factor R2 (VEGF-R2), VLA-4Wilms tumor protein (WT-1), WNT4, WT1, and ZDHHC11.

[0140] In some embodiments, the first antigen is selected from the group consisting of: CD312, CLEC12A, CD33, CD123, IL1RAP, SIGLEC-6, GRP78, TIM3, CD70, CD20, CD22, CD19, GPRC5D, SLAMF7, BCMA, CD276, and CAIX. In some embodiments, the first antigen is CD312. In some embodiments, the first antigen is CD276.

[0141] In some embodiments, the first antigen is a pathogen antigen. Non-limiting examples of viruses include: Retroviridae (e.g., human immunodeficiency virus, such as HIV-1 (also known as HDTV-III, LAVE, or HTLV-III / LAV, or HIV-III); and other isolates, such as HIV-LP); Picornaviridae (e.g., poliovirus, hepatitis A virus; enterovirus, human coxsackievirus, rhinovirus, echovirus); Calciviridae (e.g., strains causing gastroenteritis); Togaviridae (e.g., equine encephalitis virus, rubella virus); Flaviviridae (e.g., ... Dengue virus, encephalitis virus, yellow fever virus; Coronoviridae (e.g., coronavirus); Rhabdoviridae (e.g., vesicular stomatitis virus, rabies virus); Filoviridae (e.g., Ebola virus); Paramyxoviridae (e.g., parainfluenza virus, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g., influenza virus); Bungaviridae (e.g., Hantavirus, bungalow virus, sandfly virus, and Naira virus); Arenaviridae Hemorrhagic fever viruses (Viridae); Reoviridae (e.g., reovirus, circovirus, and rotavirus); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae (Parvovirus); Papovaviridae (Papillomavirus, Polyomavirus); Adenoviridae (Most adenoviruses); Herpesviridae (Herp... Herpes simplex virus (HSV) 1 and 2, varicella-zoster virus, cytomegalovirus (CMV), herpesvirus; Poxviridae (smallpox virus, vaccinia virus, poxvirus); and Iridoviridae (e.g., African swine fever virus); and unclassified viruses (e.g., hepatitis D virus (considered a defective satellite of hepatitis B virus), non-A, non-B hepatitis viruses (Class 1 = internal transmission; Class 2 = external transmission (i.e., hepatitis C)); Norwalk virus and related viruses, and astroviruses).

[0142] Non-limiting examples of bacteria include: Pasteurella, Staphylococci, Streptococcus, Escherichia coli, Pseudomonas species, and Salmonella species. Specific examples of infectious bacteria include, but are not limited to: Helicobacter pylori, Borrelia burgdorferi, Legionella, Legionella pneumophila, Mycobacteria sps (e.g., Mycobacterium tuberculosis, Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium kansaii, Mycobacterium gordonae, Mycobacterium leprae), Staphylococcus aureus, Staphylococcus epidermidis, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, and Streptococcus pyogenes. Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus pneumoniae, Campylobacter sp., Campylobacter jejuni, Enterococcus sp.Haemophilus influenzae, Bacillus antracis, Corynebacterium diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium spp., Clostridium perfringers, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidum, Treponema pallidum. The following bacteria are listed: pertenue, leptospira, rickettsia, and Actinomyces israelli, mycoplasma, Pseudomonas aeruginosa, Pseudomonas fluorescens, Corynobacteria diphtheriae, Bartonella henselae, Bartonella quintana, Coxiella burnetii, Chlamydia, Shigella, Yersinia enterocolitica, Yersinia pseudotuberculosis, Listeria monocytogenes, and Mycoplasma spp.*Vibrio cholerae*, *Borrelia*, *Francisella*, *Brucella melitensis*, *Proteus mirabilis*, and *Proteus*.

[0143] In some embodiments, the pathogen antigen is a viral antigen present in cytomegalovirus (CMV), a viral antigen present in Epstein-Barr virus (EBV), a viral antigen present in human immunodeficiency virus (HIV), or a viral antigen present in influenza virus.

[0144] 2.1.2. Chimeric antigen receptor (CAR)

[0145] CARs are engineered receptors that specifically transplant or confer specific receptors to immune effector cells. CARs can be used to specifically transplant monoclonal antibodies onto T cells; in this process, the transfer of their coding sequences is facilitated by retroviral vectors.

[0146] There are three generations of CARs. "First-generation" CARs typically consist of an extracellular antigen-binding domain (e.g., scFv) that binds to the target antigen, and an intracellular signaling domain. In some embodiments, the CAR further includes a transmembrane domain. "First-generation" CARs can provide de novo antigen recognition, and HLA-independent antigen presentation induces CD4+ expression via its CD3ζ chain signaling domain within a single fusion molecule. + and CD8 + Both T cell activation and activation are involved. "Second-generation" CARs contain signal transduction domains of intracellular signal transduction domains of co-stimulatory molecules (e.g., CD28, 4-1BB, ICOS, OX40, CD27, CD40, NKG2D, DAP-10, CD2, CD150, CD226) that provide co-stimulatory signals to cells (e.g., T cells or NK cells). "Second-generation" CARs include those that provide both co-stimulation (e.g., CD28 or 4-1BB) and activation (CD3ζ). "Third-generation" CARs include those that provide multiple co-stimuli (e.g., CD28 and 4-1BB) and activation (CD3ζ).

[0147] In some embodiments, the first antigen recognition receptor is a CAR comprising an extracellular antigen-binding domain that binds to the first antigen and an intracellular signal transduction domain. In some embodiments, the CAR further comprises a transmembrane domain. In some embodiments, the CAR further comprises a hinge / spacer region.

[0148] 2.1.2.1. Extracellular antigen-binding domain

[0149] In some embodiments, the extracellular antigen-binding domain of the CAR (e.g., scFv) is approximately 5 × 10 -7 M or smaller, approximately 1×10 -7 M or smaller, approximately 5×10 -8 M or smaller, approximately 1×10 -8 M or smaller, approximately 5×10 -9 M or smaller, or approximately 1×10 -9 M or smaller or approximately 1×10 -10 The dissociation constant (K D The CAR binds to the first antigen. In some embodiments, the extracellular antigen-binding domain of the CAR (e.g., scFv) binds at approximately 1 × 10⁻⁶. -8 M or smaller K D It binds to the first antigen.

[0150] Binding of the extracellular antigen-binding domain (e.g., in scFv) can be confirmed by, for example, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), FACS analysis, bioassays (e.g., growth inhibition), or Western blotting. Each of these assays typically detects the presence of a protein-antibody complex of particular interest using a labeled reagent (e.g., antibody or scFv) specific to the complex of interest. For example, scFv can be radiolabeled and used in radioimmunoassays (RIA) (see, for example, Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March 1986, which is incorporated herein by reference). Radioisotopes can be detected by gamma counters or scintillation counters or by autoradiography. In some embodiments, the extracellular antigen-binding domain of the CAR is labeled with a fluorescent marker. Non-limiting examples of fluorescent markers include: green fluorescent protein (GFP), blue fluorescent protein (e.g., EBFP, EBFP2, azurite and mKalama1), cyan fluorescent protein (e.g., ECFP, azurite and CyPet), and yellow fluorescent protein (e.g., YFP, tartrazine, Venus and YPet).

[0151] The extracellular antigen-binding domain may comprise or be scFv, Fab (optionally cross-linked), or F(ab)2. In some embodiments, any of the foregoing molecules may be included in a fusion protein having a heterologous sequence for forming the extracellular antigen-binding domain. In some embodiments, the extracellular antigen-binding domain comprises or is scFv. In some embodiments, the scFv is a human scFv. In some embodiments, the scFv is a humanized scFv. In some embodiments, the scFv is a mouse scFv.

[0152] 2.1.2.1.1. Exemplary extracellular antigen-binding domain

[0153] In some embodiments, the first antigen recognition receptor is a CAR containing an extracellular antigen-binding domain that binds to CD312. In some embodiments, the extracellular antigen-binding domain of the CAR contains or is composed of the amino acid sequence shown in SEQ ID NO:83 and specifically binds to CD312 (e.g., the human CD312 peptide). SEQ ID NO:83 is provided in Table 1 below.

[0154] In some embodiments, the extracellular antigen-binding domain of the CAR includes a heavy chain variable region (V). H The heavy chain variable region contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:73 or a conserved modification thereof, CDR2 comprising the amino acid sequence shown in SEQ ID NO:74 or a conserved modification thereof, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:75 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V H It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:73, CDR2 containing the amino acid sequence shown in SEQ ID NO:74, and CDR3 containing the amino acid sequence shown in SEQ ID NO:75. SEQ ID NO:73 to 75 are provided in Table 1 below.

[0155] In some embodiments, the extracellular antigen-binding domain of the CAR includes a light chain variable region (V0). L The light chain variable region contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:76 or a conserved modification thereof, CDR2 comprising the amino acid sequence shown in SEQ ID NO:77 or a conserved modification thereof, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:78 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V LIt contains CDR1 containing the amino acid sequence shown in SEQ ID NO:76, CDR2 containing the amino acid sequence shown in SEQ ID NO:77, and CDR3 containing the amino acid sequence shown in SEQ ID NO:78. SEQ ID NO:76 to 78 are provided in Table 1 below.

[0156] In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:73 or its conservatively modified form, CDR2 comprising the amino acid sequence shown in SEQ ID NO:74 or its conservatively modified form, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:75 and its conservatively modified form; V L It contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:76 or a conserved modification thereof, CDR2 comprising the amino acid sequence shown in SEQ ID NO:77 or a conserved modification thereof, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:78 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V H It contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO:73, CDR2 comprising an amino acid sequence shown in SEQ ID NO:74, and CDR3 comprising an amino acid sequence shown in SEQ ID NO:75; and V L It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:76, CDR2 containing the amino acid sequence shown in SEQ ID NO:77, and CDR3 containing the amino acid sequence shown in SEQ ID NO:78.

[0157] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains V having the amino acid sequence shown in SEQ ID NO:79 H The CDR1, CDR2, and CDR3. In some embodiments, the extracellular antigen-binding domain of the CAR includes V... L It contains V having the amino acid sequence shown in SEQ ID NO:81. L The CDR1, CDR2, and CDR3. In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains V having the amino acid sequence shown in SEQ ID NO:79 H CDR1, CDR2, and CDR3; and V LIt contains V having the amino acid sequence shown in SEQ ID NO:81. L CDR1, CDR2 and CDR3.

[0158] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:79, which is homologous or identical. For example, the extracellular antigen-binding domain of the first antigen recognition receptor contains V H It comprises an amino acid sequence that is homologous or identical to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of the amino acid sequence shown in SEQ ID NO:79. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V H It contains the amino acid sequence shown in SEQ ID NO:79. SEQ ID NO:79 is provided in Table 1 below.

[0159] In some embodiments, the extracellular antigen-binding domain of the CAR includes V L It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:81, which is homologous or identical. For example, the extracellular antigen-binding domain of the CAR contains V L It comprises an amino acid sequence that is homologous or identical to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of the amino acid sequence shown in SEQ ID NO:81. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V L It contains the amino acid sequence shown in SEQ ID NO:81. SEQ ID NO:81 is provided in Table 1 below.

[0160] In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains an amino acid sequence that is at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homologous to or identical to the amino acid sequence shown in SEQ ID NO:79; and V LIt contains an amino acid sequence that is at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homologous to or identical to the amino acid sequence shown in SEQ ID NO:81.

[0161] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains the amino acid sequence shown in SEQ ID NO:79. In some embodiments, the extracellular antigen-binding domain of the CAR contains V L It contains the amino acid sequence shown in SEQ ID NO:81. In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains the amino acid sequence shown in SEQ ID NO:79; and V L It contains the amino acid sequence shown in SEQ ID NO:81.

[0162] In some embodiments, the extracellular antigen-binding domain of the CAR is an scFv comprising the amino acid sequence shown in SEQ ID NO:83 or composed of said amino acid sequence. SEQ ID NO:73 to 83 are provided in Table 1 below. In some embodiments, V H and V L The connection is made via a connector. In some embodiments, the connector comprises the amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0163] In some embodiments, the Kabat system is used to describe the CDR regions / sequences disclosed herein (Swindells et al., J MolBiol. 3 Feb 2017; 429(3):356-364).

[0164] Table 1

[0165]

[0166] In some embodiments, the first antigen recognition receptor is a CAR containing an extracellular antigen-binding domain that binds to CD276. In some embodiments, the extracellular antigen-binding domain of the CAR contains or is composed of the amino acid sequence shown in SEQ ID NO:95 and specifically binds to CD276 (e.g., the human CD276 peptide). SEQ ID NO:95 is provided in Table 2 below.

[0167] In some embodiments, the extracellular antigen-binding domain of the CAR includes a heavy chain variable region (V). HThe heavy chain variable region contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:85 or a conserved modification thereof, CDR2 comprising the amino acid sequence shown in SEQ ID NO:86 or a conserved modification thereof, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:87 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V H It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:85, CDR2 containing the amino acid sequence shown in SEQ ID NO:86, and CDR3 containing the amino acid sequence shown in SEQ ID NO:87. SEQ ID NO:85 to 87 are provided in Table 2 below.

[0168] In some embodiments, the extracellular antigen-binding domain of the CAR includes a light chain variable region (V0). L The light chain variable region contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:88 or a conserved modification thereof, CDR2 comprising the amino acid sequence shown in SEQ ID NO:89 or a conserved modification thereof, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:90 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V L It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:88, CDR2 containing the amino acid sequence shown in SEQ ID NO:89, and CDR3 containing the amino acid sequence shown in SEQ ID NO:90. SEQ ID NO:88 to 90 are provided in Table 2 below.

[0169] In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:85 or its conservatively modified form, CDR2 comprising the amino acid sequence shown in SEQ ID NO:86 or its conservatively modified form, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:87 and its conservatively modified form; V L It contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO:88 or a conserved modification thereof, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:89 or a conserved modification thereof, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:90 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V HIt contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO:85, CDR2 comprising an amino acid sequence shown in SEQ ID NO:86, and CDR3 comprising an amino acid sequence shown in SEQ ID NO:87; and V L It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:88, CDR2 containing the amino acid sequence shown in SEQ ID NO:89, and CDR3 containing the amino acid sequence shown in SEQ ID NO:90.

[0170] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains V having the amino acid sequence shown in SEQ ID NO:91. H The CDR1, CDR2, and CDR3. In some embodiments, the extracellular antigen-binding domain of the CAR includes V... L It contains V having the amino acid sequence shown in SEQ ID NO:93. L The CDR1, CDR2, and CDR3. In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains V having the amino acid sequence shown in SEQ ID NO:91. H CDR1, CDR2, and CDR3; and V L It contains V having the amino acid sequence shown in SEQ ID NO:93. L CDR1, CDR2 and CDR3.

[0171] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:91, which is homologous or identical. For example, the extracellular antigen-binding domain of the first antigen recognition receptor contains V H It comprises an amino acid sequence that is homologous or identical to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of the amino acid sequence shown in SEQ ID NO:91. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V H It contains the amino acid sequence shown in SEQ ID NO:91. SEQ ID NO:91 is provided in Table 2 below.

[0172] In some embodiments, the extracellular antigen-binding domain of the CAR includes V L It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:93, which is homologous or identical. For example, the extracellular antigen-binding domain of the CAR contains V L It comprises an amino acid sequence that is homologous or identical to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of the amino acid sequence shown in SEQ ID NO:93. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V L It contains the amino acid sequence shown in SEQ ID NO:93. SEQ ID NO:93 is provided in Table 2 below.

[0173] In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains an amino acid sequence that is at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homologous to or identical to the amino acid sequence shown in SEQ ID NO:91; and V L It contains an amino acid sequence that is at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homologous to or identical to the amino acid sequence shown in SEQ ID NO:93.

[0174] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains the amino acid sequence shown in SEQ ID NO:91. In some embodiments, the extracellular antigen-binding domain of the CAR contains V L It contains the amino acid sequence shown in SEQ ID NO:93. In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains the amino acid sequence shown in SEQ ID NO:91; and V L It contains the amino acid sequence shown in SEQ ID NO:93.

[0175] In some embodiments, the extracellular antigen-binding domain of the CAR is an scFv comprising the amino acid sequence shown in SEQ ID NO:95 or composed of said amino acid sequence. SEQ ID NO:85 to 95 are provided in Table 2 below. In some embodiments, V H and V LThe connection is made via a connector. In some embodiments, the connector comprises the amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0176] In some embodiments, the Kabat system is used to describe the CDR regions / sequences disclosed herein (Swindells et al., J MolBiol. 3 Feb 2017; 429(3):356-364).

[0177] Table 2

[0178]

[0179] In some embodiments, the first antigen recognition receptor is a CAR containing an extracellular antigen-binding domain that binds to CD22. In some embodiments, the extracellular antigen-binding domain of the CAR contains or is composed of the amino acid sequence shown in SEQ ID NO:107 or SEQ ID NO:109, and specifically binds to CD22 (e.g., the human CD22 polypeptide). SEQ ID NO:107 and SEQ ID NO:109 are provided in Table 3 below.

[0180] In some embodiments, the extracellular antigen-binding domain of the CAR includes a heavy chain variable region (V). H The heavy chain variable region contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:97 or a conserved modification thereof, CDR2 comprising the amino acid sequence shown in SEQ ID NO:98 or a conserved modification thereof, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:99 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V H It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:97, CDR2 containing the amino acid sequence shown in SEQ ID NO:98, and CDR3 containing the amino acid sequence shown in SEQ ID NO:99. SEQ ID NO:97 to 99 are provided in Table 3 below.

[0181] In some embodiments, the extracellular antigen-binding domain of the CAR includes a light chain variable region (V0). LThe light chain variable region contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:100 or a conserved modification thereof, CDR2 comprising the amino acid sequence shown in SEQ ID NO:101 or a conserved modification thereof, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:102 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V L It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:100, CDR2 containing the amino acid sequence shown in SEQ ID NO:101, and CDR3 containing the amino acid sequence shown in SEQ ID NO:102. SEQ ID NO:100 to 102 are provided in Table 3 below.

[0182] In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:97 or its conservative modifications, CDR2 comprising the amino acid sequence shown in SEQ ID NO:98 or its conservative modifications, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:99 and its conservative modifications; V L It contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO:100 or a conserved modification thereof, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:101 or a conserved modification thereof, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:102 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V H It contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO:97, CDR2 comprising an amino acid sequence shown in SEQ ID NO:98, and CDR3 comprising an amino acid sequence shown in SEQ ID NO:99; and V L It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:100, CDR2 containing the amino acid sequence shown in SEQ ID NO:101, and CDR3 containing the amino acid sequence shown in SEQ ID NO:102.

[0183] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains V having the amino acid sequence shown in SEQ ID NO:103. H The CDR1, CDR2, and CDR3. In some embodiments, the extracellular antigen-binding domain of the CAR includes V... LIt contains V having the amino acid sequence shown in SEQ ID NO:105. L The CDR1, CDR2, and CDR3. In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains V having the amino acid sequence shown in SEQ ID NO:103. H CDR1, CDR2, and CDR3; and V L It contains V having the amino acid sequence shown in SEQ ID NO:105. L CDR1, CDR2 and CDR3.

[0184] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:103, which is homologous or identical. For example, the extracellular antigen-binding domain of the first antigen recognition receptor contains V H It comprises an amino acid sequence that is homologous or identical to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of the amino acid sequence shown in SEQ ID NO: 103. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V H It contains the amino acid sequence shown in SEQ ID NO:103. SEQ ID NO:103 is provided in Table 3 below.

[0185] In some embodiments, the extracellular antigen-binding domain of the CAR includes V L It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:105, which is homologous or identical. For example, the extracellular antigen-binding domain of the CAR contains V L It comprises an amino acid sequence that is homologous or identical to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of the amino acid sequence shown in SEQ ID NO: 105. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V LIt contains the amino acid sequence shown in SEQ ID NO:105. SEQ ID NO:105 is provided in Table 3 below.

[0186] In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:103, which is homologous or identical; and V L It contains an amino acid sequence that is at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homologous to or identical to the amino acid sequence shown in SEQ ID NO:105.

[0187] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains the amino acid sequence shown in SEQ ID NO:103. In some embodiments, the extracellular antigen-binding domain of the CAR contains V L It contains the amino acid sequence shown in SEQ ID NO:105. In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains the amino acid sequence shown in SEQ ID NO:103; and V L It contains the amino acid sequence shown in SEQ ID NO:105.

[0188] In some embodiments, the extracellular antigen-binding domain of the CAR is an scFv comprising the amino acid sequence shown in SEQ ID NO:107 or SEQ ID NO:109 or composed of said amino acid sequence. SEQ ID NO:97 to 109 are provided in Table 3 below. In some embodiments, V H and V L The connection is made via a connector. In some embodiments, the connector comprises the amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0189] In some embodiments, the Kabat system is used to describe the CDR regions / sequences disclosed herein (Swindells et al., J MolBiol. 3 Feb 2017; 429(3):356-364).

[0190] Table 3

[0191]

[0192]

[0193] In some embodiments, the first antigen recognition receptor is a CAR containing an extracellular antigen-binding domain that binds to CD22. In some embodiments, the extracellular antigen-binding domain of the CAR contains or is composed of the amino acid sequence shown in SEQ ID NO:115 or SEQ ID NO:117, and specifically binds to CD22 (e.g., the human CD22 polypeptide). SEQ ID NO:115 and SEQ ID NO:117 are provided in Table 4 below.

[0194] In some embodiments, the extracellular antigen-binding domain of the CAR includes a heavy chain variable region (V). H The heavy chain variable region contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:97 or a conserved modification thereof, CDR2 comprising the amino acid sequence shown in SEQ ID NO:153 or a conserved modification thereof, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:99 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V H It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:97, CDR2 containing the amino acid sequence shown in SEQ ID NO:153, and CDR3 containing the amino acid sequence shown in SEQ ID NO:99. SEQ ID NO:97, 99, and 153 are provided in Table 4 below.

[0195] In some embodiments, the extracellular antigen-binding domain of the CAR includes a light chain variable region (V0). L The light chain variable region contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:100 or a conserved modification thereof, CDR2 comprising the amino acid sequence shown in SEQ ID NO:101 or a conserved modification thereof, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:102 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V L It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:100, CDR2 containing the amino acid sequence shown in SEQ ID NO:101, and CDR3 containing the amino acid sequence shown in SEQ ID NO:102. SEQ ID NO:100 to 102 are provided in Table 4 below.

[0196] In some embodiments, the extracellular antigen-binding domain of the CAR includes: V HIt contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:97 or its conservatively modified form, CDR2 comprising the amino acid sequence shown in SEQ ID NO:153 or its conservatively modified form, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:99 and its conservatively modified form; V L It contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO:100 or a conserved modification thereof, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:101 or a conserved modification thereof, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:102 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V H It contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO:97, CDR2 comprising an amino acid sequence shown in SEQ ID NO:153, and CDR3 comprising an amino acid sequence shown in SEQ ID NO:99; and V L It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:100, CDR2 containing the amino acid sequence shown in SEQ ID NO:101, and CDR3 containing the amino acid sequence shown in SEQ ID NO:102.

[0197] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains V having the amino acid sequence shown in SEQ ID NO:111. H The CDR1, CDR2, and CDR3. In some embodiments, the extracellular antigen-binding domain of the CAR includes V... L It contains V having the amino acid sequence shown in SEQ ID NO:113. L The CDR1, CDR2, and CDR3. In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains V having the amino acid sequence shown in SEQ ID NO:111. H CDR1, CDR2, and CDR3; and V L It contains V having the amino acid sequence shown in SEQ ID NO:113. L CDR1, CDR2 and CDR3.

[0198] In some embodiments, the extracellular antigen-binding domain of the CAR includes V HIt contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:111, which is homologous or identical. For example, the extracellular antigen-binding domain of the first antigen recognition receptor contains V H It comprises an amino acid sequence that is homologous or identical to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of the amino acid sequence shown in SEQ ID NO: 111. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V H It contains the amino acid sequence shown in SEQ ID NO:111. SEQ ID NO:111 is provided in Table 4 below.

[0199] In some embodiments, the extracellular antigen-binding domain of the CAR includes V L It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:113, which is homologous or identical. For example, the extracellular antigen-binding domain of the CAR contains V L It comprises an amino acid sequence that is homologous or identical to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of the amino acid sequence shown in SEQ ID NO:113. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V L It contains the amino acid sequence shown in SEQ ID NO:113. SEQ ID NO:113 is provided in Table 4 below.

[0200] In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:111, which is homologous or identical to the amino acid sequence shown in SEQ ID NO:111; and V L It contains an amino acid sequence that is at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homologous to or identical to the amino acid sequence shown in SEQ ID NO:113.

[0201] In some embodiments, the extracellular antigen-binding domain of the CAR includes V HIt contains the amino acid sequence shown in SEQ ID NO:111. In some embodiments, the extracellular antigen-binding domain of the CAR contains V L It contains the amino acid sequence shown in SEQ ID NO:113. In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains the amino acid sequence shown in SEQ ID NO:111; and V L It contains the amino acid sequence shown in SEQ ID NO:113.

[0202] In some embodiments, the extracellular antigen-binding domain of the CAR is an scFv comprising the amino acid sequence shown in SEQ ID NO:115 or SEQ ID NO:117 or composed of said amino acid sequence. SEQ ID NO:99 to 102 and 111 to 117 are provided in Table 4 below. In some embodiments, V H and V L The connection is made via a connector. In some embodiments, the connector comprises the amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0203] In some embodiments, the Kabat system is used to describe the CDR regions / sequences disclosed herein (Swindells et al., J MolBiol. 3 Feb 2017; 429(3):356-364).

[0204] Table 4

[0205]

[0206]

[0207] In some embodiments, the first antigen recognition receptor is a CAR containing an extracellular antigen-binding domain that binds to CD22. In some embodiments, the extracellular antigen-binding domain of the CAR contains or is composed of the amino acid sequence shown in SEQ ID NO:129 or SEQ ID NO:131, and specifically binds to CD22 (e.g., the human CD22 polypeptide). SEQ ID NO:129 and SEQ ID NO:131 are provided in Table 5 below.

