OMNI-335 CRISPR nuclease

Abstract

The present invention provides a non-naturally occurring composition comprising: a CRISPR nuclease comprising a sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 1; or a nucleic acid molecule containing a sequence encoding a CRISPR nuclease.

Description

[0001] This application claims the benefit of U.S. Provisional Application No. 284,858, filed on December 28, 2022, the contents of which are incorporated herein by reference.

[0002] Throughout this application, various publications are cited, including references in parentheses. The disclosures of all publications mentioned in this application are incorporated herein by reference in their entirety to provide additional information on the field to which the invention pertains and the features of the art to which the invention may be applied.

[0003] References to sequence listings

[0004] This application incorporates by reference the nucleotide sequence in the file named "221228_102322-040365_Sequence_Listing_AWG.xml", which is 34 kilobytes in size and was created on December 22, 2022 in IBM-PC machine format, compatible with MS-Windows operating system, and is included as part of this application in the XML file filed on December 28, 2023. Field of the Invention

[0005] In particular, the present invention relates to compositions and methods for genome editing. Background Art

[0006] Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) systems of bacterial and archaeal adaptive immunity display extreme diversity in protein composition and genomic loci architecture. CRISPR systems have become important tools for research and genome engineering. However, many details of CRISPR systems remain undetermined, and the applicability of CRISPR nucleases may be limited by sequence-specific requirements, expression, or delivery challenges. Different CRISPR nucleases have different characteristics, such as size, PAM sites, on-target activity, specificity, cleavage patterns (e.g., blunt ends, staggered ends), and prominent indel (insertion-deletion) patterns formed after cleavage. Different sets of characteristics can be used for different applications. For example, some CRISPR nucleases may be able to target specific genomic loci that other CRISPR nucleases cannot target due to PAM site restrictions. In addition, some currently used CRISPR nucleases exhibit pre-existing immunity, which may limit in vivo applicability. See Charlesworth et al., Nature Medicine (2019) and Wagner et al., Nature Medicine (2019). Therefore, the discovery, engineering, and improvement of novel CRISPR nucleases are important. Summary of the Invention

[0007] Disclosed herein are compositions and methods useful for genome engineering, epigenome engineering, genome targeting, genome editing of cells, and / or in vitro diagnostics.

[0008] The disclosed compositions can be used to modify genomic DNA sequences. As used herein, genomic DNA refers to linear and / or chromosomal DNA and / or plasmid or other extrachromosomal DNA sequences present in one or more target cells. In some embodiments, the target cell is a eukaryotic cell. In some embodiments, the target cell is a prokaryotic cell. In some embodiments, the method produces double-strand breaks (DSBs) at predetermined target sites in the genomic DNA sequence, resulting in mutations, insertions and / or deletions of the DNA sequence at the target site in the genome.

[0009] Thus, in some embodiments, the composition comprises a clustered regularly interspaced short palindromic repeats (CRISPR) nuclease. In some embodiments, the CRISPR nuclease is a CRISPR-associated protein.

[0010] OMNI-335 CRISPR nuclease

[0011] Embodiments of the present invention provide CRISPR nucleases referred to as "OMNI-335" nucleases as provided in Table 1.

[0012] The present invention provides a method for modifying a nucleotide sequence at a target site in the genome of a mammalian cell, the method comprising introducing into the cell: (i) a composition comprising: a CRISPR nuclease having at least 95% identity to the amino acid sequence of SEQ ID NO: 1; or a nucleic acid molecule comprising a sequence encoding a CRISPR nuclease having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 2-3, and (ii) a DNA-targeting RNA molecule or a DNA polynucleotide encoding the DNA-targeting RNA molecule comprising a nucleotide sequence complementary to a sequence in the target DNA.

[0013] The present invention also provides a non-naturally occurring composition comprising a CRISPR-associated system, the CRISPR-associated system comprising:

[0014] a) one or more RNA molecules comprising a guide sequence portion linked to a direct repeat sequence, wherein the guide sequence is capable of hybridizing to a target sequence or one or more nucleotide sequences encoding the one or more RNA molecules; and

[0015] b) a CRISPR nuclease comprising an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1, or a nucleic acid molecule comprising a sequence encoding said CRISPR nuclease; and

[0016] The one or more RNA molecules hybridize to the target sequence, wherein the target sequence is adjacent to a complementary sequence of a Protospacer Adjacent Motif (PAM), and the one or more RNA molecules form a complex with the RNA-guided nuclease.