[0208] In some embodiments, the extracellular antigen-binding domain of the CAR includes a heavy chain variable region (V). HThe heavy chain variable region contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:119 or a conserved modification thereof, CDR2 comprising the amino acid sequence shown in SEQ ID NO:120 or a conserved modification thereof, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:121 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V H It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:119, CDR2 containing the amino acid sequence shown in SEQ ID NO:120, and CDR3 containing the amino acid sequence shown in SEQ ID NO:121. SEQ ID NO:119 to 121 are provided in Table 5 below.

[0209] In some embodiments, the extracellular antigen-binding domain of the CAR includes a light chain variable region (V0). L The light chain variable region contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:122 or a conserved modification thereof, CDR2 comprising the amino acid sequence shown in SEQ ID NO:123 or a conserved modification thereof, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:124 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V L It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:122, CDR2 containing the amino acid sequence shown in SEQ ID NO:123, and CDR3 containing the amino acid sequence shown in SEQ ID NO:124. SEQ ID NO:122 to 124 are provided in Table 5 below.

[0210] In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:119 or its conservatively modified form, CDR2 comprising the amino acid sequence shown in SEQ ID NO:120 or its conservatively modified form, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:121 and its conservatively modified form; V L It contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO:122 or a conserved modification thereof, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:123 or a conserved modification thereof, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:124 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V HIt contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO:119, CDR2 comprising an amino acid sequence shown in SEQ ID NO:120, and CDR3 comprising an amino acid sequence shown in SEQ ID NO:121; and V L It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:122, CDR2 containing the amino acid sequence shown in SEQ ID NO:123, and CDR3 containing the amino acid sequence shown in SEQ ID NO:124.

[0211] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains V having the amino acid sequence shown in SEQ ID NO:125. H The CDR1, CDR2, and CDR3. In some embodiments, the extracellular antigen-binding domain of the CAR includes V... L It contains V having the amino acid sequence shown in SEQ ID NO:127. L The CDR1, CDR2, and CDR3. In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains V having the amino acid sequence shown in SEQ ID NO:125. H CDR1, CDR2, and CDR3; and V L It contains V having the amino acid sequence shown in SEQ ID NO:127. L CDR1, CDR2 and CDR3.

[0212] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:125, which is homologous or identical. For example, the extracellular antigen-binding domain of the first antigen recognition receptor contains V H It comprises an amino acid sequence that is homologous or identical to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of the amino acid sequence shown in SEQ ID NO: 125. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V H It contains the amino acid sequence shown in SEQ ID NO:125. SEQ ID NO:125 is provided in Table 5 below.

[0213] In some embodiments, the extracellular antigen-binding domain of the CAR includes V L It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:127, which is homologous or identical. For example, the extracellular antigen-binding domain of the CAR contains V L It comprises an amino acid sequence that is homologous or identical to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of the amino acid sequence shown in SEQ ID NO:127. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V L It contains the amino acid sequence shown in SEQ ID NO:127. SEQ ID NO:127 is provided in Table 5 below.

[0214] In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:125, which is homologous or identical; and V L It contains an amino acid sequence that is at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homologous to or identical to the amino acid sequence shown in SEQ ID NO:127.

[0215] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains the amino acid sequence shown in SEQ ID NO:125. In some embodiments, the extracellular antigen-binding domain of the CAR contains V L It contains the amino acid sequence shown in SEQ ID NO:127. In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains the amino acid sequence shown in SEQ ID NO:125; and V L It contains the amino acid sequence shown in SEQ ID NO:127.

[0216] In some embodiments, the extracellular antigen-binding domain of the CAR is an scFv comprising the amino acid sequence shown in SEQ ID NO:129 or SEQ ID NO:131 or composed of said amino acid sequence. SEQ ID NO:119 to 132 are provided in Table 5 below. In some embodiments, V Hand V L The connection is made via a connector. In some embodiments, the connector comprises the amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0217] In some embodiments, the Kabat system is used to describe the CDR regions / sequences disclosed herein (Swindells et al., J MolBiol. 3 Feb 2017; 429(3):356-364).

[0218] Table 5

[0219]

[0220]

[0221] In some embodiments, the first antigen recognition receptor is a CAR containing an extracellular antigen-binding domain that binds to CD22. In some embodiments, the extracellular antigen-binding domain of the CAR contains or is composed of the amino acid sequence shown in SEQ ID NO:157 or SEQ ID NO:158, and specifically binds to CD22 (e.g., the human CD22 polypeptide). SEQ ID NO:157 and SEQ ID NO:158 are provided in Table 6 below.

[0222] In some embodiments, the extracellular antigen-binding domain of the CAR includes a heavy chain variable region (V). H The heavy chain variable region contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:97 or a conserved modification thereof, CDR2 comprising the amino acid sequence shown in SEQ ID NO:154 or a conserved modification thereof, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:99 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V H It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:97, CDR2 containing the amino acid sequence shown in SEQ ID NO:154, and CDR3 containing the amino acid sequence shown in SEQ ID NO:99. SEQ ID NO:97, 99, and 154 are provided in Table 6 below.

[0223] In some embodiments, the extracellular antigen-binding domain of the CAR includes a light chain variable region (V0). LThe light chain variable region contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:100 or a conserved modification thereof, CDR2 comprising the amino acid sequence shown in SEQ ID NO:101 or a conserved modification thereof, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:102 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V L It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:100, CDR2 containing the amino acid sequence shown in SEQ ID NO:101, and CDR3 containing the amino acid sequence shown in SEQ ID NO:102. SEQ ID NO:100 to 102 are provided in Table 6 below.

[0224] In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:97 or its conservative modifications, CDR2 comprising the amino acid sequence shown in SEQ ID NO:154 or its conservative modifications, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:99 and its conservative modifications; V L It contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO:100 or a conserved modification thereof, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:101 or a conserved modification thereof, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:102 or a conserved modification thereof. In some embodiments, the extracellular antigen-binding domain of the CAR contains V H It contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO:97, CDR2 comprising an amino acid sequence shown in SEQ ID NO:154, and CDR3 comprising an amino acid sequence shown in SEQ ID NO:99; and V L It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:100, CDR2 containing the amino acid sequence shown in SEQ ID NO:101, and CDR3 containing the amino acid sequence shown in SEQ ID NO:102.

[0225] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains V having the amino acid sequence shown in SEQ ID NO:155. H The CDR1, CDR2, and CDR3. In some embodiments, the extracellular antigen-binding domain of the CAR includes V... LIt contains V having the amino acid sequence shown in SEQ ID NO:105. L The CDR1, CDR2, and CDR3. In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains V having the amino acid sequence shown in SEQ ID NO:155. H CDR1, CDR2, and CDR3; and V L It contains V having the amino acid sequence shown in SEQ ID NO:105. L CDR1, CDR2 and CDR3.

[0226] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:155, which is homologous or identical. For example, the extracellular antigen-binding domain of the first antigen recognition receptor contains V H It comprises an amino acid sequence that is homologous or identical to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of the amino acid sequence shown in SEQ ID NO: 155. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V H It contains the amino acid sequence shown in SEQ ID NO:155. SEQ ID NO:155 is provided in Table 6 below.

[0227] In some embodiments, the extracellular antigen-binding domain of the CAR includes V L It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:105, which is homologous or identical. For example, the extracellular antigen-binding domain of the CAR contains V L It comprises an amino acid sequence that is homologous or identical to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of the amino acid sequence shown in SEQ ID NO:113. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V LIt contains the amino acid sequence shown in SEQ ID NO:105. SEQ ID NO:105 is provided in Table 6 below.

[0228] In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) of the amino acid sequence shown in SEQ ID NO:155, which is homologous or identical; and V L It contains an amino acid sequence that is at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homologous to or identical to the amino acid sequence shown in SEQ ID NO:105.

[0229] In some embodiments, the extracellular antigen-binding domain of the CAR includes V H It contains the amino acid sequence shown in SEQ ID NO:155. In some embodiments, the extracellular antigen-binding domain of the CAR contains V L It contains the amino acid sequence shown in SEQ ID NO:105. In some embodiments, the extracellular antigen-binding domain of the CAR includes: V H It contains the amino acid sequence shown in SEQ ID NO:155; and V L It contains the amino acid sequence shown in SEQ ID NO:105.

[0230] In some embodiments, the extracellular antigen-binding domain of the CAR is an scFv comprising the amino acid sequence shown in SEQ ID NO:157 or SEQ ID NO:158 or composed of said amino acid sequence. SEQ ID NO:154 to 160 are provided in Table 6 below. In some embodiments, V H and V L The connection is made via a connector. In some embodiments, the connector comprises the amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0231] In some embodiments, the Kabat system is used to describe the CDR regions / sequences disclosed herein (Swindells et al., J MolBiol. 3 Feb 2017; 429(3):356-364).

[0232] Table 6

[0233]

[0234]

[0235] V having at least about 80%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% (e.g., about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%) homology or identity with a specific sequence (e.g., SEQ ID NO: 79, 81, 91, 93, 103, 105, 111, 113, 125, 127, and 155). H and / or V L The amino acid sequence may contain substitutions (e.g., conserved substitutions), insertions, or deletions relative to a specified sequence, but retains the ability to bind to target antigens (e.g., CD312, CD276, CD22). In some embodiments, a total of 1 to 10 amino acids are substituted, inserted, and / or deleted in specific sequences (e.g., SEQ ID NO: 79, 81, 91, 93, 103, 105, 111, 113, 125, 127, and 155). In some embodiments, the substitution, insertion, or deletion occurs in a region outside the CDR of the extracellular antigen-binding domain (e.g., in the FR). In some embodiments, the extracellular antigen-binding domain of the CAR contains a V selected from SEQ ID NO: 79, 81, 91, 93, 103, 105, 111, 113, 125, 127, and 155. H and / or V L The sequence contains translated modifications of the sequence (SEQ ID NO:79, 81, 91, 93, 103, 105, 111, 113, 125, 127 and 155).

[0236] Additionally, the extracellular antigen-binding domain of the CAR may contain a leader peptide or signal peptide that guides the nascent protein into the endoplasmic reticulum. Since the CAR is glycosylated and anchored in the cell membrane, the signal peptide or leader peptide may be essential. The signal sequence or leader sequence may be a peptide sequence (e.g., about 5, about 10, about 15, about 20, about 25, or about 30 amino acids) present at the N-terminus of the newly synthesized protein, which guides the protein into the secretory pathway. In some embodiments, the signal peptide is covalently bound to the 5' end (N-terminus) of the extracellular antigen-binding domain of the CAR. Exemplary leader sequences include, but are not limited to: human IL-2 signal sequences (e.g., human IL-2 signal sequences comprising or composed of the amino acid sequence shown in SEQ ID NO:32), mouse IL-2 signal sequences (e.g., mouse IL-2 signal sequences comprising or composed of the amino acid sequence shown in SEQ ID NO:33); human κ leader sequences (e.g., human κ leader sequences comprising or composed of the amino acid sequence shown in SEQ ID NO:34), mouse κ leader sequences (e.g., mouse κ leader sequences comprising or composed of the amino acid sequence shown in SEQ ID NO:35); human CD8 leader sequences (e.g., human CD8 leader sequences comprising or composed of the amino acid sequence shown in SEQ ID NO:36); truncated human CD8 signal peptides (e.g., human CD8 signal peptides comprising or composed of the amino acid sequence shown in SEQ ID NO:37); human albumin signal sequences (e.g., human IL-2 signal sequences comprising or composed of the amino acid sequence shown in SEQ ID NO:37). The amino acid sequence shown in SEQ ID NO:38 or the human albumin signal sequence composed of said amino acid sequence; and the human prolactin signal sequence (e.g., comprising the amino acid sequence shown in SEQ ID NO:39 or the human prolactin signal sequence composed of said amino acid sequence). SEQ ID NO:32 to 39 are provided below.

[0237] MYRMQLLSCIALSLALVTNS[SEQ ID NO:32]

[0238] MYSMQLASCVTLTLVLLVNS[SEQ ID NO:33]

[0239] METPAQLLFLLLLLWLPDTTG[SEQ ID NO:34]

[0240] METDTLLLWVLLLWVPGSTG[SEQ ID NO:35]

[0241] MALPVTALLLPLALLLHAARP[SEQ ID NO:36]

[0242] MALPVTALLLPLALLLHA[SEQ ID NO:37]

[0243] MKWVTFISLLFSSAYS[SEQ ID NO:38]

[0244] MDSKGSSQKGSRLLLLLVVSSNLLLCQGVVS[SEQ ID NO:39]

[0245] In some embodiments, the signal peptide comprises a CD8 polypeptide; for example, the CAR comprises a truncated CD8 signal peptide. In some embodiments, the signal peptide comprises or consists of the amino acid sequence shown in SEQ ID NO:37.

[0246] 2.1.2.2. Transmembrane structural domains and hinge / spacer regions

[0247] In some embodiments, the first antigen recognition receptor is a CAR containing a transmembrane domain. Different transmembrane domains produce different receptor stability. After antigen recognition, the receptor aggregates and the signal is transduced into the cell. According to the subject matter disclosed in this application, the transmembrane domain of the first antigen recognition receptor may include a natural or modified transmembrane domain of the following: CD8 peptide, CD28 peptide, CD3ζ peptide, CD40 peptide, 4-1BB peptide, OX40 peptide, CD84 peptide, CD166 peptide, CD8a peptide, CD8b peptide, ICOS peptide, ICAM-1 peptide, CTLA-4 peptide, CD27 peptide, CD40 peptide, NKG2D peptide, synthetic peptide (not based on a protein associated with an immune response), or a combination thereof.

[0248] In some embodiments, the transmembrane domain of the CAR comprises a CD28 polypeptide (e.g., the transmembrane domain of CD28 or a portion thereof). In some embodiments, the transmembrane domain of the CAR comprises the transmembrane domain of human CD28 or a portion thereof. In some embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence having a length of at least about 20, at least about 25, or at least about 30 and / or up to about 220 amino acids as a continuous portion of the amino acid sequence having NCBI reference number: NP_006130 (SEQ ID NO:7). In some embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence of amino acids 1 to 220, 1 to 50, 50 to 100, 100 to 150, 114 to 220, 150 to 200, 153 to 179, or 200 to 220 of SEQ ID NO:7. In some embodiments, the transmembrane domain of the CAR comprises a CD28 polypeptide, which comprises or consists of amino acids 153 to 179 of SEQ ID NO:7. SEQ ID NO:7 is provided below.

[0249]

[0250] In some embodiments, the first antigen recognition receptor is a CAR that further comprises a hinge / spacer region connecting an extracellular antigen-binding domain to a transmembrane domain. The hinge / spacer region may be flexible enough to allow the antigen-binding domain to orient in different directions, thereby facilitating antigen recognition. In some embodiments, the hinge / spacer region of the CAR may comprise a natural or modified hinge region of the following: CD8 peptide, CD28 peptide, CD3ζ peptide, CD40 peptide, 4-1BB peptide, OX40 peptide, CD84 peptide, CD166 peptide, CD8a peptide, CD8b peptide, ICOS peptide, ICAM-1 peptide, CTLA-4 peptide, CD27 peptide, CD40 peptide, NKG2D peptide, synthetic peptides (not based on proteins associated with an immune response), or combinations thereof. The hinge / spacer region may be a hinge region derived from IgG1 or a CH2CH3 region of an immunoglobulin and a portion of CD3, a portion of a CD28 peptide (e.g., a portion of SEQ ID NO:7), a portion of a CD8 peptide, or a synthetic spacer sequence.

[0251] In some embodiments, the first antigen recognition receptor is a CAR that further comprises a hinge / spacer region containing a natural or modified hinge region comprising a CD28 polypeptide. In some embodiments, the hinge / spacer region of the first antigen recognition receptor (e.g., CAR) comprises a CD28 polypeptide, said polypeptide comprising or consisting of amino acids 114 to 152 of SEQ ID NO:7.

[0252] In some embodiments, the hinge / spacer region is located between the extracellular antigen-binding domain and the transmembrane domain. In some embodiments, the hinge / spacer region comprises the following: CD8 peptide, CD28 peptide, CD3ζ peptide, CD4 peptide, 4-1BB peptide, OX40 peptide, CD166 peptide, CD8a peptide, CD8b peptide, ICOS peptide, ICAM-1 peptide, CTLA-4 peptide, CD27 peptide, CD40 peptide, NKG2D peptide, synthetic peptide (not based on a protein associated with an immune response), or combinations thereof. In some embodiments, the transmembrane domain comprises the following: CD8 peptide, CD28 peptide, CD3ζ peptide, CD4 peptide, 4-1BB peptide, OX40 peptide, CD166 peptide, CD8a peptide, CD8b peptide, ICOS peptide, ICAM-1 peptide, CTLA-4 peptide, CD27 peptide, CD40 peptide, NKG2D peptide, synthetic peptide (not based on a protein associated with an immune response), or combinations thereof.

[0253] In some embodiments, the transmembrane domain and the hinge / spacer region are derived from the same molecule. In some embodiments, the transmembrane domain and the hinge / spacer region are derived from different molecules. In some embodiments, the hinge / spacer region comprises a CD28 peptide and the transmembrane domain comprises a CD28 peptide. In some embodiments, the hinge / spacer region comprises a CD28 peptide and the transmembrane domain comprises a CD28 peptide. In some embodiments, the hinge / spacer region comprises a CD84 peptide and the transmembrane domain comprises a CD84 peptide. In some embodiments, the hinge / spacer region comprises a CD166 peptide and the transmembrane domain comprises a CD166 peptide. In some embodiments, the hinge / spacer region comprises a CD8a peptide and the transmembrane domain comprises a CD8a peptide. In some embodiments, the hinge / spacer region comprises a CD8b peptide and the transmembrane domain comprises a CD8b peptide. In some embodiments, the hinge / spacer region comprises a CD28 peptide and the transmembrane domain comprises an ICOS peptide.

[0254] 2.1.2.3. Intracellular signal transduction domains

[0255] In some embodiments, the first antigen recognition receptor is a CAR containing an intracellular signaling domain. In some embodiments, the intracellular signaling domain of the CAR contains a CD3ζ polypeptide. CD3ζ can activate or stimulate cells (e.g., lymphoid cells, such as T cells). Wild-type (“natural”) CD3ζ includes three functional immune receptor tyrosine-based activation motifs (ITAMs) and three functional base-rich extension (BRS) regions (BRS1, BRS2, ​​and BRS3). After antigen binding, CD3ζ delivers activation signals to cells (e.g., lymphoid cells, such as T cells). The intracellular signaling domain of the CD3ζ chain is the primary signal transducer of the endogenous TCR.

[0256] In some embodiments, the intracellular signaling domain of the CAR comprises native CD3ζ. In some embodiments, native CD3ζ comprises or consists of an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical or homologous to an amino acid sequence or fragment thereof having NCBI reference number: NP_932170 (SEQ ID NO:8), and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the CD3ζ polypeptide comprises or consists of an amino acid sequence of at least about 20, at least about 30, at least about 40, at least about 50, and at most about 164 amino acids as a continuous portion of SEQ ID NO:12. In some embodiments, the natural CD3ζ comprises or consists of the following amino acid sequences: amino acids 1 to 164, 1 to 50, 50 to 100, 52 to 164, 100 to 150, or 150 to 164 of SEQ ID NO:8. In some embodiments, the intracellular signaling domain of the CAR contains the amino acid sequence comprising or consisting of the amino acid sequence 52 to 164 of SEQ ID NO:8. SEQ ID NO:8 is provided below:

[0257]

[0258] In some embodiments, the natural CD3ζ comprises or consists of an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical or homologous to the amino acid sequence shown in SEQ ID NO:9. SEQ ID NO:9 is provided below:

[0259]

[0260] In some embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide. In some embodiments, the modified CD3ζ polypeptide comprises one, two, or three ITAMs. In some embodiments, the modified CD3ζ polypeptide comprises native ITAM1. In some embodiments, native ITAM1 comprises or is composed of the amino acid sequence shown in SEQ ID NO:10.

[0261] QNQLYNELNLGRREEYDVLDKR[SEQ ID NO:10]

[0262] An exemplary nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:10 is shown in SEQ ID NO:11 provided below.

[0263]

[0264] In some embodiments, the modified CD3ζ polypeptide contains an ITAM1 variant comprising one or more loss-of-function mutations. In some embodiments, the ITAM1 variant comprises or consists of two loss-of-function mutations. In some embodiments, each of the one or more (e.g., two) loss-of-function mutations comprises a mutation in a tyrosine residue in ITAM1. In some embodiments, the ITAM1 variant consists of two loss-of-function mutations. In some embodiments, the ITAM1 variant comprises or consists of the amino acid sequence shown in SEQ ID NO: 12, which is provided below.

[0265] QNQLFNELNLGRREEFDVLDKR[SEQ ID NO:12]

[0266] An exemplary nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:12 is shown in SEQ ID NO:13 provided below.

[0267]

[0268] In some embodiments, the modified CD3ζ polypeptide comprises natural ITAM2. In some embodiments, natural ITAM2 comprises or consists of the amino acid sequence shown in SEQ ID NO:14, which is provided below.

[0269] QEGLYNELQKDKMAEAYSEIGMK[SEQ ID NO:14]

[0270] An exemplary nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:14 is shown in SEQ ID NO:15 provided below.

[0271]

[0272] In some embodiments, the modified CD3ζ polypeptide comprises an ITAM2 variant. In some embodiments, the ITAM2 variant comprises or consists of one or more loss-of-function mutations. In some embodiments, the ITAM2 variant comprises or consists of two loss-of-function mutations. In some embodiments, each of the one or more (e.g., two) loss-of-function mutations comprises a mutation of a tyrosine residue in ITAM2. In some embodiments, the ITAM1 variant consists of two loss-of-function mutations. In some embodiments, the ITAM2 variant comprises or consists of the amino acid sequence shown in SEQ ID NO:16, which is provided below.

[0273] QEGLFNELQKDKMAEAFSEIGMK[SEQ ID NO:16]

[0274] An exemplary nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:16 is shown in SEQ ID NO:17 provided below.

[0275]

[0276] In some embodiments, the modified CD3ζ polypeptide comprises natural ITAM3. In some embodiments, natural ITAM3 comprises or consists of the amino acid sequence shown in SEQ ID NO:18, which is provided below.

[0277] HDGLYQGLSTATKDTYDALHMQ[SEQ ID NO:18]

[0278] An exemplary nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:18 is shown in SEQ ID NO:19 provided below.

[0279]

[0280] In some embodiments, the modified CD3ζ polypeptide comprises an ITAM3 variant. In some embodiments, the ITAM3 variant comprises or consists of two loss-of-function mutations. In some embodiments, each of one or more (e.g., two) loss-of-function mutations comprises a mutation in a tyrosine residue in ITAM3. In some embodiments, the ITAM3 variant comprises or consists of two loss-of-function mutations. In some embodiments, the ITAM3 variant comprises or consists of the amino acid sequence shown in SEQ ID NO:20, which is provided below.

[0281] HDGLFQGLSTATKDTFDALHMQ[SEQ ID NO:20]

[0282] An exemplary nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:20 is shown in SEQ ID NO:21 provided below.

[0283]

[0284] Various modified CD3ζ peptides and CARs including modified CD3ζ peptides are disclosed in International Patent Application Publication No. WO2019 / 133969, which is hereby incorporated by reference in its entirety.

[0285] In some embodiments, the intracellular signaling domain of the CAR includes a modified CD3ζ polypeptide comprising native ITAM1, an ITAM2 variant comprising one or more (e.g., two) loss-of-function mutations or thereof, and an ITAM3 variant comprising one or more (e.g., two) loss-of-function mutations or thereof. In some embodiments, the intracellular signaling domain of the CAR includes a modified CD3ζ polypeptide comprising native ITAM1, an ITAM2 variant comprising two loss-of-function mutations, and an ITAM3 variant comprising two loss-of-function mutations. In some embodiments, the intracellular signaling domain of the CAR includes a modified CD3ζ polypeptide comprising: native ITAM1 consisting of the amino acid sequence shown in SEQ ID NO:10, an ITAM2 variant consisting of the amino acid sequence shown in SEQ ID NO:16, and an ITAM3 variant consisting of the amino acid sequence shown in SEQ ID NO:20. In some embodiments, the CAR is designated as "1XX". In some embodiments, the modified CD3ζ polypeptide comprises or consists of the amino acid sequence shown in SEQ ID NO:22. SEQ ID NO:22 is provided below:

[0286]

[0287] In some embodiments, the intracellular signaling domain of the CAR includes a modified CD3ζ polypeptide comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or at least about 100% identical to or composed of a fragment of SEQ ID NO:22 or thereof, and / or may optionally include at most one, at most two, or at most three conserved amino acid substitutions.

[0288] An exemplary nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:22 is shown in SEQ ID NO:23 provided below.

[0289]

[0290]

[0291] In some embodiments, the intracellular signaling domain of the CAR further includes at least one co-stimulatory signaling region. In some embodiments, the at least one co-stimulatory region includes a co-stimulatory molecule or a portion thereof. In some embodiments, the at least one co-stimulatory region includes at least one intracellular domain of at least one co-stimulatory molecule or a portion thereof. Non-limiting examples of co-stimulatory molecules include: CD28, 4-1BB, OX40, CD27, CD40, CD154, CD97, CD11a / CD18, ICOS, DAP-10, CD2, CD150, CD226, and NKG2D.

[0292] In some embodiments, the intracellular signaling domain of the CAR includes a co-stimulatory signaling region comprising a CD28 polypeptide, such as an intracellular domain of CD28 or a portion thereof. In some embodiments, the intracellular signaling domain of the CAR includes a co-stimulatory signaling region comprising an intracellular domain of human CD28 or a portion thereof.

[0293] In some embodiments, the CD28 polypeptide contained in the co-stimulatory signal transduction region of the first antigen recognition receptor comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or at least about 100% identical or homologous to the amino acid sequence or fragments thereof shown in SEQ ID NO:7, and / or may optionally contain at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the CD28 polypeptide contained in the co-stimulatory signal transduction region of the CAR comprises or consists of an amino acid sequence having a length of at least about 20, at least about 30, at least about 40, or at least about 50, and at most about 220 amino acids as a continuous portion of SEQ ID NO:7. Alternatively or additionally, in some embodiments, the CD28 polypeptide contained in the co-stimulatory signaling region of the CAR comprises or consists of amino acids 1 to 220, 1 to 50, 50 to 100, 100 to 150, 114 to 220, 150 to 200, 180 to 220, or 200 to 220 of SEQ ID NO:7. In some embodiments, the intracellular signaling domain of the CAR includes a co-stimulatory signaling region containing the CD28 polypeptide, which comprises or consists of amino acids 180 to 220 of SEQ ID NO:7.

[0294] An exemplary nucleic acid sequence encoding amino acid sequence 180 to 220 of SEQ ID NO:7 is shown in SEQ ID NO:24 provided below.

[0295]

[0296]

[0297] In some embodiments, the intracellular signaling domain of the first antigen recognition receptor includes a co-stimulatory signaling region comprising an intracellular domain of mouse CD28 or a portion thereof. In some embodiments, the CD28 polypeptide contained in the co-stimulatory signaling region comprises or consists of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, at least 100% identical or homologous to an amino acid sequence or fragment thereof having NCBI reference number: NP_031668.3 (or SEQ ID NO: 25), and / or optionally may include at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the CD28 peptide contained in the co-stimulatory signal transduction region of the CAR comprises or consists of an amino acid sequence having a length of at least about 20, at least about 30, at least about 40, or at least about 50 amino acids and a maximum of 218 amino acids as a continuous portion of SEQ ID NO:25. In some embodiments, the CD28 peptide contained in the co-stimulatory signal transduction region of the CAR comprises or consists of an amino acid sequence of amino acids 1 to 218, 1 to 50, 50 to 100, 100 to 150, 150 to 218, 178 to 218, or 200 to 218 of SEQ ID NO:25. In some embodiments, the co-stimulatory signal transduction region of the CAR contains a CD28 peptide comprising or consists of amino acids 178 to 218 of SEQ ID NO:25. SEQ ID NO:25 is provided below.

[0298]

[0299] In some embodiments, the intracellular signaling domain of the CAR includes a co-stimulatory signaling region comprising a 4-1BB polypeptide, such as the intracellular domain of 4-1BB or a portion thereof. In some embodiments, the co-stimulatory signaling region comprises the intracellular domain of human 4-1BB or a portion thereof. In some embodiments, the 4-1BB contained in the co-stimulatory signaling region of the CAR comprises or consists of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, at least 100% identical or homologous to a sequence or fragment thereof having NCBI reference number: NP_001552 (SEQ ID NO: 26), and / or optionally may comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the 4-1BB contained in the co-stimulatory signal transduction region of the CAR comprises or consists of an amino acid sequence of at least about 20, or at least about 30, or at least about 40, or at least about 50, and / or at most about 50, at most about 60, at most about 70, at most about 80, at most about 90, at most about 100, at most about 200, or at most about 255 amino acids as a continuous portion of SEQ ID NO:26. In some embodiments, the co-stimulatory signal transduction region of the CAR comprises a 4-1BB polypeptide comprising or consists of an amino acid sequence of amino acids 1 to 255, 1 to 50, 50 to 100, 100 to 150, 150 to 200, or 200 to 255 of SEQ ID NO:26. In some embodiments, the co-stimulatory signal transduction region of the CAR comprises a 4-1BB polypeptide, which comprises or consists of the amino acid sequence of amino acids 214 to 255 of SEQ ID NO:26. SEQ ID NO:26 is provided below.

[0300]

[0301] In some embodiments, the intracellular signaling domain of the CAR comprises two co-stimulatory signaling regions, wherein the first co-stimulatory signaling region comprises the intracellular domain of a first co-stimulatory molecule or a portion thereof, and the second co-stimulatory signaling region comprises the intracellular domain of a second co-stimulatory molecule or a portion thereof. The first and second co-stimulatory molecules are independently selected from the group consisting of: CD28, 4-1BB, OX40, CD27, CD40, CD154, CD97, CD11a / CD18, ICOS, DAP-10, CD2, CD150, CD226, and NKG2D. In some embodiments, the intracellular signaling domain of the CAR comprises two co-stimulatory signaling regions, wherein the first co-stimulatory signaling region comprises the intracellular domain of CD28 or a portion thereof, and the second co-stimulatory signaling region comprises the intracellular domain of 4-1BB or a portion thereof.

[0302] In some embodiments, the first antigen recognition receptor is a CAR comprising: i) an extracellular antigen-binding domain, ii) a transmembrane domain comprising a CD28 peptide (e.g., a human CD28 peptide, such as the transmembrane domain of CD28 (e.g., human CD28) or a portion thereof), iii) a hinge / spacer region derived from a CD28 peptide (e.g., human CD28 peptide), iv) an intracellular signaling domain comprising: a) a native CD3ζ peptide, and b) a co-stimulatory signaling region comprising a CD28 peptide (e.g., a human CD28 peptide, such as the intracellular domain of CD28 (e.g., human CD28) or a portion thereof). In some embodiments, the transmembrane domain comprises a CD28 peptide comprising or consisting of amino acids 153 to 179 of SEQ ID NO:7. In some embodiments, the hinge / spacer region comprises a CD28 peptide comprising or consisting of amino acids 114 to 152 of SEQ ID NO:7. In some embodiments, the intracellular signal transduction domain comprises: a natural CD3ζ polypeptide comprising or consisting of the amino acid sequence shown in SEQ ID NO:9; and a co-stimulatory signal transduction region comprising a CD28 polypeptide comprising or consisting of 180 to 220 of SEQ ID NO:7. In some embodiments, the CAR is designated as “28z”. In some embodiments, the CAR (e.g., 28z) is encoded by a nucleotide sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or at least about 100% identical to the nucleotide sequence shown in SEQ ID NO:27. In some embodiments, the CAR (e.g., 28z) comprises the nucleotide sequence shown in SEQ ID NO:27. SEQ ID NO:27 is provided below.

[0303]

[0304] In some embodiments, the first antigen recognition receptor is a CAR comprising: i) an extracellular antigen-binding domain, ii) a transmembrane domain comprising a CD28 peptide (e.g., a human CD28 peptide, such as the transmembrane domain of CD28 (e.g., human CD28) or a portion thereof), iii) a hinge / spacer region derived from a CD28 peptide (e.g., human CD28 peptide), and iv) an intracellular signaling domain comprising: a) a modified CD3ζ peptide (e.g., a modified human CD3ζ peptide) comprising native ITAM1, an ITAM2 variant consisting of two loss-of-function mutations, and an ITAM3 variant consisting of two loss-of-function mutations, and b) a co-stimulatory signaling region comprising an intracellular domain of a CD28 peptide (e.g., a human CD28 peptide, such as the intracellular domain of CD28 (e.g., human CD28) or a portion thereof). In some embodiments, the transmembrane domain comprises a CD28 peptide comprising or consisting of amino acids 153 to 179 of SEQ ID NO:7. In some embodiments, the hinge / spacer region comprises a CD28 polypeptide comprising or consisting of amino acids 114 to 152 of SEQ ID NO:7. In some embodiments, the intracellular signal transduction domain comprises: a modified CD3ζ polypeptide comprising or consisting of the amino acid sequence shown in SEQ ID NO:22; and a co-stimulatory signal transduction region comprising the CD28 polypeptide comprising or consisting of amino acids 180 to 220 of SEQ ID NO:7. In some embodiments, the CAR is designated as “28z1xx”. In some embodiments, the CAR (e.g., 28z1xx) is encoded by a nucleotide sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, at least about 100% identical to the nucleotide sequence shown in SEQ ID NO:28 or SEQ ID NO:29. In some embodiments, the CAR (e.g., 28z1xx) comprises the nucleotide sequence shown in SEQ ID NO:28 or SEQ ID NO:29. SEQ ID NO:28 and SEQ ID NO:29 are provided below.

[0305]

[0306]

[0307] In some embodiments, the first antigen recognition receptor is a CAR comprising: i) an extracellular antigen-binding domain, ii) a transmembrane domain, iii) a hinge / spacer region, iv) an intracellular signaling domain comprising: a) a native CD3ζ polypeptide, and b) a co-stimulatory signaling region comprising a 4-1BB polypeptide (e.g., the intracellular domain of or a portion thereof of the human 4-1BB polypeptide, e.g., human 4-1BB). In some embodiments, the intracellular signaling domain comprises: a native CD3ζ polypeptide comprising or consisting of the amino acid sequence shown in SEQ ID NO:9; and a co-stimulatory signaling region comprising a 4-1BB polypeptide comprising or consisting of: 214 to 255 of SEQ ID NO:26. In some embodiments, the CAR is named “BBz”. In some embodiments, the CAR (e.g., BBz) is encoded by at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or at least about 100% identical nucleotide sequences to those shown in SEQ ID NO:30 or SEQ ID NO:31. In some embodiments, the CAR (e.g., BBz) comprises the nucleotide sequences shown in SEQ ID NO:30 or SEQ ID NO:31. SEQ ID NO:30 and SEQ ID NO:31 are provided below.

[0308]

[0309]

[0310] 2.1.3. Chimeric ligand receptors

[0311] In some embodiments, the first antigen recognition receptor is a chimeric ligand receptor, which includes a ligand or a portion thereof that binds to the first antigen. In some embodiments, the chimeric ligand receptor further includes a transmembrane domain and an intracellular signal transduction domain.

[0312] In some embodiments, the transmembrane domain is fused with a ligand or a portion thereof. In some embodiments, the transmembrane domain is fused with an intracellular signaling domain. In some embodiments, the transmembrane domain is located between the ligand or a portion thereof and the intracellular signaling domain. In some embodiments, the transmembrane domain of the chimeric ligand receptor is the transmembrane domain disclosed in Section 2.1.2.2. In some embodiments, the intracellular signaling domain of the chimeric ligand receptor comprises a CD3ζ polypeptide (e.g., as disclosed in Section 2.1.2.3).

[0313] Further information regarding the chimeric ligand receptor disclosed in this application can be found in Sauer et al., Blood (2021) 138(4): 318–330, the contents of which are incorporated herein by reference in their entirety.

[0314] 2.1.4. Delivery of the first antigen recognition receptor

[0315] In some embodiments, a viral method is used to deliver the first antigen recognition receptor to cells. In some embodiments, the viral method includes a viral vector. In some embodiments, the viral vector is a retroviral vector (e.g., a gamma retroviral vector or a lentiviral vector). Other viral vectors include adenovirus vectors, adeno-associated virus vectors, vaccinia virus, bovine papillomavirus, and herpesviruses (e.g., such as Epstein-Barr virus).

[0316] In some embodiments, the first antigen recognition receptor is delivered to cells using non-viral methods. Any targeted genome editing method can also be used to deliver the first antigen recognition receptor to cells. In some embodiments, the first antigen recognition receptor is delivered to cells using methods including: homologous recombination, zinc finger nucleases, large-scale nucleases, transcription activator-like effector nucleases (TALENs), clustered regularly spaced short palindromic repeat (CRISPR) systems, or combinations thereof. In some embodiments, a CRISPR system is used to deliver the first antigen recognition receptor to cells.

[0317] In some embodiments, the cell is a T cell, and the first antigen recognition receptor is integrated at a locus within the genome of the T cell. Non-limiting examples of loci include the TRAC locus, TRBC locus, TRDC locus, and TRGC locus. In some embodiments, the locus is either the TRAC locus or the TRBC locus. In some embodiments, the cell is a T cell, and the first antigen recognition receptor is integrated at the TRAC locus. Methods for targeting CARs to sites within the genome of T cells are disclosed in WO2017180989 and Eyquem et al., Nature. (March 2, 2017); 543(7643):113–117, both of which are incorporated herein by reference in their entirety. In some embodiments, the cell is a T cell, the first antigen recognition receptor is a CAR, and the first antigen recognition receptor is integrated at the TRAC locus. In some embodiments, the cell further includes genetic disruption of the TRBC locus. In some embodiments, genetic disruption of the TRBC locus results in the knockout of the TRBC locus.

[0318] 2.2. Second antigen recognition receptor

[0319] The second antigen recognition receptor targets a second antigen. The second antigen can be a tumor antigen or a pathogen antigen. In some embodiments, the second antigen recognition receptor is a TCR-like fusion molecule.

[0320] 2.2.1. Second antigen

[0321] In some embodiments, the second antigen is a tumor antigen, such as the tumor antigen disclosed in Section 2.1.1. In some embodiments, the tumor antigen is an antigen with a low antigen density. In some embodiments, the tumor antigen is expressed on cells with a low tumor cell frequency.

[0322] In some embodiments, the second antigen is selected from the group consisting of: CD19, CD70, IL1RAP, ABCG2, AChR, ACKR6, ADAMTS13, ADGRE2, ADGRE2(EMR2), ADORA3, ADRA1D, AGER, ALS2, antigens of cytomegalovirus (CMV) infected cells (e.g., cell surface antigens), ANO9, AQP2, ASIC3, ASPRV1, ATP6V0A4, B3GNT4, B7-H3, BCMA, BEST4, C3orf35, CADM3, CAIX, CAPN3, CCDC155, CCR1, CD10, CD117, CD123. CD133, CD135(FLT3), CD138, CD20, CD22, CD244(2B4), CD25, CD26, CD276, CD30, CD300LF, CD312, CD32, CD321, CD33, CD34, CD36, CD38, CD41, CD44, CD44 V6, CD47, CD49f, CD56, CD7, CD71, CD74, CD8, CD82, CD96, CD98, CD99, CDH13, CDHR1, CEA, CEACAM6, CHST3, CLEC12A, CLEC1A, CLL1, CNIH2, COL15A1, COLE C12, CPM, CR1, CX3CR1, CXCR4, CYP4F11, DAGLB, DARC, DFNB31, DGKI, EGF1R, EGFR-VIII, EGP-2, EGP-40, ELOVL6, EMB, EMC10, EMR2, ENG, EpCAM, EphA2, EPHA4, ERBB, ERBB2, Erb-B3, Erb-B4, E-selectin, EXOC3L4, EXTL3, FAM186B, FBP, FCGR1A, FKBP1B, FLRT1, folate receptor-α, FOLR2, FRMD5, GABRB2, GAS2, GD2, GD3, GDPD3 GNA14, GNAZ, GPR153, GPR56, GYPA, HEPHL1, HER-2, hERT, HILPDA, HLA-DR, HOOK1, hTERT, HTR2A, ICAM1, IGFBP3, IL10RB, IL20RB, IL23R, ILDR1, interleukin-13 receptor subunit α-2 (IL-13Rα2), ITFG3, ITGA4, ITGA5, ITGA8, ITGAX, ITGB5, ITGB8, JAM3, KCND1, KCNJ5, KCNK13, KCNN4, KCNV2, KDR, KIF19, KIF26B, κ-light chain, L1CAMLAX1, LEPR, Lewis Y (CD174), Lewis Y (LeY), LILRA2, LILRA6, LILRB2, LILRB3, LILRB4, LOXL4, LPAR2, LRRC37A3, LRRC8E, LRRN2, LLRTM2, LTB4R, MAGE-A1, MAGEA3, MANSC1, MART1, GP100, MBOAT1, MBOAT7, Melanoma Antigen Family A, Mesothelin (MSLN), MFAP3L, MMP25, MRP1, MT-ND1, Mucin 1 (MUC1), Mucin 16 (MUC16), MYADM, MYADML2, NGFR, N KCS1, NKG2D ligand, NLGN3, NPAS2, NY-ESO-1, carcinoembryonic antigen (h5T4), OTOA, P2RY13, p53, PDE3A, PEAR1, PIEZO1, PLXNA4, PLXNC1, PNPLA3, PPFIA4, PPP2R5B, PRAME, PRAME, prostate stem cell antigen (PSCA), prostate-specific membrane antigen (PSMA), proteinase 3 (PR1), PSD2, PTPRJ, RDH16, receptor tyrosine protein kinase Erb-B2, RHBDL3, RNF173, RNF183, ROR 1. RYR2, SCIN, SCN11A, SCN2A, SCNN1D, SEC31B, SEMA4A, SH3PXD2A, SIGLEC11, SIRPB1, SLC16A6, SLC19A1, SLC22A5, SLC25A36, SLC25A41, SLC30A1, SLC34A3, SLC43A3, SLC44A1, SLC44A3, SLC45A3, SLC6A16, SLC6A6, SLC8A3, SLC9A1, SLCO2B1, SPAG17, STC1, STON2, SUN3, survivin, S USD2, SYNC, TACSTD2, TAS1R3, TEX29, TFR2, TIM-3 (HAVCR2), TLR2, TMEFF2, TMEM145, TMEM27, TMEM40, TMEM59L, TMEM89, TMPRSS5, TNFRSF14, TNFRSF1B, TRIM55, TSPEAR, TTYH3, tumor-associated glycoprotein 72 (TAG-72), tyrosinase, vascular endothelial growth factor R2 (VEGF-R2), VLA-4, Wilms tumor protein (WT-1), WNT4, WT1, and ZDHHC11.

[0323] In some embodiments, the second antigen is selected from the group consisting of: CD70, SIGLEC-6, IL1RAP, CLEC12A, GRP78, TIM3, CD19, CD20, CD22, BCMA, GPRC5D, SLAMF7, CD276, and CAIX. In some embodiments, the second antigen is CD70.

[0324] In some embodiments, the first antigen and the second antigen are different. In some embodiments, the second antigen is CD70. In some embodiments, the first antigen is CD312 and the second antigen is CD70. In some embodiments, the first antigen is CD276 and the second antigen is CD70.

[0325] In some embodiments, the second antigen is CD19. In some embodiments, the first antigen is CD22 and the second antigen is CD19.

[0326] In some embodiments, the second antigen is a pathogen antigen, such as the pathogen antigen disclosed in Section 2.1.1.

[0327] 2.2.2. TCR-like fusion molecules

[0328] In some embodiments, the second antigen recognition receptor is a TCR-like fusion molecule. Non-limiting examples of TCR fusion molecules include HLA-independent TCR-based chimeric antigen receptors (also known as “HITs”, e.g., those disclosed in International Patent Application No. PCT / US19 / 017525, which is incorporated herein by reference in its entirety) and T-cell receptor fusion constructs (TRuCs) (e.g., those disclosed in Baeuerle et al., “Synthetic TRuC receptors engaging the complete T cell receptor for potent anti-tumor response,” Nature Communications, Vol. 10, Article No. 2087 (2019), which is incorporated herein by reference in its entirety).

[0329] In some embodiments, the TCR-like fusion molecule is a recombinant T-cell receptor (TCR). In some embodiments, the recombinant TCR comprises at least one antigen-binding strand. In some embodiments, the antigen-binding domain of the recombinant TCR comprises an antigen-binding portion of a ligand targeting a cell surface receptor, a receptor targeting a cell surface ligand, an antibody, or a fragment thereof, or an antigen-binding portion of the TCR. In some embodiments, the recombinant TCR comprises two antigen-binding strands, namely, a first antigen-binding strand and a second antigen-binding strand. In some embodiments, the first antigen-binding strand and the second antigen-binding strand each comprise a constant domain. In some embodiments, the recombinant TCR binds to an antigen (e.g., a first antigen or a second antigen) in an HLA-independent manner. Therefore, in some embodiments, the recombinant TCR is an HLA-independent (or non-HLA-bound) TCR (referred to as "HIT").

[0330] In some embodiments, the first antigen-binding chain includes the heavy chain variable region (V0) of the antibody. H The second antigen-binding chain comprises an antigen-binding fragment of the antibody. In some embodiments, the second antigen-binding chain includes the light chain variable region (V0). L The antigen-binding fragment of the antibody. In some embodiments, the first antigen-binding chain comprises the V of the antibody. H The antigen-binding fragment, and the second antigen-binding chain contains the antibody's V. L Antigen-binding fragments.

[0331] In some embodiments, the constant domain comprises a TCR constant region selected from the group consisting of: natural or modified TRAC peptides, natural or modified TRBC peptides, natural or modified TRDC peptides, natural or modified TRGC peptides, and any variants or functional fragments thereof. In some embodiments, the constant domain comprises a natural or modified TRAC peptide. In some embodiments, the constant domain comprises a natural or modified TRBC peptide. In some embodiments, the first antigen-binding chain comprises a TRAC peptide, and the second antigen-binding chain comprises a TRBC peptide. In some embodiments, the first antigen-binding chain comprises a TRBC peptide, and the second antigen-binding chain comprises a TRAC peptide.

[0332] In some embodiments, the first antigen-binding chain comprises the antibody's V... H And TRAC peptide, and the second antigen-binding chain contains the antibody's V. L And TRBC peptides.

[0333] In some embodiments, the first antigen-binding chain comprises the antibody's V... H And TRBC peptide, and the second antigen-binding chain contains the antibody's V. L And TRAC peptides.

[0334] In some embodiments, at least one of the TRAC peptide and the TRBC peptide is endogenous. In some embodiments, the TRAC peptide is endogenous. In some embodiments, the TRBC peptide is endogenous. In some embodiments, both the TRAC peptide and the TRBC peptide are endogenous.

[0335] In some embodiments, the antigen-binding chain is capable of associating with the CD3ζ peptide. In some embodiments, upon binding to the antigen, the antigen-binding chain is capable of activating the CD3ζ peptide associated with the antigen-binding chain. In some embodiments, activation of the CD3ζ peptide can activate immune response cells. In some embodiments, the TCR-like fusion molecule is capable of integrating with the CD3 complex and providing HLA-independent antigen recognition. In some embodiments, the TCR-like fusion molecule replaces the endogenous TCR in the CD3 / TCR complex.

[0336] In some embodiments, the first antigen-binding strand and the second antigen-binding strand are at approximately 2 × 10⁻⁶. -7 The dissociation constant (K D The first antigen-binding chain and the second antigen-binding chain bind to the antigen with high binding affinity. In some embodiments, K... D Approximately 2 × 10 -7 M or smaller, approximately 1×10 -7 M or smaller, approximately 9×10 -8 M or smaller, approximately 1×10 -8 M or smaller, approximately 9×10 -9 M or smaller, approximately 5×10 -9 M or smaller, approximately 4×10 -9 M or smaller, approximately 3×10 -9 Or smaller, approximately 2×10 -9 M or smaller or approximately 1×10 -9 M or smaller. In some embodiments, K D Approximately 1×10 -8 M or smaller. In some embodiments, K D Approximately 3 × 10 -9 M or smaller. In some embodiments, K D Approximately 5 × 10 -9 M or smaller. In some embodiments, K D Approximately 1×10 -9 M to approximately 1×10 -8 M. In some embodiments, K D Approximately 1.5 × 10 -9 M to approximately 1×10 - 8 M. In some embodiments, K D Approximately 5 × 10-9 M to approximately 1×10 -8 M.

[0337] In some embodiments, the constant domain includes a TCR constant region, such as the T cell receptor α constant region (TRAC), the T cell receptor β constant region (TRBC, e.g., TRBC1 or TRBC2), the T cell receptor γ constant region (TRGC, e.g., TRGC1 or TRGC2), the T cell receptor δ constant region (TRDC), or any variant or functional fragment thereof.

[0338] In some embodiments, the first antigen-binding strand or the second antigen-binding strand comprises a constant domain comprising a natural or modified TRAC polypeptide. In some embodiments, the TRAC polypeptide comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence or fragment thereof shown in SEQ ID NO:40, and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the TRAC polypeptide comprises or is composed of the amino acid sequence shown in SEQ ID NO:40. SEQ ID NO:40 is provided below.

[0339]

[0340] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:40 is shown in SEQ ID NO:41 provided below.

[0341]

[0342] In some embodiments, the TRAC polypeptide comprises at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence or fragments thereof shown in SEQ ID NO:42, and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the TRAC polypeptide comprises or is composed of the amino acid sequence shown in SEQ ID NO:42. SEQ ID NO:42 is provided below.

[0343]

[0344] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:42 is shown in SEQ ID NO:43 provided below.

[0345]

[0346]

[0347] In some embodiments, the TRAC polypeptide comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to an amino acid sequence or fragment thereof encoded by a transcript expressed by a gene expressed via NCBI Genbank ID:28755, NG_001332.3, range 925603 to 930229 (SEQ ID NO:44), and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the TRAC polypeptide comprises or consists of an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:44. SEQ ID NO:44 is provided below.

[0348]

[0349]

[0350]

[0351]

[0352] In some embodiments, the first antigen-binding strand or the second antigen-binding strand comprises a constant domain, said constant domain comprising a natural or modified TRBC polypeptide. In some embodiments, the TRBC polypeptide is a TRBC2 polypeptide. In some embodiments, the TRBC2 polypeptide comprises or consists of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% homologous or identical amino acid sequence to or from the amino acid sequence shown in SEQ ID NO:45, and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the TRBC2 polypeptide comprises or consists of the amino acid sequence shown in SEQ ID NO:45. SEQ ID NO:45 is provided below.

[0353]

[0354] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:45 is shown in SEQ ID NO:46 provided below.

[0355]

[0356]

[0357] In some embodiments, the TRBC polypeptide is the TRBC2 polypeptide. In some embodiments, the TRBC2 polypeptide comprises or consists of the following: an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence or fragments thereof shown in SEQ ID NO:47, and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the TRBC2 polypeptide comprises or consists of the amino acid sequence shown in SEQ ID NO:47. SEQ ID NO:47 is provided below.

[0358]

[0359] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:47 is shown in SEQ ID NO:48 provided below.

[0360]

[0361]

[0362] In some embodiments, the TRBC polypeptide is the TRBC1 polypeptide. In some embodiments, the TRBC1 polypeptide comprises or consists of the following: an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence or fragments thereof shown in SEQ ID NO:49, and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the TRBC1 polypeptide comprises or consists of the amino acid sequence shown in SEQ ID NO:49. SEQ ID NO:49 is provided below.

[0363]

[0364] In some embodiments, the TRBC1 polypeptide comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous to or identical to the amino acid sequence or fragment thereof shown in SEQ ID NO:50, and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the TRBC1 polypeptide comprises or consists of the amino acid sequence shown in SEQ ID NO:50. SEQ ID NO:50 is provided below.

[0365]

[0366] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:50 is shown in SEQ ID NO:51 provided below.

[0367]

[0368]

[0369] In some embodiments, the TRBC polypeptide comprises or consists of an amino acid sequence or fragment thereof encoded by a transcript expressed by a gene from NCBI Genbank ID:28639, NG_001333.2, range 645749 to 647196 (TRBC1, SEQ ID NO:52), NCBI Genbank ID:28638, NG_001333.2, range 655095 to 656583 (TRBC2, SEQ ID NO:53), comprising or consisting of at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to such an amino acid sequence, and / or optionally may comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the TRBC polypeptide comprises or consists of an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:52. In some embodiments, the TRBC polypeptide comprises or consists of an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:53. SEQ ID NO:52 and 53 are provided below.

[0370]

[0371]

[0372]

[0373] In some embodiments, the first antigen-binding strand or the second antigen-binding strand comprises a constant domain, said constant domain comprising a natural or modified TRGC polypeptide. In some embodiments, the TRGC polypeptide is a natural or modified TRGC1 polypeptide. In some embodiments, the TRGC1 polypeptide comprises or consists of an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% homologous to the amino acid sequence shown in SEQ ID NO:54 provided below. In some embodiments, the TRGC1 polypeptide comprises or consists of the amino acid sequence shown in SEQ ID NO:54.

[0374]

[0375] In some embodiments, the TRGC polypeptide is a natural or modified TRGC2 polypeptide. In some embodiments, the TRGC2 polypeptide comprises or consists of an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% homologous to the amino acid sequence shown in SEQ ID NO:55 provided below. In some embodiments, the TRGC2 polypeptide comprises or consists of the amino acid sequence shown in SEQ ID NO:55.

[0376]

[0377] In some embodiments, the TRGC polypeptide comprises or consists of an amino acid sequence or fragment thereof encoded by a transcript expressed by a gene expressed via NCBI Genbank ID:6966, NG_001336.2, range 108270 to 113860 (TRGC1, SEQ ID NO:56), NCBI Genbank ID:6967, NG_001336.2, range 124376 to 133924 (TRGC2, SEQ ID NO:57), representing at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% homologous to or identical to such an amino acid sequence, and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the TRGC polypeptide comprises or consists of an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:56. In some embodiments, the TRGC polypeptide comprises or consists of an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:57.

[0378] SEQ ID NO:56 and 57 are provided below.

[0379]

[0380]

[0381]

[0382]

[0383]

[0384]

[0385]

[0386]

[0387]

[0388]

[0389]

[0390] In some embodiments, the first antigen-binding strand or the second antigen-binding strand comprises a constant domain, said constant domain comprising a natural or modified TRDC polypeptide. In some embodiments, the TRDC polypeptide comprises or consists of an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% homologous to the amino acid sequence shown in SEQ ID NO:58 provided below. In some embodiments, the TRDC polypeptide comprises or consists of the amino acid sequence shown in SEQ ID NO:58.

[0391]

[0392] In some embodiments, the TCR-like fusion molecule includes a hinge / spacer region connecting a first antigen-binding strand to a constant domain. In some embodiments, the TCR-like fusion molecule includes a hinge / spacer region connecting a second antigen-binding strand to a constant domain. The hinge / spacer region may be flexible enough to allow the antigen-binding strand to orient in different directions, thereby facilitating antigen recognition. In some embodiments, the hinge / spacer region may be a hinge region from IgG1, a portion of the CH2CH3 region and CD3 of an immunoglobulin, a portion of a TCRα polypeptide, a portion of a TCRβ polypeptide, a portion of a CD28 polypeptide, a portion of a CD8 polypeptide, or a synthetic spacer sequence. In some embodiments, the hinge / spacer region includes a portion of a TCRα polypeptide. In some embodiments, the hinge / spacer region includes a portion of a variable region (TRAV), a portion of a diversity region (TRAD), a portion of a conjugating region (TRAJ), a portion of a constant region (TRAC), or a combination thereof. In some embodiments, the hinge / spacer region includes a portion of the TRAJ region and a portion of the TRAC region of the TCRα polypeptide. In some embodiments, the hinge / spacer region comprises or consists of the amino acid sequence shown in SEQ ID NO:59. In some embodiments, the hinge / spacer region comprises or consists of amino acids 1 to 3 of the sequence shown in SEQ ID NO:59. An exemplary nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:59 is shown in SEQ ID NO:60. SEQ ID NO:59 and 60 are provided below.

[0393] IPNIQNPDPA [SEQ ID NO:59]

[0394] ATTCCCAATATCCAGAACCCTGACCCTGCC[SEQ ID NO:60]

[0395] In some embodiments, the hinge / spacer region comprises a portion of the TCRβ polypeptide. In some embodiments, the hinge / spacer region comprises a portion of the variable region (TRBV), a portion of the diversity region (TRBD), a portion of the conjugation region (TRBJ), a portion of the constant region (TRBC), or a combination thereof. In some embodiments, the hinge / spacer region comprises a portion of the TRBJ region and a portion of the TRAC region (C) of the TCRβ polypeptide. In some embodiments, the hinge / spacer region comprises or consists of the amino acid sequence shown in SEQ ID NO:61. In some embodiments, the hinge / spacer region comprises or consists of amino acids 1 to 2 of the sequence shown in SEQ ID NO:61. An exemplary nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:61 is shown in SEQ ID NO:62. SEQ ID NO:61 and 62 are provided below. LEDLKNVFPPE [SEQ ID NO:61]

[0396] CTGGAGGATCTGAAAAACGTGTTCCCTCCTGAA[SEQ ID NO:62]

[0397] In some embodiments, the antigen-binding chain does not contain an intracellular domain. In some embodiments, the antigen-binding chain is capable of associating with the CD3ζ peptide. In some embodiments, the antigen-binding chain associates with the CD3ζ peptide via a constant domain. In some embodiments, the CD3ζ peptide is endogenous. In some embodiments, the CD3ζ peptide is exogenous. In some embodiments, binding of the antigen-binding chain to the target antigen can activate the CD3ζ peptide associated with the antigen-binding chain. In some embodiments, the exogenous CD3ζ peptide is fused or integrated with the co-stimulatory molecule disclosed herein.

[0398] In some embodiments, the TCR-like fusion molecule comprises an antigen-binding strand containing an intracellular domain. In some embodiments, the intracellular domain comprises a CD3ζ polypeptide. In some embodiments, binding of the antigen-binding strand to an antigen can activate the CD3ζ polypeptide of the antigen-binding strand.

[0399] In some embodiments, the CD3ζ polypeptide comprises or consists of an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous to the amino acid sequence or fragment thereof shown in SEQ ID NO:12, and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the CD3ζ polypeptide comprises or consists of an amino acid sequence of at least about 20, at least about 30, at least about 40, at least about 50, and at most about 164 amino acids as a continuous portion of SEQ ID NO:8. In some embodiments, CD3ζ comprises or consists of an amino acid sequence of amino acids 1 to 164, 1 to 50, 50 to 100, 52 to 164, 100 to 150, or 150 to 164 of SEQ ID NO:8. In some embodiments, the CD3ζ polypeptide comprises or consists of amino acids 52 to 164 of SEQ ID NO:8.

[0400] In some embodiments, the CD3ζ polypeptide comprises or consists of the following: an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous to or identical to a fragment of SEQ ID NO:9 or thereof, and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, the CD3ζ polypeptide comprises or consists of the amino acid sequence shown in SEQ ID NO:9.

[0401] In some embodiments, the TCR-like fusion molecule comprises an antigen-binding strand containing an intracellular domain, wherein the intracellular domain includes a co-stimulatory signaling region. In some embodiments, the intracellular domain includes a co-stimulatory signaling region and a CD3ζ peptide. In some embodiments, the intracellular domain includes a co-stimulatory signaling region but does not contain a CD3ζ peptide. In some embodiments, the co-stimulatory signaling region includes an intracellular domain of at least the co-stimulatory molecules disclosed herein.

[0402] In some embodiments, the TCR-like fusion molecule is capable of associating with the CD3 complex (also known as a "T-cell co-receptor"). In some embodiments, the TCR-like fusion molecule and the CD3 complex form an antigen recognition receptor complex similar to the native TCR / CD3 complex. In some embodiments, the CD3 complex is endogenous. In some embodiments, the CD3 complex is exogenous. In some embodiments, the TCR-like fusion molecule replaces the native and / or endogenous TCR in the CD3 / TCR complex. In some embodiments, the CD3 complex comprises a CD3γ chain, a CD3δ chain, and two CD3ε chains.

[0403] In some embodiments, the CD3γ chain comprises or consists of the following: an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous to or identical to an amino acid sequence or fragment thereof having NCBI reference number: NP_000064.1 (SEQ ID NO: 63), and / or may optionally contain at most one, or at most two, or at most three conserved amino acid substitutions.

[0404] The following provides SEQ ID NO:63.

[0405]

[0406] In some embodiments, the CD3δ chain comprises or consists of at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous or identical amino acid sequences to or fragments thereof having NCBI reference number: NP_000723.1 (SEQ ID NO: 64) or NCBI reference number: NP_001035741.1 (SEQ ID NO: 65), and / or may optionally contain at most one, at most two, or at most three conserved amino acid substitutions. SEQ ID NO: 64 and 65 are provided below.

[0407]

[0408] In some embodiments, the CD3ε chain comprises or consists of the following: an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous to or identical to an amino acid sequence or fragment thereof having NCBI reference number: NP_000724.1 (SEQ ID NO: 66), and / or may optionally comprise at most one, or at most two, or at most three conserved amino acid substitutions.

[0409] The following provides SEQ ID NO:66.

[0410]

[0411] In some embodiments, TCR-like fusion molecules exhibit higher antigen sensitivity compared to CARs targeting the same antigen. In some embodiments, TCR-like fusion molecules can induce an immune response when binding to an antigen having a low antigen density on the surface of tumor cells. In some embodiments, cells containing TCR-like fusion molecules can be used to treat subjects with tumor cells exhibiting low levels of surface antigen expression (e.g., from disease recurrence), wherein the subject has received treatment that induces residual tumor cells. In some embodiments, the tumor cells have a low antigen density of target molecules on their surface. In some embodiments, the target molecules having a low antigen density on the cell surface have densities of less than about 5,000 molecules / cell, less than about 4,000 molecules / cell, less than about 3,000 molecules / cell, less than about 2,000 molecules / cell, less than about 1,500 molecules / cell, less than about 1,000 molecules / cell, less than about 500 molecules / cell, less than about 200 molecules / cell, or less than about 100 molecules / cell. In some embodiments, target molecules with low antigen density on the cell surface have a density of less than about 2,000 molecules / cell. In some embodiments, target molecules with low antigen density on the cell surface have a density of less than about 1,500 molecules / cell. In some embodiments, target molecules with low antigen density on the cell surface have a density of less than about 1,000 molecules / cell. In some embodiments, target molecules with low antigen density on the cell surface have a density between about 4,000 molecules / cell and about 2,000 molecules / cell, between about 2,000 molecules / cell and about 1,000 molecules / cell, between about 1,500 molecules / cell and about 1,000 molecules / cell, between about 2,000 molecules / cell and about 500 molecules / cell, between about 1,000 molecules / cell and about 200 molecules / cell, or between about 1,000 molecules / cell and about 100 molecules / cell.

[0412] In some embodiments, TCR-like fusion molecules can induce an immune response when they bind to an antigen expressed on the surface of tumor cells having a low tumor cell frequency. In some embodiments, cells containing TCR-like fusion molecules can be used to treat subjects with tumor cells having a low tumor cell frequency (e.g., from disease recurrence), wherein the subject has received treatment that induces residual tumor cells. In some embodiments, tumors having a low tumor cell frequency have a frequency of less than about 40% / tumor, less than about 30% / tumor, less than about 20% / tumor, less than about 15% / tumor, less than about 10% / tumor, less than about 5% / tumor, less than about 2% / tumor, or less than about 1% / tumor. In some embodiments, the low tumor cell frequency is less than about 2% / tumor. In some embodiments, the low tumor cell frequency is less than about 1.5% / tumor. In some embodiments, the low tumor cell frequency is less than about 1% / tumor. In some embodiments, the low tumor cell frequency is between about 40% / tumor and about 20% / tumor, between about 20% / tumor and about 10% / tumor, between about 15% / tumor and about 10% / tumor, between about 20% / tumor and about 5% / tumor, between about 10% / tumor and about 2% / tumor, or between about 10% / tumor and about 1% / tumor.

[0413] In some embodiments, the second antigen recognition receptor is a TCR-like fusion molecule comprising: a first antigen-binding chain, wherein the first antigen-binding chain comprises the antibody's V... H and a constant domain containing the TRBC peptide; and a second antigen-binding chain, the second antigen-binding chain containing the antibody's V... L And a constant structural domain containing the TRAC peptide. In some embodiments, the first antigen-binding chain is named "V". H -TRBC chain". In some embodiments, the second antigen-binding chain is named "V". L -TRAC chain". In some embodiments, the first antigen-binding chain is contained in V H A hinge region between the TRBC peptide and the target peptide. In some embodiments, the hinge region comprises or consists of the amino acid sequence shown in SEQ ID NO:59 or SEQ ID NO:61. In some embodiments, the second antigen-binding chain contains V L A hinge region between the peptide and the TRAC peptide. In some embodiments, the hinge region comprises or consists of the amino acid sequence shown in SEQ ID NO:59 or SEQ ID NO:61.

[0414] In some embodiments, the second antigen recognition receptor is a TCR-like fusion molecule comprising: a first antigen-binding chain, wherein the first antigen-binding chain comprises the antibody's V... Hand a constant domain containing the TRAC peptide; and a second antigen-binding chain, the second antigen-binding chain containing the antibody's V... L And a constant structural domain containing the TRBC peptide. In some embodiments, the first antigen-binding chain is named "V". H -TRAC chain". In some embodiments, the second antigen-binding chain is named "V". L -TRBC chain". In some embodiments, the first antigen-binding chain is contained in V H The hinge region between the peptide and the TRAC peptide. In some embodiments, the second antigen-binding chain is contained in V. L The hinge region between the TRBC peptide and the second antigen-binding strand. In some embodiments, the first antigen-binding strand and the second antigen-binding strand bind to a second antigen (e.g., human CD70).

[0415] In some embodiments, the second antigen recognition receptor is a TCR-like fusion molecule comprising: a first antigen-binding chain, wherein the first antigen-binding chain comprises the antibody's V... H and a constant domain containing the TRBC peptide; and a second antigen-binding chain, the second antigen-binding chain containing the antibody's V... L And a constant structural domain containing the TRAC peptide. In some embodiments, the first antigen-binding chain is named "V". H -TRBC chain". In some embodiments, the second antigen-binding chain is named "V". L -TRAC chain". In some embodiments, the first antigen-binding chain is contained in V H The hinge region between the peptide and the TRAC peptide. In some embodiments, the second antigen-binding chain is contained in V. L The hinge region between the TRBC peptide and the second antigen-binding strand. In some embodiments, the first antigen-binding strand and the second antigen-binding strand bind to a second antigen (e.g., human CD70).

[0416] 2.2.2.1. Exemplary TCR-like fusion molecule

[0417] In some embodiments, the second antigen recognition receptor is a TCR-like fusion molecule that binds to CD70 (e.g., human CD70) and comprises two antigen-binding strands capable of dimerizing and binding to CD70, for example, containing V H The first antigen-binding chain of the TRBC peptide (“V”) H -TRBC chain) and includes V L The second antigen-binding chain of the TRBC peptide (“V”) L -TRAC chain). In some embodiments, V HIt contains CDR1 containing the amino acid sequence shown in SEQ ID NO:133, CDR2 containing the amino acid sequence shown in SEQ ID NO:134, and CDR3 containing the amino acid sequence shown in SEQ ID NO:135. In some embodiments, V H It contains the amino acid sequence shown in SEQ ID NO:139. In some embodiments, V L It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:136, CDR2 containing the amino acid sequence shown in SEQ ID NO:137, and CDR3 containing the amino acid sequence shown in SEQ ID NO:138. In some embodiments, V L The amino acid sequence shown in SEQ ID NO:141 is included. In some embodiments, the TRBC polypeptide includes the amino acid sequence shown in SEQ ID NO:42. In some embodiments, the TRBC polypeptide is the TRBC2 polypeptide. In some embodiments, the TRBC2 polypeptide includes the amino acid sequence shown in SEQ ID NO:47. In some embodiments, the TCR-like fusion molecule is named "70-HIT" or "70H". SEQ ID NOs:133 to 142 are provided in Table 7 below.

[0418] In some embodiments, the Kabat system is used to describe the CDR regions / sequences disclosed herein (Swindells et al., J MolBiol. 3 Feb 2017; 429(3):356-364).

[0419] Table 7

[0420]

[0421] In some embodiments, the second antigen recognition receptor is a TCR-like fusion molecule that binds to CD70 (e.g., human CD70) and comprises two antigen-binding strands capable of dimerizing and binding to CD70, for example, containing V H The first antigen-binding chain of the TRBC peptide (“V”) H -TRBC chain) and includes V L The second antigen-binding chain of the TRBC peptide (“V”) L -TRAC chain). In some embodiments, V H V containing the anti-CD70 antibody disclosed in International Patent Publication No. WO 2007 / 038637 H The sequences CDR1, CDR2, and CDR3, the international patent disclosure thereof, are incorporated herein by reference in their entirety. In some embodiments, V HV containing the anti-CD70 antibody 2H5 disclosed in International Patent Publication No. WO 2007 / 038637 H The sequence CDR1, CDR2, and CDR3. In some embodiments, V L V containing the anti-CD70 antibody disclosed in International Patent Publication No. WO 2007 / 038637 H The sequence CDR1, CDR2, and CDR3. In some embodiments, V L V containing the anti-CD70 antibody 2H5 disclosed in International Patent Publication No. WO2007 / 038637 H The CDR1, CDR2, and CDR3 of the sequence.

[0422] In some embodiments, the second antigen recognition receptor is a TCR-like fusion molecule that binds to CD19 (e.g., human CD19) and comprises two antigen-binding strands capable of dimerizing and binding to CD19, for example, containing V H The first antigen-binding chain of the TRBC peptide (“V”) H -TRBC chain) and includes V L The second antigen-binding chain of the TRBC peptide (“V”) L -TRAC chain). In some embodiments, V H It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:143, CDR2 containing the amino acid sequence shown in SEQ ID NO:144, and CDR3 containing the amino acid sequence shown in SEQ ID NO:145. In some embodiments, V H It contains the amino acid sequence shown in SEQ ID NO:149. In some embodiments, V L It contains CDR1 containing the amino acid sequence shown in SEQ ID NO:146, CDR2 containing the amino acid sequence shown in SEQ ID NO:147, and CDR3 containing the amino acid sequence shown in SEQ ID NO:148. In some embodiments, V L The amino acid sequence shown in SEQ ID NO:151 is included. In some embodiments, the TRBC polypeptide includes the amino acid sequence shown in SEQ ID NO:42. In some embodiments, the TRBC polypeptide is the TRBC2 polypeptide. In some embodiments, the TRBC2 polypeptide includes the amino acid sequence shown in SEQ ID NO:47. In some embodiments, the TCR-like fusion molecule is named "19-HIT" or "19H". SEQ ID NOs:143 to 152 are provided in Table 8 below.

[0423] In some embodiments, the Kabat system is used to describe the CDR regions / sequences disclosed herein (Swindells et al., J MolBiol. 3 Feb 2017; 429(3):356-364).

[0424] Table 8

[0425]

[0426] Various TCR-like fusion molecules are disclosed in International Patent Application Publication No. WO2019 / 133969, which is hereby incorporated by reference in its entirety.

[0427] 2.2.3. Delivery of the second antigen recognition receptor

[0428] In some embodiments, a viral method is used to deliver the second antigen recognition receptor into cells. In some embodiments, the viral method includes a viral vector. In some embodiments, the viral vector is a retroviral vector (e.g., a gamma retroviral vector or a lentiviral vector). Other viral vectors include adenovirus vectors, adeno-associated virus vectors, vaccinia virus, bovine papillomavirus, and herpesviruses (e.g., such as Epstein-Barr virus).

[0429] In some embodiments, the second antigen recognition receptor is delivered to cells using non-viral methods. Any targeted genome editing method can also be used to deliver the second antigen recognition receptor to cells. In some embodiments, the second antigen recognition receptor is delivered to cells using methods including: homologous recombination, zinc finger nucleases, large-scale nucleases, transcription activator-like effector nucleases (TALENs), clustered regularly spaced short palindromic repeat (CRISPR) systems, or combinations thereof. In some embodiments, a CRISPR system is used to deliver the second antigen recognition receptor to cells.

[0430] In some embodiments, the cell is a T cell, and the second antigen recognition receptor is integrated at a locus within the T cell's genome. Non-limiting examples of loci include the TRAC locus, TRBC locus, TRDC locus, and TRGC locus. In some embodiments, the locus is either the TRAC locus or the TRBC locus. In some embodiments, the cell is a T cell, and the second antigen recognition receptor is integrated at the TRAC locus.

[0431] 2.3.CCR

[0432] In some embodiments, the cells containing a first antigen recognition receptor and a second antigen recognition receptor disclosed in this application further include a chimeric co-stimulatory receptor (CCR). The term "chimeric co-stimulatory receptor" or "CCR" refers to a chimeric receptor that binds to an antigen and provides a co-stimulatory signal but does not provide a T-cell activation signal to cells containing the CCR. Various CCRs are described in US20020018783, the contents of which are incorporated herein by reference in their entirety. CCRs mimic co-stimulatory signals but, unlike CARs, do not provide a T-cell activation signal. In some embodiments, the CCR lacks the CD3ζ peptide.

[0433] In the absence of natural co-stimulatory ligands on antigen-presenting cells, CCRs provide co-stimulatory signals (e.g., CD28-like or 4-1BB-like signals). Combination antigen recognition (i.e., the combined use of CCRs and CARs) can enhance T cell responsiveness against T cells expressing dual antigens, thereby improving selective tumor targeting. Kloss et al. described a strategy that integrates combined antigen recognition, fission signaling, and a balanced intensity of key T cell activation and co-stimulation to generate T cells that eliminate target cells expressing the antigen combination while retaining cells expressing each antigen individually (Kloss et al., Nature Biotechnology (2013); 31(1):71-75, the contents of which are incorporated herein by reference in their entirety). Using this method, T cell activation requires CAR-mediated recognition of one antigen, while co-stimulation is independently mediated by a CCR specific for the second antigen. To achieve tumor selectivity, the combination antigen recognition approach reduces the efficiency of T cell activation to a level where it is ineffective without the rescue provided by simultaneous CCR recognition of the second antigen.

[0434] In some embodiments, the CCR includes an extracellular antigen-binding domain that binds to a third antigen, and an intracellular domain capable of delivering a co-stimulatory signal to the cell but not an activation signal alone. In some embodiments, the CCR further includes a transmembrane domain. In some embodiments, the intracellular domain of the CCR includes at least the intracellular domain of a co-stimulatory molecule or a portion thereof. In some embodiments, the co-stimulatory molecule is selected from the group consisting of: CD28, 4-1BB, OX40, CD27, CD40, CD154, CD97, CD11a / CD18, ICOS, DAP-10, CD2, CD150, CD226, and NKG2D.

[0435] In some embodiments, the CCR includes an intracellular domain of CD28 or a portion thereof. In some embodiments, the CCR includes an intracellular domain of 4-1BB or a portion thereof. In some embodiments, the CCR includes an intracellular domain of CD28 or a portion thereof and an intracellular domain of 4-1BB or a portion thereof.

[0436] In some embodiments, a third antigen is selected such that the expression of both the first / second antigen and the third antigen is restricted to target cells (e.g., cancerous tissue, cancer cells, LSCs, or AML HSPCs). Similar to CARs, the extracellular antigen-binding domain can be scFv, Fab, F(ab)2, or a fusion protein having a heterologous sequence for forming the extracellular antigen-binding domain.

[0437] In some embodiments, cells comprising a first antigen recognition receptor, a second antigen recognition receptor, and a CCR exhibit greater cytolytic activity against cells positive for both the first / second antigen and the third antigen compared to cells that are single-positive for the first / second antigen. In some embodiments, cells comprising a first antigen recognition receptor, a second antigen recognition receptor, and a CCR exhibit substantially no or negligible cytolytic activity against cells that are single-positive for the first / second antigen.

[0438] In some embodiments, the first antigen recognition receptor and / or the second antigen recognition receptor have low binding affinity (e.g., about 1 × 10⁻⁶). -8 M or larger, approximately 5×10 -8 M or larger, approximately 1×10 -7 M or larger, approximately 5×10 -7 M or larger, or approximately 1×10 -6 M or larger or approximately 1×10 -8 M to approximately 1×10 -6 The dissociation constant (K D The receptor binds to both the first and second antigens. In some embodiments, the first antigen recognition receptor (e.g., CAR, TCR, or TCR-like fusion molecule) binds to the first antigen with low binding affinity. In some embodiments, the first antigen recognition receptor (e.g., CAR, TCR, or TCR-like fusion molecule) binds to the first antigen at a low-accessibility epitope. In some embodiments, the first antigen recognition receptor (e.g., CAR, TCR, or TCR-like fusion molecule) binds to the first antigen with a lower binding affinity than the second antigen recognition receptor (e.g., CCR). In some embodiments, the CCR binds to the first antigen with a binding affinity of about 1 × 10⁻⁶. -9 M to approximately 1×10 -7 M, for example, approximately 1 × 10 -7 M or smaller, approximately 1×10 -8M or smaller or approximately 1×10 -9 M or smaller binding affinity K D It binds to the third antigen.

[0439] 2.4. T cell receptor (TCR)

[0440] In some embodiments, the cells comprising a first antigen recognition receptor and a second antigen recognition receptor disclosed in this application further comprise a TCR. A TCR is a disulfide-linked heterodimeric protein consisting of two variable chains expressed as part of a complex having an invariant CD3 chain. TCRs are found on the surface of T cells and are responsible for recognizing antigens as peptides that bind to the major histocompatibility complex (MHC) molecule. In some embodiments, the TCR comprises an α chain and a β chain (encoded by TRA and TRB, respectively). In some embodiments, the TCR comprises a γ chain and a δ chain (encoded by TRG and TRD, respectively).

[0441] Each TCR chain consists of two extracellular domains: a variable (V) domain and a constant (C) domain. The constant domain is located near the cell membrane, followed by a transmembrane domain and a short cytoplasmic tail. The variable domain binds to the peptide / MHC complex. Each of the two chains' variable domains has three complementarity-determining regions (CDRs).

[0442] In some embodiments, the TCR can form a receptor complex with three dimeric signaling modules, CD3δ / ε, CD3γ / ε, and CD247ζ / ζ or ζ / η. When the TCR complex binds to its antigen and MHC (peptide / MHC), T cells expressing the TCR complex are activated.

[0443] In some embodiments, the TCR is an endogenous TCR. In some embodiments, the TCR is a naturally occurring TCR.

[0444] In some embodiments, the TCR is an exogenous TCR. In some embodiments, the TCR is a recombinant TCR. In some embodiments, the TCR is a non-naturally occurring TCR. In some embodiments, the non-naturally occurring TCR differs from any naturally occurring TCR by at least one amino acid residue. In some embodiments, the non-naturally occurring TCR differs from any naturally occurring TCR by at least about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 20, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100 or more amino acid residues. In some embodiments, the non-naturally occurring TCR is derived from a naturally occurring TCR by modifying it with at least one amino acid residue. In some embodiments, the non-naturally occurring TCR is formed by modifying a naturally occurring TCR with at least about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 20, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100 or more amino acid residues.

[0445] 2.5. Co-stimulatory ligands

[0446] In some embodiments, the cells disclosed in this application that contain a first antigen recognition receptor and a second antigen recognition receptor further include at least one recombinant or exogenous co-stimulatory ligand. For example, the cells disclosed in this application may be further transduced with at least one co-stimulatory ligand, such that the cells express or are induced to express the first antigen recognition receptor, the second antigen recognition receptor, and the at least one co-stimulatory ligand. The at least one co-stimulatory ligand provides a co-stimulatory signal to the cells.

[0447] Non-limiting examples of costimulatory ligands include, but are not limited to, members of the tumor necrosis factor (TNF) superfamily and immunoglobulin (Ig) superfamily ligands. TNF is a cytokine involved in systemic inflammation and stimulating acute-phase responses. Its primary function is to regulate immune cells. Members of the TNF superfamily share many common characteristics. Most members of the TNF superfamily are synthesized as type II transmembrane proteins (extracellular C-terminus), which contain a short cytoplasmic portion and a relatively long extracellular region. Non-limiting examples of members of the TNF superfamily include: nerve growth factor (NGF), CD40L (also known as "CD154"), 4-1BBL, TNF-α, OX40L, CD70, Fas ligand (FasL), CD30L, tumor necrosis factor β (TNFβ) / lymphotoxin-α (LTα), lymphotoxin-β (LTβ), CD257 / B cell activating factor (BAFF) / Blys / THANK / Tall-1, glucocorticoid-induced TNF receptor ligand (GITRL), TNF-associated apoptosis-inducing ligand (TRAIL), and LIGHT (TNFSF14). The immunoglobulin (Ig) superfamily is a large class of cell surface and soluble proteins involved in cell recognition, binding, or adhesion processes. These proteins share the same structural features as immunoglobulins—they possess immunoglobulin domains (folds). Non-limiting examples of immunoglobulin superfamily ligands include: CD80, CD86, and ICOSLG. In some embodiments, the at least one costimulatory ligand is selected from the group consisting of: 4-1BBL, CD80, CD86, CD70, GITRL, CD40L, OX40L, CD30L, TNFRSF14, ICOSLG, TRAIL, and combinations thereof.

[0448] In some embodiments, the cell further comprises an exogenous costimulatory ligand, which is 4-1BBL. In some embodiments, the costimulatory ligand is human 4-1BBL. In some embodiments, 4-1BBL comprises or consists of: an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or at least about 100% homologous to or identical to an amino acid sequence having Uniprotocol reference number: P41273-1 (SEQ ID NO: 67), and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, 4-1BBL comprises or consists of: an amino acid sequence that is a continuous portion of the amino acid sequence of SEQ ID NO: 67. SEQ ID NO: 67 is provided below.

[0449]

[0450] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:67 is shown in SEQ ID NO:68.

[0451]

[0452]

[0453] In some embodiments, the cell further comprises an exogenous costimulatory ligand, which is CD80. In some embodiments, the costimulatory ligand is human CD80. In some embodiments, CD80 comprises or consists of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, at least 100% homologous or identical to an amino acid sequence or fragment thereof having NCBI reference number: NP_005182 (SEQ ID NO: 69), and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, CD80 comprises or consists of an amino acid sequence that is a continuous portion of the amino acid sequence of SEQ ID NO: 69. SEQ ID NO: 69 is provided below.

[0454]

[0455] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:69 is shown in SEQ ID NO:70. SEQ ID NO:70 is provided below.

[0456]

[0457] In some embodiments, the cell further comprises two exogenous costimulatory ligands, 4-1BBL and CD80. In some embodiments, the cell further comprises two exogenous costimulatory ligands, 4-1BBL and CD80, wherein 4-1BBL comprises or is composed of the amino acid sequence shown in SEQ ID NO:67, and CD80 comprises or is composed of the amino acid sequence shown in SEQ ID NO:69.

[0458] U.S. Patent No. 8,389,282 describes a receptor-containing cell containing at least one exogenous costimulatory ligand, which is incorporated herein by reference in its entirety.

[0459] 2.6. Fusion Peptides

[0460] In some embodiments, the cells containing the first antigen recognition receptor and the second antigen recognition receptor disclosed herein further comprise a fusion polypeptide. For example, the cells disclosed herein can be further transduced with the fusion polypeptide, causing the cells to express or be induced to express the first antigen recognition receptor, the second antigen recognition receptor, and the fusion polypeptide. The fusion polypeptide provides a co-stimulatory signal to the cells. The fusion polypeptide can enhance the activity and / or efficacy of cells containing the first antigen recognition receptor (e.g., a CAR or TCR-like fusion molecule). In some embodiments, the fusion polypeptide comprises: a) an extracellular domain and a transmembrane domain of the co-stimulatory ligand, and b) an intracellular domain of the first co-stimulatory molecule.

[0461] Non-limiting examples of co-stimulatory ligands include members of the tumor necrosis factor (TNF) family, members of the immunoglobulin (Ig) superfamily, and combinations thereof. TNF family members may be selected from the group consisting of: 4-1BBL, OX40L, CD70, GITRL, CD40L, and combinations thereof. Ig superfamily members may be selected from the group consisting of: CD80, CD86, ICOS ligand (ICOSLG (also known as "CD275")), and combinations thereof. In some embodiments, the co-stimulatory ligand is selected from the group consisting of: 4-1BBL, OX40L, CD70, GITRL, CD40L, CD80, CD86, ICOSLG, and combinations thereof.

[0462] In some embodiments, the fusion polypeptide comprises an extracellular domain and a transmembrane domain of a costimulatory ligand for CD80. In some embodiments, the costimulatory ligand is human CD80. In some embodiments, CD80 comprises or consists of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, or at least 100% homologous or identical amino acid sequences to or derived from the amino acid sequence shown in SEQ ID NO:69, and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, CD80 comprises or consists of an amino acid sequence that is a continuous portion of the amino acid sequence of SEQ ID NO:69.

[0463] In some embodiments, the extracellular domain of CD80 comprises or consists of an amino acid sequence that is at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous to or identical to amino acids 1 to 242 of SEQ ID NO: 69. In some embodiments, the extracellular domain of CD80 comprises or consists of amino acids 1 to 242 of SEQ ID NO: 69 or a functional fragment thereof. The functional fragment may be a continuous portion of amino acids 1 to 242 of SEQ ID NO:69, having a length of at least about 50, at least about 75, at least about 100, at least about 125, at least about 150, at least about 175, at least about 200, or at least about 220 amino acids. In some embodiments, the functional fragment retains at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% of the major function of the extracellular domain of CD80. Non-limiting examples of the major function of the extracellular domain of CD80 include: binding / interacting with CD28, binding / interacting with CTLA-4, binding / interacting with PD-L1, and promoting CD80 homodimerization. In some embodiments, the extracellular domain of CD80 comprises or consists of amino acids 1 to 242 of SEQ ID NO:69.

[0464] In some embodiments, the transmembrane domain of CD80 comprises or consists of an amino acid sequence that is at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous to amino acids 243 to 263 of SEQ ID NO: 69. In some embodiments, the transmembrane domain of CD80 comprises or consists of amino acids 243 to 263 of SEQ ID NO: 69 or fragments thereof. Such fragments may be at least about 5, at least about 10, at least about 15, or at least about 20 amino acids in length. In some embodiments, the transmembrane domain of CD80 contains or consists of amino acids 243 to 263 of SEQ ID NO:69.

[0465] Non-restricted examples of co-stimulatory molecules include: CD28, 4-1BB, OX40, ICOS, DAP-10, CD27, CD40, NKG2D, CD2, and combinations thereof.

[0466] In some embodiments, the fusion polypeptide comprises an extracellular domain and a transmembrane domain of a co-stimulatory molecule of type 4-1BB. In some embodiments, the co-stimulatory molecule is human 4-1BB. In some embodiments, 4-1BB comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or at least about 100% homologous to or identical to the amino acid sequence or fragment thereof shown in SEQ ID NO:26, and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, 4-1BB comprises or consists of an amino acid sequence that is a continuous portion of the amino acid sequence of SEQ ID NO:26. In some embodiments, the intracellular domain of 4-1BB comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or at least about 100% homologous to amino acids 214 to 255 of SEQ ID NO:26 or a functional fragment thereof. Such a functional fragment may be a continuous portion of amino acids 214 to 255 of SEQ ID NO:26 with a length of at least about 20, at least about 25, at least about 30, at least about 35, or at least about 40 amino acids. In some embodiments, the functional fragment of amino acids 214 to 255 of SEQ ID NO:26 retains at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% of the major function of the intracellular domain of 4-1BB. Non-limiting examples of the major function of the intracellular domain of 4-1BB include: providing co-stimulatory signaling for the activation and proliferation of immune-responding cells (e.g., T cells), and interacting with and activating downstream adaptors (e.g., TRAF). In some embodiments, the intracellular domain of 4-1BB comprises or consists of amino acids 214 to 255 of SEQ ID NO:26.

[0467] In some embodiments, the co-stimulatory molecule is CD28. In some embodiments, the co-stimulatory molecule is human CD28. In some embodiments, CD28 comprises or consists of: an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or at least about 100% homologous to or identical to the amino acid sequence or fragments thereof shown in SEQ ID NO:7, and / or may optionally comprise at most one, at most two, or at most three conserved amino acid substitutions. In some embodiments, CD28 comprises or consists of: an amino acid sequence that is a continuous portion of the amino acid sequence of SEQ ID NO:7. In some embodiments, the intracellular domain of CD28 comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or at least about 100% homologous to amino acids 180 to 219 of SEQ ID NO:7 or a functional fragment thereof. The functional fragment of amino acids 180 to 219 of SEQ ID NO:7 may be a continuous portion of amino acids 180 to 219 of SEQ ID NO:7 with a length of at least about 20, at least about 25, at least about 30, or at least about 35 amino acids. In some embodiments, such functional fragments retain at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% of the major functions of the intracellular domain of CD28. Non-limiting examples of the major functions of the intracellular domain of CD28 include providing co-stimulatory signaling for the activation and proliferation of immune-response cells (e.g., T cells) and interacting with protein adaptors (e.g., PI3K, GRB2, and LCK). In some embodiments, the intracellular domain of CD28 comprises or consists of amino acids 180 to 219 of SEQ ID NO: 7.

[0468] In some embodiments, the fusion peptide comprises an intracellular domain of a second co-stimulatory molecule. In some embodiments, the fusion peptide comprises an intracellular domain of a third co-stimulatory molecule. In some embodiments, the fusion peptide comprises an intracellular domain of a fourth co-stimulatory molecule. In some embodiments, the fusion peptide comprises an intracellular domain of a fifth co-stimulatory molecule. In some embodiments, the first, second, third, fourth, and fifth co-stimulatory molecules may be the same as or different from each other.

[0469] In some embodiments, the fusion polypeptide comprises an extracellular domain and a transmembrane domain of a costimulatory ligand of CD80, and an intracellular domain of a costimulatory molecule of 4-1BB. In some embodiments, the fusion polypeptide comprises or consists of an amino acid sequence that is at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous to the amino acid sequence shown in SEQ ID NO:71. In some embodiments, the fusion polypeptide comprises or consists of the amino acid sequence shown in SEQ ID NO:71. SEQ ID NO:71 is provided below.

[0470]

[0471] In some embodiments, the fusion peptide comprises an extracellular and transmembrane domain of a costimulatory ligand of CD80, an intracellular domain of a first costimulatory molecule of 4-1BB, and an intracellular domain of a second costimulatory molecule of CD28.

[0472] In some embodiments, the fusion polypeptide comprises an amino acid sequence that is at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous to the amino acid sequence shown in SEQ ID NO:72. In some embodiments, the fusion polypeptide comprises or is composed of the amino acid sequence shown in SEQ ID NO:72. SEQ ID NO:72 is provided below.

[0473]

[0474] Various modified fusion peptides are disclosed in International Patent Application No. PCT / US20 / 42753, which is hereby incorporated herein by reference in its entirety.

[0475] 2.7. Gene Destruction and Gene Modification

[0476] In some embodiments, the cells comprising the first antigen recognition receptor and the second antigen recognition receptor disclosed in this application further include gene disruption at the CD70 locus. Gene disruption at the CD70 locus can cause nonfunctional CD70 protein or knockout of CD70 gene expression. In some embodiments, gene disruption at the CD70 locus causes knockout of CD70 gene expression.

[0477] Non-limiting examples of gene disruption include substitution, deletion, insertion, or combinations thereof. In some embodiments, mutation includes missense mutation, nonsense mutation, or combinations thereof. In some embodiments, deletion includes non-frameshift deletion, frameshift deletion, or combinations thereof. In some embodiments, insertion includes non-frameshift insertion, frameshift insertion, or combinations thereof.

[0478] In some embodiments, the CD70 locus is the human CD70 locus. Genetic disruption of the CD70 locus can be generated using any suitable gene-editing method. In some embodiments, viral methods are used to generate gene disruption of the CD70 locus (e.g., knockout of the CD70 locus). In some embodiments, the viral method includes a viral vector. In some embodiments, the viral vector is a retroviral vector (e.g., a gamma retroviral vector or a lentiviral vector). Other viral vectors include adenovirus vectors, adeno-associated virus vectors, vaccinia virus, bovine papillomavirus, and herpesviruses (e.g., such as Epstein-Barr virus).

[0479] In some embodiments, non-viral methods are used to generate gene disruption at the CD70 locus (e.g., knockout of the CD70 locus). Non-viral methods can also be used for gene modification of cells. For example, nucleic acid molecules can be introduced into cells by administering nucleic acids in the presence of lipid transfection (Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413, 1987; Ono et al., Neuroscience Letters 17:259, 1990; Brigham et al., Am. J. Med. Sci. 298:278, 1989; Staubinger et al., Methods in Enzymology 101:512, 1983), by desialylated serum mucin-polylysine binding (Wu et al., Journal of Biological Chemistry 263:14621, 1988; Wu et al., Journal of Biological Chemistry 264:16985, 1989), or by microinjection under surgical conditions (Wolff et al., Science 247:1465, 1990). Other non-viral methods for gene transfer include in vitro transfection using calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes may also have potential benefits for delivering DNA into cells. Transplanting normal genes into the affected tissues of a subject can also be accomplished by transferring normal nucleic acids ex vivo into culturable cell types (e.g., autologous or allogeneic primary cells or their progeny), followed by injection of the cells (or their progeny) into the target tissue or systemic injection. Recombinant receptors can also be derived or obtained using transposases or targeting nucleases (e.g., zinc finger nucleases, broad-spectrum nucleases, or TALE nucleases, CRISPR). Transient expression can be obtained via RNA electroporation.

[0480] Any targeted genome editing method can also be used to generate gene disruption at the CD70 locus. In some embodiments, gene disruption at the CD70 locus is generated by methods including: homologous recombination, zinc finger nucleases, large-scale nucleases, transcription activator-like effector nucleases (TALENs), clustered regularly spaced short palindromic repeat (CRISPR) systems, or combinations thereof.

[0481] In some embodiments, the CRISPR system is used to generate gene disruption at the CD70 locus.

[0482] The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system is a genome editing tool found in prokaryotic cells. When used for genome editing, the system comprises Cas9 (a protein that uses crRNA as its guide to modify DNA), CRISPR RNA (crRNA, containing the RNA used by Cas9 to guide it to the correct segment of host DNA, and a region that binds to tracrRNA (usually in the form of a hairpin loop), thus forming an active complex with Cas9), trans-activating crRNA (tracrRNA, which binds to crRNA and forms an active complex with Cas9), and an optional segment of the DNA repair template (DNA that guides the cellular repair process, allowing the insertion of a specific DNA sequence). CRISPR / Cas9 is typically transfected into target cells using plasmids. The crRNA needs to be designed for each application because it is the sequence that Cas9 uses to identify and bind directly to the target DNA in the cell. The repair template carrying the CAR expression cassette also needs to be designed for each application because it must overlap the sequence on either side of the cut and encode the insertion sequence. Multiple crRNAs and tracrRNAs can be packaged together to form a single guide RNA (sgRNA). This sgRNA can bind to the Cas9 gene and be made into a plasmid for transfection into cells. In some embodiments, the CRISPR system includes a base editor. In some embodiments, the CRISPR system includes a transposase / recombinase. In some embodiments, the CRISPR system includes a guide editor. In some embodiments, the CRISPR system includes an epigenetic regulator. In some embodiments, the CRISPR system includes a CRISPRoff system. Further details regarding the CRISPR system disclosed in this application can be found in Anzalone et al., Nature biotechnology 38.7(2020):824-844 and In the references of et al., Cell 184.9(2021):2503-2519, the content of each of these references is incorporated by citing the whole.

[0483] In some embodiments, gRNA molecules are used to disrupt the CD70 locus to knock out CD70 expression. The gRNA molecules may target the coding sequence of the CD70 gene (e.g., the human CD70 gene) or a non-coding sequence of the CD70 gene (e.g., the human CD70 gene). In some embodiments, the gRNA molecules target the coding sequence of the CD70 gene (e.g., the human CD70 gene). In some embodiments, the gRNA molecules target a target sequence within the human CD70 gene.

[0484] In some embodiments, zinc finger nucleases are used to generate gene disruption at the CD70 locus. Zinc finger nucleases (ZFNs) are artificial restriction enzymes generated by combining a zinc finger DNA-binding domain with a DNA-cutting domain. The zinc finger domain can be engineered to target specific DNA sequences, allowing the zinc finger nuclease to target desired sequences within the genome. The DNA-binding domain of a single ZFN typically contains multiple individual zinc finger repeat sequences, each recognizing multiple base pairs. The most common method for generating novel zinc finger domains involves combining smaller zinc finger “modules” with known specificity. The most common cutting domain in ZFNs is the non-specific cutting domain derived from the type IIs restriction endonuclease FokI. Using endogenous homologous recombination (HR) mechanisms and homologous DNA templates carrying CAR expression cassettes, ZFNs can be used to insert CAR expression cassettes into the genome. When the target sequence is cleaved by a ZFN, the HR mechanism searches for homology between the damaged chromosome and the homologous DNA template, and then replicates the template sequence between the two broken ends of the chromosome, thereby integrating the homologous DNA template into the genome.

[0485] In some embodiments, the TALEN system is used to generate gene disruption at the CD70 locus. Transcription activator-like effector nucleases (TALENs) are restriction enzymes that can be engineered to cleave specific DNA sequences. TALEN systems operate on a principle nearly identical to ZFNs. They are generated by combining a transcription activator-like effector DNA-binding domain with a DNA-cleaving domain. Transcription activator-like effectors (TALEs) consist of a 33-34 amino acid repeat motif with two variable positions and strong recognition of specific nucleotides. By assembling arrays of these TALEs, the TALE DNA-binding domain can be engineered to bind to the desired DNA sequence, thereby directing the nuclease to cleave at a specific location in the genome. cDNA expression in polynucleotide therapy approaches can be directed by any suitable promoter (e.g., human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionein promoter) and regulated by any suitable mammalian regulatory element or intron (e.g., elongation factor 1a enhancer / promoter / intron structure). For example, enhancers known to preferentially guide gene expression in specific cell types can be used to guide nucleic acid expression, if desired. The enhancers used may include, but are not limited to, enhancers characterized as tissue- or cell-specific enhancers. Alternatively, if the genome clone is used as a therapeutic construct, regulation can be mediated by homologous regulatory sequences or (if desired) by heterologous regulatory sequences derived from any of the promoters or regulatory elements described above.

[0486] The methods used to deliver genome editing agents / systems can vary as needed. In some embodiments, components of the selected genome editing method are delivered as DNA constructs in one or more plasmids. In some embodiments, these components are delivered via viral vectors. Common delivery methods include, but are not limited to, electroporation, microinjection, gene gun, puncture, hydrostatic pressure, continuous infusion, sonication, magnetic infection, adeno-associated virus, envelope protein pseudotypes of viral vectors, cis and trans-acting elements of replicating vectors, herpes simplex virus, and chemical agents (e.g., oligonucleotides, lipoplexes, polymeric vesicles, polymeric complexes, dendritic polymers, inorganic nanoparticles, and cell-penetrating peptides).

[0487] In some embodiments, gene disruption at the CD70 locus can be disruption of the coding region of the CD70 locus and / or disruption of the non-coding region of the CD70 locus. In some embodiments, gene disruption at the CD70 locus includes disruption of the coding region of the CD70 locus. In some embodiments, gene disruption at the CD70 locus includes insertion at the coding region of the CD70 locus. The human CD70 protein contains three exons: exon 1, exon 2, and exon 3. In some embodiments, gene disruption at the CD70 locus includes disruption at one or more of exons 1, 2, and 3 of the CD70 locus. In some embodiments, gene disruption at the CD70 locus includes disruption at exon 1 of the CD70 locus. In some embodiments, gene disruption at the CD70 locus includes insertion at exon 1 of the CD70 locus.

[0488] In some embodiments, the cells comprising the first antigen recognition receptor and the second antigen recognition receptor disclosed in this application further comprise genetic modifications to the CD70 gene. Genetic modifications to the CD70 gene can cause nonfunctional CD70 protein or knockdown of CD70 gene expression. In some embodiments, genetic modifications to the CD70 gene cause knockout of CD70 gene expression.

[0489] In some embodiments, modification of the CD70 gene includes the use of an RNAi agent (including, but not limited to, shRNA, siRNA, LNA, dsRNA, and miRNA). In some embodiments, the RNAi agent includes shRNA. In some embodiments, the RNAi agent (e.g., shRNA) targets one or more isotypes of the CD70 gene, thereby reducing or eliminating the expression of the CD70 gene or CD70 protein. In some embodiments, the RNAi agent (e.g., shRNA) is expressed by the same construct expressing the first antigen recognition receptor and / or the second antigen recognition receptor disclosed herein. In some embodiments, the expression of the RNAi agent (e.g., shRNA), the first antigen recognition receptor, and the second antigen recognition receptor is driven by the same promoter (e.g., the same promoter). In some embodiments, the expression of the shRNA disclosed herein, the first antigen recognition receptor, and the second antigen recognition receptor is driven by different promoters.

[0490] In some embodiments, the RNAi agent (e.g., shRNA) comprises a nucleotide sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% homologous to at least a portion of the CD70 nucleic acid sequence. In some embodiments, the RNAi agent (e.g., shRNA) comprises a nucleotide sequence complementary to the CD70 gene of at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, or at least about 30 nucleotides. In some embodiments, the RNAi agent (e.g., shRNA) comprises a nucleotide sequence of up to 15, 20, 25, 30, 35, 40, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides in length. In some embodiments, the RNAi agent comprises DNA or atypical or non-naturally occurring residues, such as, but not limited to, phosphate thiocyanate residues.

[0491] In some embodiments, the RNAi agent reduces CD70 expression (e.g., endogenous expression) by about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 100%, or any intermediate value or range thereof. In some embodiments, the RNAi agent reduces CD70 expression (e.g., endogenous expression) by about 70%.

[0492] In some embodiments, the RNAi agent targeting the CD70 gene comprises or is composed of the nucleotide sequences shown in SEQ ID NO:161 to 175. In some embodiments, the RNAi agent targeting the CD70 gene comprises or is composed of the nucleotide sequence shown in SEQ ID NO:162. In some embodiments, the RNAi agent targeting the CD70 gene comprises or is composed of the nucleotide sequence shown in SEQ ID NO:167. In some embodiments, the RNAi agent targeting the CD70 gene comprises or is composed of the nucleotide sequence shown in SEQ ID NO:172. SEQ ID Nos:161 to 175 are provided below.

[0493] AUGACAGGUUGAAGCAAGUAGAUA[SEQ ID NO:161]

[0494] CAAGUUCAAGAGAAAAAGUGUAUA[SEQ ID NO:162]

[0495] CGCUGCUGAUUAGGGUUUUUUAUA[SEQ ID NO:163]

[0496] CCGUGAUGGCAUCUACAUGGUAUA[SEQ ID NO:164]

[0497] AAAGAGAAAAAGGUACACACAUA[SEQ ID NO:165]

[0498] UCUACUUGCUUCAACCUGUCAGUG[SEQ ID NO:166]

[0499] UACACUUUUUCUCUUGAACUUAUG[SEQ ID NO:167]

[0500] UAAAAAACCCUAAUCAGCAGCAUG[SEQ ID NO:168]

[0501] UACCAUGUAGAUGCCAUCACGAUG[SEQ ID NO:169]

[0502] UGUGUGUACACUUUUUCUCUUGUG[SEQ ID NO:170]

[0503]

[0504]

[0505] In some embodiments, the cells comprising the first antigen recognition receptor and the second antigen recognition receptor disclosed in this application further include gene disruption of the TRAC locus. In some embodiments, gene disruption of the TRAC locus causes a nonfunctional TCR. In some embodiments, gene disruption of the TRAC locus causes knockout of TCR gene expression.

[0506] Any method used to generate gene disruption at the CD70 locus as disclosed above can also be used to generate gene disruption at the TRAC locus. In some embodiments, gene disruption at the TRAC locus is generated by methods including gene editing methods such as homologous recombination, zinc finger nucleases, large-scale nucleases, transcription activator-like effector nucleases (TALENs), clustered regularly spaced short palindromic repeat (CRISPR) systems, or combinations thereof.

[0507] In some embodiments, gene disruption at the TRAC locus may be disruption of the coding region of the TRAC locus and / or disruption of the non-coding region of the TRAC locus. In some embodiments, gene disruption at the TRAC locus includes disruption of the coding region of the TRAC locus. In some embodiments, gene disruption at the TRAC locus includes insertion at the coding region of the TRAC locus. The human TRAC protein comprises four exons: exon 1, exon 2, exon 3, and exon 4. In some embodiments, the coding region of the TRAC locus comprises exon 1, exon 2, exon 3, and exon 4. In some embodiments, gene disruption at the TRAC locus includes disruption at one or more of exons 1 through 4 of the TRAC locus. In some embodiments, gene disruption at the TRAC locus includes disruption at exon 1 of the TRAC locus. In some embodiments, gene disruption at the TRAC locus includes insertion at exon 1 of the TRAC locus.

[0508] In some embodiments, the cells containing the first antigen recognition receptor and the second antigen recognition receptor disclosed in this application further include genetic modification of the TRAC gene. Genetic modification of the TRAC gene can cause non-functional TCR protein or knockdown of TCR gene expression. In some embodiments, genetic modification of the TRAC gene causes knockout of TCR gene expression.

[0509] In some embodiments, modification of the TRAC gene includes the use of RNAi agents (including, but not limited to, shRNA, siRNA, LNA, dsRNA, and miRNA). In some embodiments, the RNAi agent includes shRNA. In some embodiments, the RNAi agent (e.g., shRNA) targets one or more isotypes of the TRAC gene, thereby reducing or eliminating the expression of the TRAC gene or TCR protein. In some embodiments, the RNAi agent (e.g., shRNA) is expressed by the same construct expressing the first antigen recognition receptor and / or the second antigen recognition receptor disclosed herein. In some embodiments, the expression of the RNAi agent (e.g., shRNA), the first antigen recognition receptor, and the second antigen recognition receptor is driven by the same promoter (e.g., the same promoter). In some embodiments, the expression of the shRNA disclosed herein, the first antigen recognition receptor, and the second antigen recognition receptor is driven by different promoters.

[0510] In some embodiments, the RNAi agent (e.g., shRNA) comprises a nucleotide sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% homologous to at least a portion of the TRAC nucleic acid sequence. In some embodiments, the RNAi agent (e.g., shRNA) comprises a nucleotide sequence complementary to the TRAC gene of at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, or at least about 30 nucleotides. In some embodiments, the RNAi agent (e.g., shRNA) comprises a nucleotide sequence of up to 15, 20, 25, 30, 35, 40, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides in length. In some embodiments, the RNAi agent comprises DNA or atypical or non-naturally occurring residues, such as, but not limited to, phosphate thiocyanate residues.

[0511] In some embodiments, the RNAi agent reduces TCR expression (e.g., endogenous expression) by about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 100%, or any intermediate value or range thereof. In some embodiments, the RNAi agent reduces TCR expression (e.g., endogenous expression) by about 20%. In some embodiments, the RNAi agent reduces TCR expression (e.g., endogenous expression) by about 30%.

[0512] In some embodiments, the RNAi agent targeting the TRAC gene comprises or consists of the nucleotide sequences shown in SEQ ID NO:176 to 190. In some embodiments, the RNAi agent targeting the TRAC gene comprises or consists of the nucleotide sequence shown in SEQ ID NO:180. In some embodiments, the RNAi agent targeting the TRAC gene comprises or consists of the nucleotide sequence shown in SEQ ID NO:185. In some embodiments, the RNAi agent targeting the TRAC gene comprises or consists of the nucleotide sequence shown in SEQ ID NO:190. SEQ ID Nos:176 to 190 are provided below.

[0513] CUCACCGAUUUUGAUUCUCAAAUA[SEQ ID NO:176]

[0514] AUGGUCGAGAAAAGCUUUGAAAUA[SEQ ID NO:177]

[0515] ACGAUUUUGAUUCUCAAACAAAUA[SEQ ID NO:178]

[0516] CUUCACCGAUUUGAUUCUCAAUA[SEQ ID NO:179]

[0517] AAGAUACGAACCUAAACUUUCAUA[SEQ ID NO:180]

[0518] UUUGAGAAUCAAAAUCGGUGAAUG[SEQ ID NO:181]

[0519] UUUCAAAGCUUUUCUCGACCAGUG[SEQ ID NO:182]

[0520] UUUGUUUGAGAAUCAAAAUCGGUG[SEQ ID NO:183]

[0521] UUGAGAAUCAAAAUCGGUGAAUUG[SEQ ID NO:184]

[0522] UGAAAGUUUAGGUUCGUAUCUGUG[SEQ ID NO:185]

[0523]

[0524] In some embodiments, the cells containing the first antigen recognition receptor and the second antigen recognition receptor disclosed in this application further include gene disruption at TRBC loci (e.g., TRBC1 loci, TRBC2 loci). In some embodiments, gene disruption at TRBC loci (e.g., TRBC1 loci, TRBC2 loci) causes nonfunctional TCR. In some embodiments, gene disruption at TRBC loci (e.g., TRBC1 loci, TRBC2 loci) causes knockout of TCR gene expression.

[0525] Any method used to generate gene disruption at the CD70 locus as disclosed above can also be used to generate gene disruption at TRBC loci (e.g., TRBC1 locus, TRBC2 locus). In some embodiments, gene disruption at TRBC loci is generated by methods including gene editing methods such as homologous recombination, zinc finger nucleases, large-scale nucleases, transcription activator-like effector nucleases (TALENs), clustered regularly spaced short palindromic repeat (CRISPR) systems, or combinations thereof.

[0526] In some embodiments, gene disruption at the TRBC locus may be disruption of the coding region of the TRBC1 locus. In some embodiments, gene disruption at the TRBC locus includes disruption of the coding region of the TRBC1 locus. In some embodiments, gene disruption at the TRBC locus includes insertion at the coding region of the TRBC1 locus. The human TRBC1 protein comprises four exons: exon 1, exon 2, exon 3, and exon 4. In some embodiments, the coding region of the TRBC1 locus comprises exon 1, exon 2, exon 3, and exon 4. In some embodiments, gene disruption at the TRBC locus includes disruption at one or more of exons 1 through 4 of the TRBC1 locus. In some embodiments, gene disruption at the TRBC locus includes disruption at exon 1 of the TRBC1 locus. In some embodiments, gene disruption at the TRBC locus includes insertion at exon 1 of the TRBC1 locus.

[0527] In some embodiments, gene disruption at the TRBC locus may be disruption of the coding region of the TRBC2 locus. In some embodiments, gene disruption at the TRBC locus includes disruption of the coding region of the TRBC2 locus. In some embodiments, gene disruption at the TRBC locus includes insertion at the coding region of the TRBC2 locus. The human TRBC2 protein comprises four exons: exon 1, exon 2, exon 3, and exon 4. In some embodiments, the coding region of the TRBC2 locus comprises exon 1, exon 2, exon 3, and exon 4. In some embodiments, gene disruption at the TRBC locus includes disruption at one or more of exons 1 through 4 of the TRBC2 locus. In some embodiments, gene disruption at the TRBC locus includes disruption at exon 1 of the TRBC2 locus. In some embodiments, gene disruption at the TRBC locus includes insertion at exon 1 of the TRBC2 locus.

[0528] In some embodiments, the cells comprising the first antigen recognition receptor and the second antigen recognition receptor disclosed in this application further comprise genetic modifications to the TRBC gene. Genetic modifications to the TRBC gene can cause nonfunctional TCR protein or knockdown of TCR gene expression. In some embodiments, genetic modifications to the TRBC gene cause knockout of TCR gene expression.

[0529] In some embodiments, modification of the TRBC gene includes the use of an RNAi agent (including, but not limited to, shRNA, siRNA, LNA, dsRNA, and miRNA). In some embodiments, the RNAi agent includes shRNA. In some embodiments, the RNAi agent (e.g., shRNA) targets one or more isotypes of the TRBC gene, thereby reducing or eliminating the expression of the TRBC gene or TCR protein. In some embodiments, the RNAi agent (e.g., shRNA) is expressed by the same construct expressing the first antigen recognition receptor and / or the second antigen recognition receptor disclosed herein. In some embodiments, the expression of the RNAi agent (e.g., shRNA), the first antigen recognition receptor, and the second antigen recognition receptor is driven by the same promoter (e.g., the same promoter). In some embodiments, the expression of the shRNA disclosed herein, the first antigen recognition receptor, and the second antigen recognition receptor is driven by different promoters.

[0530] In some embodiments, the RNAi agent (e.g., shRNA) comprises a nucleotide sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% homologous to at least a portion of the TRBC nucleic acid sequence. In some embodiments, the RNAi agent (e.g., shRNA) comprises a nucleotide sequence complementary to the TRBC gene of at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, or at least about 30 nucleotides. In some embodiments, the RNAi agent (e.g., shRNA) comprises a nucleotide sequence of up to 15, 20, 25, 30, 35, 40, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides in length. In some embodiments, the RNAi agent comprises DNA or atypical or non-naturally occurring residues, such as, but not limited to, phosphate thiocyanate residues.

[0531] In some embodiments, the RNAi agent reduces TCR expression (e.g., endogenous expression) by about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 100%, or any intermediate value or range thereof. In some embodiments, the RNAi agent reduces TCR expression (e.g., endogenous expression) by about 60%.

[0532] In some embodiments, the RNAi agent targeting the TRBC gene comprises or consists of the nucleotide sequences shown in SEQ ID NO:191 to 208. In some embodiments, the RNAi agent targeting the TRBC gene comprises or consists of the nucleotide sequence shown in SEQ ID NO:191. In some embodiments, the RNAi agent targeting the TRBC gene comprises or consists of the nucleotide sequence shown in SEQ ID NO:197. In some embodiments, the RNAi agent targeting the TRBC gene comprises or consists of the nucleotide sequence shown in SEQ ID NO:203. SEQ ID Nos:191 to 208 are provided below.

[0533] CCCGCUGUCAAGUCCAGUUCUAUA[SEQ ID NO:191]

[0534] ACGCCCUCAAUGACUCCAGAUAUA[SEQ ID NO:192]

[0535] AACCCGAGGUCGCUGUGUUUGAUA[SEQ ID NO:193]

[0536] ACGCAACCACUUCCGCUGUCAUA [SEQ ID NO:194]

[0537] CGCAGAGAUCUCCCACACCCAUA [SEQ ID NO:195]

[0538] CCGCUGUGUUUGAGCCAUCAGAUA [SEQ ID NO:196]

[0539] UAGAACUGGACUUGACAGCGGAUG[SEQ ID NO:197]

[0540] UAUCUGGAGUCAUUGAGGGCGGUG[SEQ ID NO:198]

[0541] UCAAACACAGCGACCUCGGGUG[SEQ ID NO:199]

[0542] UUGACAGCGGAAGUGGUUGCGGUG[SEQ ID NO:200]

[0543] UUGGGUGUGGGGAGAUCUCUGCUUG[SEQ ID NO:201]

[0544] UCUGAUGGCUCAAACACAGCGAUG[SEQ ID NO:202]

[0545]

[0546]

[0547] The cells disclosed in this application can be isolated and activated using CD3 / CD28 antibodies before gene disruption occurs. In some embodiments, the cells containing the first antigen recognition receptor and the second antigen recognition receptor disclosed in this application further include gene disruption of the TRAC locus, TRBC locus, and / or CD70 locus. In some embodiments, the cells containing the first antigen recognition receptor and the second antigen recognition receptor disclosed in this application further include gene modification of the TRAC locus, TRBC locus, and / or CD70 locus.

[0548] In some embodiments, gene disruption at the TRAC locus, gene disruption at the TRBC locus, and / or gene disruption at the CD70 locus is generated after the isolation and activation of cells (e.g., T cells). In some embodiments, gene disruption at the TRAC locus, gene disruption at the TRBC locus, and / or gene disruption at the CD70 locus is generated before the isolation and activation of cells (e.g., T cells).

[0549] In some embodiments, gene disruption at the TRAC and / or TRBC loci is generated prior to cell (e.g., T cells) isolation and activation, and gene disruption at the CD70 locus is generated after cell (e.g., T cells) isolation and activation.

[0550] In some embodiments, gene modifications to the TRAC locus, the TRBC locus, and / or the CD70 locus are generated after the isolation and activation of cells (e.g., T cells). In some embodiments, gene modifications to the TRAC locus, the TRBC locus, and / or the CD70 locus are generated before the isolation and activation of cells (e.g., T cells).

[0551] In some embodiments, genetic modifications to the TRAC and / or TRBC loci are generated prior to the isolation and activation of cells (e.g., T cells), and genetic modifications to the CD70 locus are generated after the isolation and activation of cells (e.g., T cells).

[0552] 2.7. Exemplary Cell

[0553] In some embodiments, the cells disclosed in this application are T cells comprising: a) a chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain targeting CD312; and b) a TCR-like fusion protein (HIT) targeting CD70, the fusion protein comprising a first antigen-binding strand and a second antigen-binding strand. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V HIt contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO:73, CDR2 comprising an amino acid sequence shown in SEQ ID NO:74, and CDR3 comprising an amino acid sequence shown in SEQ ID NO:75; and V L The CAR contains CDR1, comprising the amino acid sequence shown in SEQ ID NO:76; CDR2, comprising the amino acid sequence shown in SEQ ID NO:77; and CDR3, comprising the amino acid sequence shown in SEQ ID NO:78. In some embodiments, the transmembrane domain of the CAR comprises a CD28 polypeptide, which comprises or consists of amino acids 153 to 179 of SEQ ID NO:7. In some embodiments, the intracellular domain of the CAR comprises the CD28 polypeptide and a modified CD3ζ polypeptide. In some embodiments, the CD28 polypeptide comprises amino acids 180 to 220 of SEQ ID NO:7, and the modified CD3ζ polypeptide comprises the amino acid sequence shown in SEQ ID NO:22. In some embodiments, the first antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a heavy chain variable region (VH) of an antibody comprising the amino acid sequence shown in SEQ ID NO:133, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:134, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:135, and b) a TRBC polypeptide. In some embodiments, the second antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a light chain variable region (VL) of an antibody comprising the amino acid sequence shown in SEQ ID NO:136, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:137, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:138, and b) a TRBC polypeptide. In some embodiments, CAR and HIT are encoded by exogenous nucleic acids integrated into the TRAC locus. In some embodiments, the T cells disclosed in this application include gene disruption of the CD70 locus.

[0554] In some embodiments, the cells disclosed in this application are T cells comprising: a) a chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain targeting CD312; and b) a TCR-like fusion protein (HIT) targeting CD70, the fusion protein comprising a first antigen-binding strand and a second antigen-binding strand. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V HIt contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO:73, CDR2 comprising an amino acid sequence shown in SEQ ID NO:74, and CDR3 comprising an amino acid sequence shown in SEQ ID NO:75; and V L The CAR contains CDR1, comprising the amino acid sequence shown in SEQ ID NO:76; CDR2, comprising the amino acid sequence shown in SEQ ID NO:77; and CDR3, comprising the amino acid sequence shown in SEQ ID NO:78. In some embodiments, the transmembrane domain of the CAR comprises a CD28 polypeptide, which comprises or consists of amino acids 153 to 179 of SEQ ID NO:7. In some embodiments, the intracellular domain of the CAR comprises the CD28 polypeptide and a modified CD3ζ polypeptide. In some embodiments, the CD28 polypeptide comprises amino acids 180 to 220 of SEQ ID NO:7, and the modified CD3ζ polypeptide comprises the amino acid sequence shown in SEQ ID NO:22. In some embodiments, the first antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a heavy chain variable region (VH) of an antibody comprising the amino acid sequence shown in SEQ ID NO:133, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:134, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:135, and b) a TRAC polypeptide. In some embodiments, the second antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a light chain variable region (VL) of an antibody comprising the amino acid sequence shown in SEQ ID NO:136, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:137, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:138, and b) a TRBC polypeptide. In some embodiments, CAR and HIT are encoded by exogenous nucleic acids integrated into the TRAC locus. In some embodiments, the T cells disclosed in this application comprise genetic modifications to the CD70 locus.

[0555] In some embodiments, the cells disclosed in this application are T cells comprising: a) a chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain targeting CD276; and b) a TCR-like fusion protein (HIT) targeting CD70, the fusion protein comprising a first antigen-binding strand and a second antigen-binding strand. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V HIt contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO:85, CDR2 comprising an amino acid sequence shown in SEQ ID NO:86, and CDR3 comprising an amino acid sequence shown in SEQ ID NO:87; and V L The CAR contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:88, CDR2 comprising the amino acid sequence shown in SEQ ID NO:89, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:90. In some embodiments, the transmembrane domain of the CAR comprises a CD28 polypeptide comprising or consisting of amino acids 153 to 179 of SEQ ID NO:7. In some embodiments, the intracellular domain of the CAR comprises the CD28 polypeptide and a modified CD3ζ polypeptide. In some embodiments, the CD28 polypeptide comprises amino acids 180 to 220 of SEQ ID NO:7, and the modified CD3ζ polypeptide comprises the amino acid sequence shown in SEQ ID NO:22. In some embodiments, the first antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a heavy chain variable region (VH) of an antibody comprising the amino acid sequence shown in SEQ ID NO:133, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:134, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:135, and b) a TRBC polypeptide. In some embodiments, the second antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a light chain variable region (VL) of an antibody comprising the amino acid sequence shown in SEQ ID NO:136, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:137, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:138, and b) a TRBC polypeptide. In some embodiments, CAR and HIT are encoded by exogenous nucleic acids integrated into the TRAC locus. In some embodiments, the T cells disclosed in this application include gene disruption of the CD70 locus.

[0556] In some embodiments, the cells disclosed in this application are T cells comprising: a) a chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain targeting CD276; and b) a TCR-like fusion protein (HIT) targeting CD70, the fusion protein comprising a first antigen-binding strand and a second antigen-binding strand. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V HIt contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO:85, CDR2 comprising an amino acid sequence shown in SEQ ID NO:86, and CDR3 comprising an amino acid sequence shown in SEQ ID NO:87; and V L The CAR contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:88, CDR2 comprising the amino acid sequence shown in SEQ ID NO:89, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:90. In some embodiments, the transmembrane domain of the CAR comprises a CD28 polypeptide comprising or consisting of amino acids 153 to 179 of SEQ ID NO:7. In some embodiments, the intracellular domain of the CAR comprises the CD28 polypeptide and a modified CD3ζ polypeptide. In some embodiments, the CD28 polypeptide comprises amino acids 180 to 220 of SEQ ID NO:7, and the modified CD3ζ polypeptide comprises the amino acid sequence shown in SEQ ID NO:22. In some embodiments, the first antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a heavy chain variable region (VH) of an antibody comprising the amino acid sequence shown in SEQ ID NO:133, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:134, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:135, and b) a TRAC polypeptide. In some embodiments, the second antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a light chain variable region (VL) of an antibody comprising the amino acid sequence shown in SEQ ID NO:136, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:137, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:138, and b) a TRBC polypeptide. In some embodiments, CAR and HIT are encoded by exogenous nucleic acids integrated into the TRAC locus. In some embodiments, the T cells disclosed in this application comprise genetic modifications to the CD70 locus.

[0557] In some embodiments, the cells disclosed in this application are T cells comprising: a) a chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain targeting CD22; and b) a TCR-like fusion protein (HIT) targeting CD19, the fusion protein comprising a first antigen-binding strand and a second antigen-binding strand. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V HIt contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO:97, CDR2 comprising an amino acid sequence shown in SEQ ID NO:98, and CDR3 comprising an amino acid sequence shown in SEQ ID NO:99; and V L The CAR contains CDR1, which contains the amino acid sequence shown in SEQ ID NO:100; CDR2, which contains the amino acid sequence shown in SEQ ID NO:101; and CDR3, which contains the amino acid sequence shown in SEQ ID NO:102. In some embodiments, the transmembrane domain of the CAR contains a CD28 polypeptide, which contains or consists of amino acids 153 to 179 of SEQ ID NO:7. In some embodiments, the intracellular domain of the CAR contains the CD28 polypeptide and a modified CD3ζ polypeptide. In some embodiments, the CD28 polypeptide contains amino acids 180 to 220 of SEQ ID NO:7, and the modified CD3ζ polypeptide contains the amino acid sequence shown in SEQ ID NO:22. In some embodiments, the first antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a heavy chain variable region (VH) of an antibody comprising the amino acid sequence shown in SEQ ID NO:143, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:144, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:145, and b) a TRAC polypeptide. In some embodiments, the second antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a light chain variable region (VL) of an antibody comprising the amino acid sequence shown in SEQ ID NO:146, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:147, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:148, and b) a TRBC polypeptide. In some embodiments, CAR and HIT are encoded by exogenous nucleic acids integrated into the TRAC locus.

[0558] In some embodiments, the cells disclosed in this application are T cells comprising: a) a chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain targeting CD22; and b) a TCR-like fusion protein (HIT) targeting CD19, the fusion protein comprising a first antigen-binding strand and a second antigen-binding strand. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V HIt contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO:97, CDR2 comprising an amino acid sequence shown in SEQ ID NO:98, and CDR3 comprising an amino acid sequence shown in SEQ ID NO:99; and V L The CAR contains CDR1, which contains the amino acid sequence shown in SEQ ID NO:100; CDR2, which contains the amino acid sequence shown in SEQ ID NO:101; and CDR3, which contains the amino acid sequence shown in SEQ ID NO:102. In some embodiments, the transmembrane domain of the CAR contains a CD28 polypeptide, which contains or consists of amino acids 153 to 179 of SEQ ID NO:7. In some embodiments, the intracellular domain of the CAR contains the CD28 polypeptide and a modified CD3ζ polypeptide. In some embodiments, the CD28 polypeptide contains amino acids 180 to 220 of SEQ ID NO:7, and the modified CD3ζ polypeptide contains the amino acid sequence shown in SEQ ID NO:22. In some embodiments, the first antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a heavy chain variable region (VH) of an antibody comprising the amino acid sequence shown in SEQ ID NO:143, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:144, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:145, and b) a TRAC polypeptide. In some embodiments, the second antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a light chain variable region (VL) of an antibody comprising the amino acid sequence shown in SEQ ID NO:146, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:147, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:148, and b) a TRBC polypeptide. In some embodiments, CAR and HIT are encoded by exogenous nucleic acids integrated into the TRAC locus.

[0559] In some embodiments, the cells disclosed in this application are T cells comprising: a) a chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain targeting CD22; and b) a TCR-like fusion protein (HIT) targeting CD19, the fusion protein comprising a first antigen-binding strand and a second antigen-binding strand. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V HIt contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO: 97, CDR2 comprising an amino acid sequence shown in SEQ ID NO: 153, and CDR3 comprising an amino acid sequence shown in SEQ ID NO: 99; and V L The CAR contains CDR1, which contains the amino acid sequence shown in SEQ ID NO:100; CDR2, which contains the amino acid sequence shown in SEQ ID NO:101; and CDR3, which contains the amino acid sequence shown in SEQ ID NO:102. In some embodiments, the transmembrane domain of the CAR contains a CD28 polypeptide, which contains or consists of amino acids 153 to 179 of SEQ ID NO:7. In some embodiments, the intracellular domain of the CAR contains the CD28 polypeptide and a modified CD3ζ polypeptide. In some embodiments, the CD28 polypeptide contains amino acids 180 to 220 of SEQ ID NO:7, and the modified CD3ζ polypeptide contains the amino acid sequence shown in SEQ ID NO:22. In some embodiments, the first antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a heavy chain variable region (VH) of an antibody comprising the amino acid sequence shown in SEQ ID NO:143, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:144, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:145, and b) a TRAC polypeptide. In some embodiments, the second antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a light chain variable region (VL) of an antibody comprising the amino acid sequence shown in SEQ ID NO:146, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:147, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:148, and b) a TRBC polypeptide. In some embodiments, CAR and HIT are encoded by exogenous nucleic acids integrated into the TRAC locus.

[0560] In some embodiments, the cells disclosed in this application are T cells comprising: a) a chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain targeting CD22; and b) a TCR-like fusion protein (HIT) targeting CD19, the fusion protein comprising a first antigen-binding strand and a second antigen-binding strand. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V HIt contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO: 119, CDR2 comprising an amino acid sequence shown in SEQ ID NO: 120, and CDR3 comprising an amino acid sequence shown in SEQ ID NO: 121; and V L The CAR contains CDR1 comprising the amino acid sequence shown in SEQ ID NO:122, CDR2 comprising the amino acid sequence shown in SEQ ID NO:123, and CDR3 comprising the amino acid sequence shown in SEQ ID NO:124. In some embodiments, the transmembrane domain of the CAR comprises a CD28 polypeptide comprising or consisting of amino acids 153 to 179 of SEQ ID NO:7. In some embodiments, the intracellular domain of the CAR comprises the CD28 polypeptide and a modified CD3ζ polypeptide. In some embodiments, the CD28 polypeptide comprises amino acids 180 to 220 of SEQ ID NO:7, and the modified CD3ζ polypeptide comprises the amino acid sequence shown in SEQ ID NO:22. In some embodiments, the first antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a heavy chain variable region (VH) of an antibody comprising the amino acid sequence shown in SEQ ID NO:143, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:144, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:145, and b) a TRAC polypeptide. In some embodiments, the second antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a light chain variable region (VL) of an antibody comprising the amino acid sequence shown in SEQ ID NO:146, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:147, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:148, and b) a TRBC polypeptide. In some embodiments, CAR and HIT are encoded by exogenous nucleic acids integrated into the TRAC locus.

[0561] In some embodiments, the cells disclosed in this application are T cells comprising: a) a chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain targeting CD22; and b) a TCR-like fusion protein (HIT) targeting CD19, the fusion protein comprising a first antigen-binding strand and a second antigen-binding strand. In some embodiments, the extracellular antigen-binding domain of the CAR comprises V HIt contains CDR1 comprising an amino acid having the sequence shown in SEQ ID NO: 97, CDR2 comprising an amino acid sequence shown in SEQ ID NO: 154, and CDR3 comprising an amino acid sequence shown in SEQ ID NO: 99; and V L The CAR contains CDR1, which contains the amino acid sequence shown in SEQ ID NO:100; CDR2, which contains the amino acid sequence shown in SEQ ID NO:101; and CDR3, which contains the amino acid sequence shown in SEQ ID NO:102. In some embodiments, the transmembrane domain of the CAR contains a CD28 polypeptide, which contains or consists of amino acids 153 to 179 of SEQ ID NO:7. In some embodiments, the intracellular domain of the CAR contains the CD28 polypeptide and a modified CD3ζ polypeptide. In some embodiments, the CD28 polypeptide contains amino acids 180 to 220 of SEQ ID NO:7, and the modified CD3ζ polypeptide contains the amino acid sequence shown in SEQ ID NO:22. In some embodiments, the first antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a heavy chain variable region (VH) of an antibody comprising the amino acid sequence shown in SEQ ID NO:143, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:144, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:145, and b) a TRAC polypeptide. In some embodiments, the second antigen-binding chain of HIT comprises: a) an antigen-binding fragment containing a light chain variable region (VL) of an antibody comprising the amino acid sequence shown in SEQ ID NO:146, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:147, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:148, and b) a TRBC polypeptide. In some embodiments, CAR and HIT are encoded by exogenous nucleic acids integrated into the TRAC locus.

[0562] 3. Nucleic acid compositions and vectors

[0563] The subject matter disclosed in this application provides nucleic acid compositions comprising a first polynucleotide encoding a first antigen recognition receptor disclosed herein (e.g., as disclosed in Section 2.1) and a second polynucleotide encoding a second antigen recognition receptor disclosed herein (e.g., as disclosed in Section 2.2). Cells comprising such nucleic acid compositions are also provided. In some embodiments, the nucleic acid composition further comprises a first promoter operatively linked to the first antigen recognition receptor. In some embodiments, the nucleic acid composition further comprises a second promoter operatively linked to the second antigen recognition receptor.

[0564] Additionally, the subject matter disclosed in this application provides nucleic acid compositions comprising a first polynucleotide encoding a first antigen recognition receptor disclosed herein (e.g., as disclosed in Section 2.1) and a second polynucleotide encoding a fusion polypeptide disclosed herein (e.g., as disclosed in Section 2.2). Cells comprising such nucleic acid compositions are also provided. In some embodiments, the nucleic acid composition further comprises a first promoter operatively linked to the fusion polypeptide. In some embodiments, the nucleic acid composition further comprises a second promoter operatively linked to the first antigen recognition receptor.

[0565] In some embodiments, one or both of the first promoter and the second promoter are endogenous or exogenous.

[0566] In some embodiments, the exogenous promoter is selected from the elongation factor (EF)-1 promoter, CMV promoter, SV40 promoter, PGK promoter, and metallothionein promoter. In some embodiments, one or both of the first and second promoters are inducible promoters. In some embodiments, the inducible promoter is selected from the NFAT transcriptional response element (TRE) promoter, CD69 promoter, CD25 promoter, and IL-2 promoter.

[0567] In some embodiments, the first antigen recognition receptor and / or the second antigen recognition receptor are integrated into a locus within the genome of the T cell (e.g., the TRAC locus, TRBC locus, TRDC locus, or TRGC locus). In some embodiments, the locus is the TRAC locus. In some embodiments, the expression of the first antigen recognition receptor and / or the second antigen recognition receptor is controlled by an endogenous promoter. Non-limiting examples of endogenous promoters include: endogenous TRAC promoters, endogenous TRBC promoters, endogenous TRDC promoters, and endogenous TRGC promoters. In some embodiments, the endogenous promoter is the endogenous TRAC promoter.

[0568] In some embodiments, the nucleic acid composition is a vector. In some embodiments, the vector is a retroviral vector (e.g., a gamma retroviral vector or a lentiviral vector). In some embodiments, the vector is a viral vector selected from the group consisting of: adenovirus vectors, adeno-associated virus vectors, vaccinia virus, bovine papillomavirus, and herpesviruses (e.g., such as Epstein-Barr virus).

[0569] Additionally, the nucleic acid composition can be administered to a subject and / or delivered to cells by methods known in the art or as described herein. Genetic modification of cells (e.g., T cells or NK cells) can be accomplished by transducing a substantially homogeneous cellular composition using a recombinant DNA construct. In some embodiments, a retroviral vector (gamma retrovirus or lentivirus) is employed to introduce the nucleic acid composition into cells. For example, a first and second polynucleotide can be cloned into a retroviral vector, and expression can be driven from its endogenous promoter, from a retroviral long terminal repeat sequence, or from a promoter specific to the target cell type of interest. Non-viral vectors can also be used.

[0570] The first and second polynucleotides can be constructed in a single polycistronic expression cassette, multiple expression cassettes within a single vector, or multiple vectors. Examples of elements that generate polycistronic expression cassettes include, but are not limited to, various viral and nonviral internal ribosome entry sites (IRES, e.g., FGF-1IRES, FGF-2IRES, VEGF IRES, IGF-II IRES, NF-κB IRES, RUNX1 IRES, p53 IRES, hepatitis A IRES, hepatitis C IRES, hepatitis virus IRES, oral thrush virus IRES, microRNA virus IRES, poliovirus IRES, and encephalomyelitis virus IRES) and cleavable linkers (e.g., 2A peptides, such as P2A peptide, T2A peptide, E2A peptide, and F2A peptide). Combinations of retroviral vectors and appropriate packaging lines are also suitable, wherein the capsid protein will have the function of infecting human cells. Various cell lines that produce facultative viruses are known, including but not limited to PA12 (Miller, et al. (1985) Mol. Cell. Biol. 5:431-437); PA317 (Miller, et al. (1986) Mol. Cell. Biol. 6:2895-2902); and CRIP (Danos, et al. (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464). Non-facultative particles are also suitable, for example, particles encapsulated with VSVG, RD114, or GALV pseudotypes, and any other known in the art.

[0571] Possible transduction methods also include direct co-culture of cells with producing cells, for example by Bregni et al. (1992) Blood 80:1418-1422, or culturing with a single viral supernatant or a concentrated carrier stock solution with or without appropriate growth factors and polycations, for example by Xu et al. (1994) Exp. Hemat. 22:223-230; and Hughes et al. (1992) J. Clin. Invest. 89:1817.

[0572] Other transducing viral vectors can be used to modify cells. In some embodiments, the selected vectors have exhibited high infection efficiency and stable integration and expression (see, for example, Cayouette et al., Human Gene Therapy 8:423-430, 1997; Kido et al., Current Eye Research 15:833-844, 1996; Bloomer et al., Journal of Virology 71:6641-6649, 1997; Naldini et al., Science 272:263-267, 1996; and Miyoshi et al., Proc. Natl. Acad. Sci. USA 94:10319, 1997). Other viral vectors that can be used include, for example, adenoviruses, lentiviruses and adeno-associated virus vectors, vaccinia virus, bovine papillomavirus or herpesviruses such as Epstein-Barr virus (see also, for example, Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244:1275-1281, 1989; Eglitis et al., BioTechniques 6:608-614, 1988; Tolstoshev et al., Current Opinion in Biotechnology 1:55-61, 1990; Sharp, The Lancet 337:1277-1278, 1991; Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311-322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells). 17:407-416, 1991; Miller et al., Biotechnology 7:980-990, 1989; LeGal La Salle et al., Science 259:988-990, 1993; and Johnson, Chest 107:77S-83S, 1995 (vectors). Retroviral vectors are particularly well-established and have been used in clinical settings (Rosenberg et al., N. Engl. J. Med 323:370, 1990; Anderson et al., U.S. Patent No. 5,399,346).

[0573] Non-viral methods can also be used for gene modification of cells. For example, nucleic acid molecules can be introduced into cells by applying nucleic acids in the presence of lipid transfection (Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413, 1987; Ono et al., Neuroscience Letters 17:259, 1990; Brigham et al., Am. J. Med. Sci. 298:278, 1989; Staubinger et al., Methods in Enzymology 101:512, 1983), by desialylated serum mucin-polylysine binding (Wu et al., Journal of Biological Chemistry 263:14621, 1988; Wu et al., Journal of Biological Chemistry 264:16985, 1989), or by microinjection under surgical conditions (Wolff et al., Science 247:1465, 1990). Other non-viral methods for gene transfer include in vitro transfection using calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes may also have potential benefits for delivering DNA into cells. Transplanting normal genes into the affected tissues of a subject can also be accomplished by transferring normal nucleic acids ex vivo into culturable cell types (e.g., autologous or allogeneic primary cells or their progeny), followed by injection of the cells (or their progeny) into the target tissue or systemic injection. Transient expression can be obtained via RNA electroporation.

[0574] The methods used to deliver genome editing agents / systems can vary as needed. In some embodiments, components of the selected genome editing method are delivered as DNA constructs in one or more plasmids. In some embodiments, these components are delivered via viral vectors. Common delivery methods include, but are not limited to, electroporation, microinjection, gene gun, puncture, hydrostatic pressure, continuous infusion, sonication, magnetic infection, adeno-associated virus, envelope protein pseudotypes of viral vectors, cis and trans-acting elements of replicating vectors, herpes simplex virus, and chemical agents (e.g., oligonucleotides, lipoplexes, polymeric vesicles, polymeric complexes, dendritic polymers, inorganic nanoparticles, and cell-penetrating peptides).

[0575] 3.1. Delivery Method

[0576] The methods used to deliver genome editing agents / systems can vary as needed. In some embodiments, components of the selected genome editing method are delivered as DNA constructs in one or more plasmids. In some embodiments, these components are delivered via viral vectors. Common delivery methods include, but are not limited to, electroporation, microinjection, gene gun, puncture, hydrostatic pressure, continuous infusion, sonication, magnetic infection, adeno-associated virus, envelope protein pseudotypes of viral vectors, cis and trans-acting elements of replicating vectors, herpes simplex virus, and chemical agents (e.g., oligonucleotides, lipoplexes, polymeric vesicles, polymeric complexes, dendritic polymers, inorganic nanoparticles, and cell-penetrating peptides).

[0577] In some embodiments, the delivery method includes the use of a colloid. As used herein, the term "colloid" refers to a system in which two or more phases are present, with one phase (e.g., a dispersed phase) distributed within another phase (e.g., a continuous phase). Furthermore, at least one of the phases has a small size (around 10 nm). -9 To about 10 -6 (within the range of m). Non-limiting examples of colloids covered by the currently disclosed subject matter include macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems (e.g., micelles, liposomes, and lipid nanoparticles).

[0578] In some embodiments, the delivery method includes the use of liposomes. As used herein, the term "liposome" refers to a monolayer or multilayer spherical lipid bilayer structure formed from lipids dissolved in an organic solvent and then dispersed in an aqueous medium. For experimental and therapeutic purposes of delivering active pharmaceutical ingredients (e.g., nucleic acid compositions disclosed herein) into cells, liposomes fuse with the cell membrane, thereby transferring their contents into the cytoplasm.

[0579] In some embodiments, the delivery method includes the use of lipid nanoparticles. As used herein, the term "lipid nanoparticle" refers to a particle having at least one nanometer-scale (e.g., about 1 nm to about 1,000 nm) size and comprising at least one lipid. In some embodiments, lipid nanoparticles may comprise an active pharmaceutical ingredient for delivery to cells (e.g., nucleic acid compositions disclosed herein). The morphology of lipid nanoparticles may differ from that of liposomes. While liposomes are characterized by a lipid bilayer surrounding a hydrophilic core, lipid nanoparticles have an electron-dense core in which cationic lipids and / or ionizable lipids are organized into reverse micelles surrounding an active pharmaceutical ingredient (e.g., nucleic acid compositions disclosed herein). Further information on the morphology and properties of lipid nanoparticles and liposomes can be found in Wilczewska et al., Pharmacological Reports 64, Vol. 5 (2012): 1020-1037; Eygeris et al., Accounts of Chemical Research 55, Vol. 1 (2021): 2-12; Zhang et al., Chemical Reviews 121, Vol. 20 (2021): 12181-12277; and Fan et al., Journal of Pharmaceutical and Biomedical Analysis 192 (2021): 113642.

[0580] In some embodiments, the average diameter of the lipid nanoparticles is about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 80 nm to about 100 nm, about 90 nm to about 100 nm, about 70 nm to about 90 nm, about 80 nm to about 90 nm, about 70 nm to about 80 nm, or about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm.

[0581] In some embodiments, lipid nanoparticles may comprise cationic lipids or ionizable lipids. The term "cationic lipid" refers to a lipid comprising a head group with a permanently positive charge. Non-limiting examples of cationic lipids covered by the currently disclosed subject matter include 1,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA), 1,2-dioleoyl-3-trimethylammonium propane (DOTAP), 2,3-dioleoyloxy-N-[2-(sperminecarbamoyl)ethyl]-N,N-dimethyl-1-propanetrifluoroacetate (DOSPA), and ethylphosphatidylcholine (ePC).

[0582] As used herein, the term "ionizable lipid" refers to lipids that are protonated at low pH and neutral at physiological pH. The pH sensitivity of ionizable lipids is particularly advantageous for in vivo delivery (e.g., delivery of the nucleic acid compositions disclosed herein) because neutral lipids interact less with the anion exchange membranes of blood cells, and thus improve the biocompatibility of lipid nanoparticles. Once trapped in the endosome, ionizable lipids are protonated and promote membrane instability, thereby allowing the nanoparticles to escape from the endosome. Non-limiting examples of ionizable lipids covered by the subject matter disclosed in this application include: 3,3',3”,3”'-(((methylazadiyl)bis(propane-3,1-diyl))bis(azatriyl))tetrapropionate tetra(8-methylnonyl) ester; (2-(dioctylammonium)ethyl) phosphate decyl ester; ((4-hydroxybutyl)azadiyl)bis(hexane-6,1-diyl)bis(2-hexyldecyl ester); 3,3'-((3-methyl-9- 1,1'-((2-(dodecyldithioyl)ethyl) ester of oxo-10-oxa-13,14-dithia-3,6-diazahexadecyl)azadiyl)dipropionate; 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azadiyl)bis(dodecane-2-ol); cKK-E12,3,6-bis(4-( bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione; (6Z,9Z,28Z,31Z)-heptadecanehexaenoic acid-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butyrate; hexa(octyl-3-yl)9,9',9”,9”',9””,9””-((((benzene-1,3,5-tricarbonyl)tri(azadiyl))tri(propane-3,1-diyl))tri(azatriyl))hexnonyl Esters; heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate; and (((3,6-dioxopiperazin-2,5-diyl)bis(butane-4,1-diyl))bis(azatriyl))tetra(ethane-2,1-diyl)(9Z,9'Z,9”Z,9”'Z,12Z,12'Z,12”Z,12”'Z)-tetra(octadec-9,12-dienoate).

[0583] Additionally, in some embodiments, the lipid nanoparticles may include other lipids. For example, but not limited to, the lipid nanoparticles of the presently disclosed subject matter may include phospholipids, cholesterol, and polyethylene glycol (PEG) functionalized lipids (PEG-lipids). These lipids can improve certain properties of the lipid nanoparticles (e.g., stability, biodistribution, etc.). For example, cholesterol enhances the stability of the lipid nanoparticles by regulating integrity and rigidity. Non-limiting examples of other lipids present in the lipid nanoparticles include cholesterol, DC-cholesterol, β-sitosterol, BHEM-cholesterol, ALC-0159, distearylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dioleoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoylphosphatidylcholine (POPC), and palmitoylphosphatidylethanolamine (POP). E) and dioleoyl-phosphatidylethanolamine 4-(N-maleimidemethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), distearate-phosphatidylethanolamine (DSPE), 16-O-monomethylPE, 16-O-dimethylPE, 18-1-transPE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE) and 1,2-ditransoleoyl-sn-glycerol-3-phosphoethanolamine (transDOPE).

[0584] In some embodiments, the lipid nanoparticles may include a targeting portion that binds to a ligand. The use of the targeting portion allows for the selective delivery of an active pharmaceutical ingredient (e.g., the nucleic acid compositions disclosed herein) to target cells expressing the ligand (e.g., T cells). In some embodiments, the targeting portion may be an antibody or an antigen-binding fragment thereof that binds to a cell surface receptor. For example, but not limited to, the targeting domain is an antibody or an antigen-binding fragment thereof that binds to receptors expressed on the surface of T cells (e.g., CD3, CD4, CD8, CD16, CD40L, CD95, FasL, CTLA-4, OX40, GITR, LAG3, ICOS, and PD-1).

[0585] In some embodiments, the delivery method is an in vivo delivery method. In some embodiments, the delivery method is an ex vivo delivery method.

[0586] 4. Preparation and application

[0587] The subject matter disclosed in this application provides compositions comprising cells disclosed herein (e.g., those disclosed in Section 2). In some embodiments, the compositions are pharmaceutical compositions further comprising pharmaceutically acceptable excipients.

[0588] Compositions containing the cells disclosed in this application can be readily provided in the form of sterile liquid formulations, such as isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which can be buffered to a selected pH. Liquid formulations are generally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, applying liquid compositions (especially by injection) is slightly more convenient. On the other hand, viscous compositions can be formulated within appropriate viscosity ranges to provide a longer contact time with a specific tissue. Liquid or viscous compositions may include a carrier, which may be a solvent or dispersion medium containing, for example, water, saline, phosphate-buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.) and suitable mixtures thereof.

[0589] Compositions containing the cells disclosed in this application may be administered systemically or directly to a subject for inducing and / or enhancing an immune response to an antigen and / or treating and / or preventing vegetations. In some embodiments, the cells disclosed in this application or compositions containing them are injected directly into the organ of interest (e.g., an organ affected by vegetations). Alternatively, the cells disclosed in this application or compositions containing them may be administered indirectly to the organ of interest, for example, by administration to the circulatory system (e.g., a tumor vascular system). Amplifying and differentiating agents may be provided before, during, or after administration of the cells or compositions to increase in vitro or in vivo cell production.

[0590] The number of cells to be administered can vary depending on the subject being treated. In some embodiments, approximately 10 4 One and about 10 10 Between 10 4 One and about 10 7 Between 10 5 One and about 10 7 Between 10 5 One and about 10 9 Between or about 10 6 One and about 10 8 The cells disclosed in this application are administered to a subject at a ratio of approximately 10. In some embodiments, approximately 10 5 One and about 10 7 The cells disclosed in this application are administered to the subject in quantities between 1 and 10. More effective ...

Claims

1. A cell comprising: a) a chimeric antigen receptor (CAR) targeting a first antigen; and b) TCR-like fusion molecules targeting a second antigen.

2. The cell of claim 1, wherein the CAR comprises an extracellular antigen binding domain that binds to the first antigen and an intracellular signaling domain capable of delivering an activation signal to the cell.

3. The cell of claim 2, wherein the intracellular signaling domain of the CAR comprises a CD3 zeta polypeptide.

4. The cell according to claim 3, wherein the CD3ζ polypeptide is a natural CD3ζ polypeptide or a modified CD3ζ polypeptide.

5. The cell of claim 4, wherein the modified CD3ζ polypeptide comprises native ITAM1, an ITAM2 variant consisting of two loss-of-function mutations, and an ITAM3 variant consisting of two loss-of-function mutations.

6. The cell of claim 4, wherein the modified CD3zeta polypeptide comprises the amino acid sequence shown in SEQ ID NO:

22.

7. The cell of claim 6, wherein the intracellular signaling domain of the CAR further comprises at least one co-stimulatory signaling region.

8. The cell of claim 7, wherein the at least one costimulatory signaling region comprises at least the intracellular domain of a costimulatory molecule or a portion thereof.

9. The cell of claim 8, wherein the co-stimulatory molecule is selected from the group consisting of CD28, 4-1BB, OX40, CD27, CD40, CD154, CD97, CD11a / CD18, ICOS, DAP-10, CD2, CD150, CD226, and NKG2D.

10. The cell of claim 9, wherein the costimulatory molecule comprises amino acids 180 to 220 of SEQ ID NO:

7.

11. The cell of claim 6, wherein the CAR comprises a transmembrane domain.

12. The cell of claim 6, wherein the TCR-like fusion molecule comprises: i) a first antigen-binding chain comprising an antigen-binding fragment of a heavy chain variable region (VH) of an antibody; and ii) a second antigen-binding chain comprising an antigen-binding fragment of a light chain variable region (VL) of the antibody; wherein the first antigen-binding chain and the second antigen-binding chain a) each comprise a TRAC polypeptide or a TRBC polypeptide, and b) bind to the second antigen, wherein the TCR-like fusion molecule binds to the second antigen in an HLA-independent manner.

13. The cell of claim 12, wherein at least one of the TRAC polypeptide and the TRBC polypeptide is endogenous.

14. The cell of claim 12, wherein the first antigen-binding chain and the second antigen-binding chain are at about 1×10 -8 The present invention binds to the second antigen with a dissociation constant (KD) of M or less.

15. The cell of claim 14, wherein the first antigen-binding chain and the second antigen-binding chain are at about 5×10 -9 The present invention binds to the second antigen with a dissociation constant (KD) of M or less.

16. The cell of claim 12, wherein the first antigen-binding chain comprises an antigen-binding fragment of VH of an antibody and a TRBC polypeptide, and the second antigen-binding chain comprises an antigen-binding fragment of VL of the antibody and a TRAC polypeptide.

17. The cell of claim 12, wherein the first antigen-binding chain comprises an antigen-binding fragment of VH of an antibody and a TRAC polypeptide, and the second antigen-binding chain comprises an antigen-binding fragment of VL of the antibody and a TRBC polypeptide.

18. The cell of claim 12, wherein the first antigen binding chain and the second antigen binding chain are capable of associating with a CD3zeta polypeptide.

19. The cell of claim 18, wherein the first antigen binding chain and the second antigen binding chain are capable of activating the CD3 zeta polypeptide when bound to the second antigen.

20. The cell of claim 19, wherein said activation of said CD3zeta polypeptide is capable of activating said cell.

21. The cell of claim 12, wherein the cell further comprises a gene disruption to the TRAC locus and / or the TRBC locus.

22. The cell of claim 12, wherein the cell further comprises a genetic disruption of the CD70 locus.

23. The cell of claim 12, wherein the cell further comprises a gene disruption to the TRAC locus, the TRBC locus, and / or the CD70 locus.

24. The cell of claim 12, wherein the cell further comprises a genetic modification of the TRAC gene and / or the TRBC gene.

25. The cell of claim 12, wherein the cell further comprises a genetic modification of the CD70 gene.

26. The cell of claim 12, wherein the cell further comprises genetic modification of the TRAC gene, the TRBC gene, and / or the CD70 gene.

27. The cell of claim 12, wherein the cell is a cell of the lymphoid lineage or a cell of the myeloid lineage.

28. The cell of claim 27, wherein the cells of the lymphoid lineage are selected from the group consisting of T cells, B cells, natural killer (NK) cells, and dendritic cells.

29. The cell of claim 28, wherein the cell is a T cell.

30. The cell of claim 29, wherein the T cell is derived from an induced pluripotent stem cell.

31. The cell of claim 29, wherein the T cell is a CD8 + T cells.

32. The cell according to claim 31, wherein the CD8 + T cells are CD4 independent.

33. The cell of claim 29, wherein the T cell is selected from the group consisting of: cytotoxic T lymphocytes (CTLs), γδ T cells, tumor infiltrating lymphocytes (TILs), regulatory T cells, and natural killer T (NKT) cells.

34. The cell of claim 29, wherein the T cell is CD62L + .

35. The cell of claim 29, wherein the T cell is CD45RA + .

36. The cell of claim 29, wherein the T cell is CD45RA + and CD62L + .

37. The cell of claim 12, wherein the CAR and / or the TCR-like fusion molecule is integrated at a locus within the genome of the T cell.

38. The cell of claim 37, wherein the locus is selected from the group consisting of a TRAC locus, a TRBC locus, a TRDC locus, and a TRGC locus.

39. The cell of claim 37, wherein the locus is the TRAC locus or the TRBC locus.

40. The cell of claim 39, wherein the locus is the TRAC locus.

41. The cell of claim 12, wherein the first antigen and / or the second antigen is a tumor antigen or a pathogen antigen.

42. The cell of claim 41, wherein the tumor antigen is selected from the group consisting of CD19, CD70, IL1RAP, ABCG2, AChR, ACKR6, ADAMTS13, ADGRE2, ADGRE2 (EMR2), ADORA3, ADRA1D, AGER, ALS2, an antigen of a cytomegalovirus (CMV) infected cell (e.g., a cell surface antigen), ANO9, AQP2, ASIC3, ASPRV1, ATP6V0A4, B3GNT4, B7-H3, BCMA, BEST4, C3orf35, CADM3, CAIX, CAPN3, CCDC155, CCR1, CD1 0. CD117, CD123, CD133, CD135(FLT3), CD138, CD20, CD22, CD244(2B4), CD25, CD26, CD30, CD300LF, CD312, CD32, CD321, CD33, CD34, CD36, CD38, CD41, CD44, CD44V6, CD47, CD49f, CD56, CD7, CD71, CD74, CD8, CD82, CD96, CD98, CD99, CDH13, CDHR1, CEA, CEACAM6, CHST3, CLEC12A, CLEC1A, CLL1, CNIH2, COL 15A1, COLEC12, CPM, CR1, CX3CR1, CXCR4, CYP4F11, DAGLB, DARC, DFNB31, DGKI, EGF1R, EGFR-VIII, EGP-2, EGP-40, ELOVL6, EMB, EMC10, EMR2, ENG, EpCAM, EphA2, EPHA4, ERBB, ERBB2, Erb-B3, Erb-B4, E-selectin, EXOC3L4, EXTL3, FAM186B, FBP, FCGR1A, FKBP1B, FLRT1, folate receptor-α, FOLR2, FRMD5, GABRB2, GAS2, GD2 , GD3, GDPD3, GNA14, GNAZ, GPR153, GPR56, GYPA, HEPHL1, HER-2, hERT, HILPDA, HLA-DR, HOOK1, hTERT, HTR2A, ICAM1, IGFBP3, IL10RB, IL20RB, IL23R, ILDR1, interleukin-13 receptor subunit alpha-2 (IL-13Rα2), ITFG3, ITGA4, ITGA5, ITGA8, ITGAX, ITGB5, ITGB8, JAM3, KCND1, KCNJ5, KCNK13, KCNN4, KCNV2, KDR, KIF19, KIF26B,κ-light chain, L1CAM, LAX1, LEPR, Lewis Y (CD174), Lewis Y (LeY), LILRA2, LILRA6, LILRB2, LILRB3, LILRB4, LOXL4, LPAR2, LRRC37A3, LRRC8E, LRRN2, LRRTM2, LTB4R, MAGE-A1, MAGEA3, MANSC1, MART1, GP100, MBOAT1, MBOAT7, melanoma antigen family A, mesothelin (MSLN), MFAP3L, MMP25, MRP1, MT-ND1, mucin 1 (MUC1), mucin 16 (MUC16), MYADM, MYADML2, NGFR, N KCS1, NKG2D ligand, NLGN3, NPAS2, NY-ESO-1, oncofetal antigen (h5T4), OTOA, P2RY13, p53, PDE3A, PEAR1, PIEZO1, PLXNA4, PLXNC1, PNPLA3, PPFIA4, PPP2R5B, PRAME, PRAME, prostate stem cell antigen (PSCA), prostate-specific membrane antigen (PSMA), proteinase 3 (PR1), PSD2, PTPRJ, RDH16, receptor tyrosine kinase Erb-B2, RHBDL3, RNF173, RNF183, ROR 1. RYR2, SCIN, SCN11A, SCN2A, SCNN1D, SEC31B, SEMA4A, SH3PXD2A, SIGLEC11, SIRPB1, SLC16A6, SLC19A1, SLC22A5, SLC25A36, SLC25A41, SLC30A1, SLC34A3, SLC43A3, SLC44A1, SLC44A3, SLC45A3, SLC6A16, SLC6A6, SLC8A3, SLC9A1, SLCO2B1, SPAG17, STC1, STON2, SUN3, survivin, S USD2, SYNC, TACSTD2, TAS1R3, TEX29, TFR2, TIM-3 (HAVCR2), TLR2, TMEFF2, TMEM145, TMEM27, TMEM40, TMEM59L, TMEM89, TMPRSS5, TNFRSF14, TNFRSF1B, TRIM55, TSPEAR, TTYH3, tumor-associated glycoprotein 72 (TAG-72), tyrosinase, vascular endothelial growth factor R2 (VEGF-R2), VLA-4, Wilms tumor protein (WT-1), WNT4, WT1, and ZDHHC11.

43. The cell of claim 41, wherein the first antigen is selected from the group consisting of: CD312, CD19, CD20, CD22, CD276, and CAIX.

44. The cell of claim 43, wherein the second antigen is selected from the group consisting of: CD70, CD19, CD20, and CD22.

45. The cell of claim 41, wherein the first antigen and the second antigen are CD312 and CD70.

46. The cell of claim 45, wherein the extracellular antigen binding domain of the CAR targeting CD312 comprises: V H , which contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 73, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 74, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO: 75; and V L , which contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO:76, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:77, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:

78.

47. The cell of claim 46, wherein the TCR-like fusion molecule targeting CD70 comprises: a first antigen-binding chain comprising a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 133, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 134, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO: 135; and a second antigen-binding chain comprising a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 136, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 137, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:

138.

48. The cell of claim 38, wherein the first antigen and the second antigen are CD276 and CD70.

49. The cell of claim 48, wherein the extracellular antigen binding domain of the CAR targeting CD276 comprises: V H , which contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 85, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 86, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO: 87; and V L , which contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO:88, a CDR2 comprising the amino acid sequence shown in SEQ ID NO:89, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:

90.

50. The cell of claim 49, wherein the TCR-like fusion molecule targeting CD70 comprises: a first antigen-binding chain comprising a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 133, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 134, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO: 135; and a second antigen-binding chain comprising a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 136, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 137, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:

138.

51. The cell of claim 41, wherein the first antigen and the second antigen are CAIX and CD70.

52. The cell of claim 41, wherein the first antigen and the second antigen are CD19 and CD22.

53. The cell of claim 41, wherein the first antigen and the second antigen are CD19 and CD20.

54. The cell of claim 41, wherein the first antigen and the second antigen are CD20 and CD22.

55. The cell of claim 41, wherein the first antigen and the second antigen are CD20 and CD19.

56. The cell of claim 41, wherein the first antigen and the second antigen are CD22 and CD20.

57. The cell of claim 41, wherein the first antigen and the second antigen are CD22 and CD19.

58. The cell of claim 57, wherein the extracellular antigen binding domain of the CAR that targets CD22 comprises: a)V H , which contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 97, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 98, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO: 99; and V L , which contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 100, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 101, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO: 102; b)V H , which contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 97, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 153, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO: 99; and V L , which contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 100, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 101, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO: 102; c)V H , which contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 119, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 120, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO: 121; and V L , which contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 122, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 123, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO: 124; or d)V H , which contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 97, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 154, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO: 99; and V L , which contains a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 100, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 101, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:

102.

59. The cell of claim 58, wherein the TCR-like fusion molecule targeting CD19 comprises: a first antigen-binding chain comprising a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 143, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 144, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO: 145; and a second antigen-binding chain comprising a CDR1 comprising the amino acid sequence shown in SEQ ID NO: 146, a CDR2 comprising the amino acid sequence shown in SEQ ID NO: 147, and a CDR3 comprising the amino acid sequence shown in SEQ ID NO:

148.

60. The cell of claim 41, wherein the first antigen and the second antigen are selected from Table 8.

61. The cell of claim 12, further comprising a chimeric costimulatory receptor (CCR).

62. The cell of claim 61, wherein the CCR comprises an extracellular antigen binding domain that binds to a third antigen, and an intracellular domain that is capable of delivering a co-stimulatory signal to the cell but not an activation signal alone.

63. The cell of claim 62, wherein the intracellular domain of the CCR comprises at least the intracellular domain of a costimulatory molecule or a portion thereof.

64. The cell of claim 63, wherein the costimulatory molecule is selected from the group consisting of CD28, 4-1BB, OX40, CD27, CD40, CD154, CD97, CD11a / CD18, ICOS, DAP-10, CD2, CD150, CD226, and NKG2D.

65. The cell of claim 12, wherein the cell further comprises at least one exogenous co-stimulatory ligand.

66. The cell of claim 65, wherein the at least one exogenous co-stimulatory ligand is selected from the group consisting of a tumor necrosis factor (TNF) family member, an immunoglobulin (Ig) superfamily member, and combinations thereof.

67. The cell of claim 66, wherein the TNF family member is selected from the group consisting of 4-1BBL, OX40L, CD70, FasL, GITRL, TNF-related apoptosis-inducing ligand (TRAIL), CD30L, LIGHT (TNFSF14), CD40L.

68. The cell of claim 66, wherein the Ig superfamily member is selected from the group consisting of CD80, CD86, ICOSLG, and combinations thereof.

69. The cell of claim 65, wherein the at least one exogenous co-stimulatory ligand comprises CD80.

70. The cell of claim 65, wherein the at least one exogenous co-stimulatory ligand comprises 4-1BBL.

71. The cell of claim 65, wherein the cell comprises two exogenous co-stimulatory ligands.

72. The cell of claim 71, wherein the at least two exogenous co-stimulatory ligands comprise CD80 and 4-1BBL.

73. The cell of claim 72, wherein the at least two exogenous co-stimulatory ligands comprise the amino acid sequence shown in SEQ ID NO: 67 and / or the amino acid sequence shown in SEQ ID NO:

69.

74. The cell of claim 12, wherein the cell further comprises a fusion polypeptide comprising: a) the extracellular domain and the transmembrane domain of a costimulatory ligand, and b) the intracellular domain of a first costimulatory molecule.

75. The cell of claim 74, wherein the co-stimulatory ligand is selected from the group consisting of a tumor necrosis factor (TNF) family member, an immunoglobulin (Ig) superfamily member, and combinations thereof.

76. The cell of claim 75, wherein the TNF family member is selected from the group consisting of 4-1BBL, OX40L, CD70, GITRL, CD40L, and combinations thereof.

77. The cell of claim 75, wherein the Ig superfamily member is selected from the group consisting of CD80, CD86, ICOSLG, and combinations thereof.

78. The cell of claim 74, wherein the co-stimulatory ligand is CD80.

79. The cell of claim 74, wherein the first co-stimulatory molecule is selected from the group consisting of CD28, 4-1BB, OX40, ICOS, DAP-10, CD27, CD40, NKG2D, CD2, and combinations thereof.

80. The cell of claim 79, wherein the first co-stimulatory molecule is 4-1BB.

81. The cell of claim 74, wherein the co-stimulatory ligand is CD80 and the first co-stimulatory molecule is 4-1BB.

82. The cell of claim 81, wherein the fusion polypeptide comprises the amino acid sequence shown in SEQ ID NO:

71.

83. The cell of claim 74, wherein the fusion polypeptide further comprises the intracellular domain of a second costimulatory molecule.

84. The cell of claim 83, wherein the second co-stimulatory molecule is selected from the group consisting of CD28, 4-1BB, OX40, ICOS, DAP-10, CD27, CD40, NKG2D, CD2, and combinations thereof.

85. The cell of claim 83, wherein the second co-stimulatory molecule is CD28.

86. The cell of claim 74, wherein the co-stimulatory ligand is CD80, the first co-stimulatory molecule is 4-1BB, and the second co-stimulatory molecule is CD28.

87. The cell of claim 86, wherein the fusion polypeptide comprises the amino acid sequence shown in SEQ ID NO:

72.

88. The cell of any one of claims 1 to 87, wherein the cell is autologous.

89. The cell of any one of claims 1 to 87, wherein the cell is allogeneic.

90. A composition comprising the cells of any one of claims 1 to 89.

91. The composition of claim 90, which is a pharmaceutical composition further comprising a pharmaceutically acceptable excipient.

92. A nucleic acid composition comprising: a first polynucleotide encoding a chimeric antigen receptor (CAR) targeting a first antigen; and a second polynucleotide encoding a TCR-like fusion molecule targeting a second antigen.

93. A vector comprising: a first polynucleotide encoding a chimeric antigen receptor (CAR) targeting a first antigen; and a second polynucleotide encoding a TCR-like fusion molecule targeting a second antigen.

94. The vector of claim 93, wherein the vector is a lentiviral vector.

95. The vector of claim 93 or 94, wherein the vector is a gamma-retroviral vector.

96. A lipid nanoparticle comprising: a first polynucleotide encoding a chimeric antigen receptor (CAR) targeting a first antigen; and a second polynucleotide encoding a TCR-like fusion molecule targeting a second antigen.

97. A polynucleotide encoding a chimeric antigen receptor (CAR) targeting a first antigen and a TCR-like fusion molecule targeting a second antigen.

98. A vector comprising the polynucleotide according to claim 97.

99. The vector of claim 98, wherein the vector is a lentiviral vector.

100. The vector of claim 98 or 99, wherein the vector is a gamma-retroviral vector.

101. A lipid nanoparticle comprising the polynucleotide of claim 97.

102. A composition comprising the polynucleotide of claim 97, the vector of any one of claims 93 to 95 or 98 to 100, or the lipid nanoparticle of claim 96 or 101.

103. The composition of claim 102, which is a pharmaceutical composition further comprising a pharmaceutically acceptable excipient.

104. A method for producing a cell according to any one of claims 1 to 89, the method comprising: The nucleic acid composition of claim 92, the vector of any one of claims 93 to 95 or 98 to 100, the polynucleotide of claim 97, the lipid nanoparticle of claim 96 or 101, or the composition of claim 102 or 103 is introduced into the cell.

105. The method of claim 104, further comprising: Gene disruption of the CD70 locus was generated.

106. The method of claim 104 or 105, further comprising: Gene disruption of the TRAC locus was generated.

107. The method of claim 105 or 106, wherein the gene disruption comprises a substitution, deletion, insertion, mutation, or a combination thereof.

108. The method of claim 107, wherein the mutation comprises a missense mutation, a nonsense mutation, or a combination thereof.

109. The method of claim 107, wherein the deletion comprises a non-frameshift deletion, a frameshift deletion, or a combination thereof.

110. The method of claim 107, wherein the insertion comprises a non-frameshift insertion, a frameshift insertion, or a combination thereof.

111. The method of any one of claims 104 to 110, wherein genetic disruption of the CD70 locus results in a non-functional CD70 protein or results in knockout of CD70 gene expression.

112. The method of any one of claims 104 to 111, wherein genetic disruption of the TRAC locus results in a non-functional TRAC protein or results in knockout of TRAC gene expression.

113. The method of any one of claims 104 to 112, wherein generating the gene disruption comprises a gene editing method comprising homologous recombination, zinc finger nucleases, meganucleases, transcription activator-like effector nucleases (TALENs), clustered regularly interspaced short palindromic repeats (CRISPR) systems, or a combination thereof.

114. The method of any one of claims 104 to 113, wherein the genetic disruption to the CD70 locus or the TRAC locus is generated prior to activation of the cells.

115. The method of any one of claims 104 to 114, wherein the gene disruption to the CD70 locus or the TRAC locus is generated following activation of the cells.

116. The method of any one of claims 104 to 114, wherein a) the gene disruption to the CD70 locus is generated prior to activation of the cell, and b) the gene disruption to the TRAC locus is generated after activation of the cell.

117. The method of any one of claims 104 to 114, wherein a) the genetic disruption of the TRAC locus is generated prior to activation of the cell, and b) the genetic disruption of the CD70 locus is generated after activation of the cell.

118. The method of claim 104, further comprising: Genetic modifications to the CD70 gene were generated.

119. The method of claim 104 or 118, further comprising: Genetic modifications to the TRAC gene and / or the TRBC gene are generated.

120. The method of claim 118 or 119, wherein genetic modification of the CD70 gene results in a non-functional CD70 protein or results in knockdown of CD70 gene expression.

121. The method of any one of claims 118 to 120, wherein genetic modification of the TRAC locus results in a non-functional TRAC protein or results in knockdown of TRAC gene expression.

122. The method of any one of claims 118 to 121, wherein genetic modification of the TRBC locus results in a non-functional TRBC protein or results in knockdown of TRBC gene expression.

123. The method of any one of claims 104 to 122, further comprising: Introduction of chimeric coreminimetic receptors (CCRs).

124. The method of any one of claims 104 to 123, further comprising: At least one exogenous co-stimulatory ligand is introduced.

125. The method of any one of claims 104 to 124, further comprising: A fusion polypeptide is introduced comprising: a) the extracellular domain and the transmembrane domain of a costimulatory ligand, and b) the intracellular domain of a first costimulatory molecule.

126. A cell produced by the method of any one of claims 104 to 125.

127. A method of reducing tumor burden in a subject, the method comprising: An effective amount of the cell of any one of claims 1 to 89 or 126 or the composition of claim 90 or 91 is administered to the subject.

128. The method of claim 127, wherein the method reduces the number of tumor cells, reduces the size of a tumor, and / or eradicates a tumor in the subject.

129. A method of preventing and / or treating a neoplasm or tumor in a subject, said method comprising administering to said subject an effective amount of a cell according to any one of claims 1 to 89 or 126 or a composition according to claim 90 or 91.

130. The method of any one of claims 127 to 129, wherein the neoplasm or tumor is cancer.

131. The method of any one of claims 127 to 130, wherein the neoplasm or tumor comprises antigenic heterogeneity of the first antigen and the second antigen.

132. The method of claim 131, wherein the second antigen has a low antigen density.

133. The method of claim 131 or 132, wherein the second antigen is expressed on tumor cells having a low tumor cell frequency.

134. The method of any one of claims 131 to 133, wherein the first antigen and the second antigen are independently selected from the group consisting of: CD19, CD70, IL1RAP, ABCG2, AChR, ACKR6, ADAMTS13, ADGRE2, ADGRE2 (EMR2), ADORA3, ADRA1D, AGER, ALS2, an antigen of cytomegalovirus (CMV)-infected cells, ANO9, AQP2, ASIC3, ASPRV1, ATP6V0A4, B3GNT4, B7-H3, BCMA, BEST4, C3orf35, CADM3, CAIX, CAPN3, CCDC155 , CCR1, CD10, CD117, CD123, CD133, CD135(FLT3), CD138, CD20, CD22, CD244(2B4), CD25, CD26, CD30, CD300LF, CD312, CD32, CD321, CD33, CD34, CD36, CD 38. CD41, CD44, CD44V6, CD47, CD49f, CD56, CD7, CD71, CD74, CD8, CD82, CD96, CD98, CD99, CDH13, CDHR1, CEA, CEACAM6, CHST3, CLEC12A, CLEC1A, CLL1, C NIH2, COL15A1, COLEC12, CPM, CR1, CX3CR1, CXCR4, CYP4F11, DAGLB, DARC, DFNB31, DGKI, EGF1R, EGFR-VIII, EGP-2, EGP-40, ELOVL6, EMB, EMC10, EMR2, ENG, EpCAM, EphA2, EPHA4, ERBB, ERBB2, Erb-B3, Erb-B4, E-selectin, EXOC3L4, EXTL3, FAM186B, FBP, FCGR1A, FKBP1B, FLRT1, folate receptor-α, FOLR2, FRMD5, GABRB2, G AS2, GD2, GD3, GDPD3, GNA14, GNAZ, GPR153, GPR56, GYPA, HEPHL1, HER-2, hERT, HILPDA, HLA-DR, HOOK1, hTERT, HTR2A, ICAM1, IGFBP3, IL10RB, IL20RB, IL23R, ILDR1, interleukin-13 receptor subunit alpha-2 (IL-13Rα2), ITFG3, ITGA4, ITGA5, ITGA8, ITGAX, ITGB5, ITGB8, JAM3, KCND1, KCNJ5, KCNK13, KCNN4, KCNV2, KDR, KIF19,KIF26B, kappa-light chain, L1CAM, LAX1, LEPR, Lewis Y (CD174), Lewis Y (LeY), LILRA2, LILRA6, LILRB2, LILRB3, LILRB4, LOXL4, LPAR2, LRRC37A3, LRRC8E, LRRN2, LRRTM2, LTB4R, MAGE-A1, MAGEA3, MANSC1, MART1, GP100, MBOAT1, MBOAT7, melanoma antigen family A, mesothelin (MSLN), MFAP3L, MMP25, MRP1, MT-ND1, mucin 1 (MUC1), mucin 16 (MUC16), MYADM, MYADML2, NGFR, N KCS1, NKG2D ligand, NLGN3, NPAS2, NY-ESO-1, oncofetal antigen (h5T4), OTOA, P2RY13, p53, PDE3A, PEAR1, PIEZO1, PLXNA4, PLXNC1, PNPLA3, PPFIA4, PPP2R5B, PRAME, PRAME, prostate stem cell antigen (PSCA), prostate-specific membrane antigen (PSMA), proteinase 3 (PR1), PSD2, PTPRJ, RDH16, receptor tyrosine kinase Erb-B2, RHBDL3, RNF173, RNF183, ROR 1. RYR2, SCIN, SCN11A, SCN2A, SCNN1D, SEC31B, SEMA4A, SH3PXD2A, SIGLEC11, SIRPB1, SLC16A6, SLC19A1, SLC22A5, SLC25A36, SLC25A41, SLC30A1, SLC34A3, SLC43A3, SLC44A1, SLC44A3, SLC45A3, SLC6A16, SLC6A6, SLC8A3, SLC9A1, SLCO2B1, SPAG17, STC1, STON2, SUN3, survivin, S USD2, SYNC, TACSTD2, TAS1R3, TEX29, TFR2, TIM-3 (HAVCR2), TLR2, TMEFF2, TMEM145, TMEM27, TMEM40, TMEM59L, TMEM89, TMPRSS5, TNFRSF14, TNFRSF1B, TRIM55, TSPEAR, TTYH3, tumor-associated glycoprotein 72 (TAG-72), tyrosinase, vascular endothelial growth factor R2 (VEGF-R2), VLA-4, Wilms tumor protein (WT-1), WNT4, WT1, and ZDHHC11.

135. The method of any one of claims 131 to 134, wherein the first antigen is selected from the group consisting of: CD312, CD19, CD20, CD22, CD276, and CAIX.

136. The method of any one of claims 131 to 134, wherein the second antigen is selected from the group consisting of: CD70, CD19, CD20, and CD22.

137. A method according to any one of claims 131 to 134, wherein the first antigen and the second antigen are selected from: a) CD312 and CD70; b) CD276 and CD70; c) CAIX and CD70; d) CD19 and CD22; e) CD19 and CD20; f) CD20 and CD22; g) CD20 and CD19; h) CD22 and CD20; or i) CD22 and CD19.

138. The method of any one of claims 131 to 134, wherein the first antigen and the second antigen are selected from Table 8.

139. The method of any one of claims 127 to 138, wherein the neoplasm or tumor is a solid tumor.

140. The method of claim 139, wherein the solid tumor is selected from the group consisting of melanoma, renal cell carcinoma, non-small cell lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, lung neuroendocrine carcinoma, small cell lung cancer, pancreatic cancer, breast cancer, astrocytoma, glioblastoma, laryngeal / pharyngeal cancer, EBV-associated nasopharyngeal carcinoma, and ovarian cancer.

141. The method of claim 140, wherein the solid tumor is melanoma.

142. The method of any one of claims 127 to 138, wherein the neoplasm or tumor is a blood cancer.

143. The method of any one of claims 127 to 138 or 142, wherein the neoplasm or tumor is a bone marrow disorder.

144. The method of claim 143, wherein the bone marrow disorder is selected from the group consisting of myelodysplastic syndrome, myeloproliferative neoplasms, chronic myelomonocytic leukemia or acute myeloid leukemia (AML), blastic plasmacytoid dendritic cell neoplasms, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, chronic myeloid leukemia, and polycythemia vera.

145. The method of claim 144, wherein the bone marrow disorder is acute myeloid leukemia (AML).

146. The method of any one of claims 127 to 138 or 142, wherein the neoplasm or tumor is a B cell malignancy.

147. The method of claim 146, wherein the B cell malignancy is selected from the group consisting of: B cell non-Hodgkin lymphoma (NHL), B cell Hodgkin lymphoma, B cell acute lymphoblastic leukemia (ALL), B cell chronic lymphocytic leukemia (CLL), multiple myeloma (MM), CLL with Richter's transformation, and CNS lymphoma.

148. The method of claim 147, wherein the B cell malignancy is B cell acute lymphoblastic leukemia.

149. The method of any one of claims 127 to 138 or 142, wherein the neoplasm or tumor is a leukemia.

150. The method of claim 149, wherein the leukemia is selected from the group consisting of acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute promyelocytic leukemia (APL), mixed phenotype acute leukemia (MLL), hairy cell leukemia, B-cell prolymphocytic leukemia, B-cell precursor acute lymphoblastic leukemia, and T-cell precursor acute lymphoblastic leukemia.

151. The method of any one of claims 127 to 138 or 142, wherein the neoplasm or tumor is a lymphoma.

152. The method of claim 151, wherein the lymphoma is selected from the group consisting of Hodgkin lymphoma, non-Hodgkin lymphoma, B-cell non-Hodgkin lymphoma, T-cell non-Hodgkin lymphoma, and T-cell precursor acute lymphoblastic lymphoma.

153. The method of any one of claims 127 to 152, wherein the subject suffers from a recurrence of a neoplasm or tumor.

154. The method of any one of claims 127 to 153, wherein the subject has received a treatment that resulted in residual tumor cells.

155. A method of preventing and / or treating a pathogen infection in a subject, the method comprising: An effective amount of the cell of any one of claims 1 to 89 or 126 or the composition of claim 90 or 91 is administered to the subject.

156. A method for preventing and / or treating an autoimmune disease in a subject, the method comprising: An effective amount of the cell of any one of claims 1 to 89 or 126 or the composition of claim 90 or 91 is administered to the subject.

157. A method for preventing and / or treating an infectious disease in a subject, the method comprising: An effective amount of the cell of any one of claims 1 to 89 or 126 or the composition of claim 90 or 91 is administered to the subject.

158. A cell according to any one of claims 1 to 89 or 126 or a composition according to claim 90 or 91 for use in reducing tumor burden, treating and / or preventing a neoplasm or tumor, preventing and / or treating a pathogen infection, preventing and / or treating an autoimmune disease, and / or preventing and / or treating an infectious disease in a subject.

159. A kit comprising the cell of any one of claims 1 to 89 or 126 or the composition of claim 90 or 91.

160. The kit of claim 159, wherein the kit further comprises written instructions for reducing tumor burden, treating and / or preventing neoplasms or tumors, preventing and / or treating infection with a pathogen, preventing and / or treating an autoimmune disease, and / or preventing and / or treating an infectious disease.

Images