[0017] The present invention also provides a non-naturally occurring composition comprising:

[0018] a) a CRISPR nuclease comprising a sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1, or a nucleic acid molecule comprising a sequence encoding said CRISPR nuclease; and

[0019] b) one or more RNA molecules, or one or more DNA polynucleotides encoding said one or more RNA molecules, comprising at least one of:

[0020] i) a nuclease-binding RNA nucleotide sequence capable of interacting / binding to said CRISPR nuclease; and

[0021] ii) a DNA-targeting RNA nucleotide sequence comprising a sequence complementary to a sequence in the target DNA sequence,

[0022] wherein the CRISPR nuclease is capable of complexing with the one or more RNA molecules to form a complex capable of hybridizing to the target DNA sequence.

[0023] Disclosed herein are compositions and methods that can be used for genome engineering, epigenome engineering, genome targeting, genome editing of cells, and / or in vitro diagnostics using the OMNI-335 CRISPR nuclease and non-naturally occurring RNA molecules comprising a scaffold portion that is capable of specifically binding to and activating the OMNI-335 CRISPR nuclease to target a DNA target site based on a guide sequence portion (also referred to as an RNA spacer portion) of the RNA molecule.

[0024] The disclosed compositions can be used to modify genomic DNA sequences. As used herein, genomic DNA refers to linear and / or chromosomal DNA and / or plasmid or other extrachromosomal DNA sequences present in one or more target cells. In some embodiments, the target cell is a eukaryotic cell. In some embodiments, the target cell is a prokaryotic cell. In some embodiments, the method produces double-strand breaks (DSBs) at predetermined target sites in the genomic DNA sequence, resulting in mutations, insertions and / or deletions of the DNA sequence at the target site in the genome. DETAILED DESCRIPTION

[0025] According to some aspects of the invention, disclosed compositions comprise a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) nuclease and / or a nucleic acid molecule comprising a sequence encoding the enzyme.

[0026] Table 1 lists novel CRISPR nucleases, along with substitutions at one or more positions within each nuclease that convert the nuclease into a nickase or a catalytically inactive nuclease.

[0027] Table 2 provides crRNA, tracrRNA, and single-stranded guide RNA (sgRNA) sequences, as well as portions of crRNA, tracrRNA, and sgRNA sequences, that are compatible with each of the listed CRISPR nucleases. Thus, a crRNA molecule capable of binding to and targeting the OMNI-335 nuclease as part of a crRNA:tracrRNA complex can comprise any of the crRNA sequences listed in Table 2. The crRNA molecule can also comprise a guide sequence portion or a spacer sequence. Similarly, a tracrRNA molecule capable of binding to and targeting the OMNI-335 nuclease as part of a crRNA:tracrRNA complex can comprise any of the tracrRNA sequences listed in Table 2. Furthermore, a single-stranded guide RNA molecule capable of binding to and targeting the OMNI-335 nuclease can comprise any of the sequences listed in Table 2. The sgRNA molecule can also comprise a guide sequence portion or a spacer sequence.

[0028] For example, the crRNA molecule of the OMNI-335 nuclease (SEQ ID NO: 1) can comprise any one of SEQ ID NOs: 5-8; the tracrRNA molecule of the OMNI-335 nuclease can comprise any one of SEQ ID NOs: 9-19, 21, and 22; and the sgRNA molecule of the OMNI-335 nuclease can comprise any one of SEQ ID NOs: 4-22. Other crRNA molecules, tracrRNA molecules, or sgRNA molecules of the OMNI-335 nuclease can be derived from the sequences listed in Table 2 in the same manner.

[0029] The present invention provides a non-naturally occurring composition comprising: a CRISPR nuclease comprising a sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 1; or a nucleic acid molecule comprising a sequence encoding the CRISPR nuclease. The nucleic acid molecule can be, for example, a DNA molecule or an RNA molecule.

[0030] In some embodiments, the CRISPR nuclease is fully catalytically active, is a nicking enzyme, or is catalytically inactive and is fused to a DNA interacting or modifying protein. For example, a CRISPR nuclease can be fused to a deaminase protein for base editing methods. In another example, a CRISPR nuclease can be fused to a reverse transcriptase for primer editing methods.

[0031] In some embodiments, the composition further comprises one or more RNA molecules, or a DNA polynucleotide encoding any of the one or more RNA molecules, wherein the one or more RNA molecules and the CRISPR nuclease are not found together in nature, and the one or more RNA molecules are configured to form a complex with the CRISPR nuclease and / or target the complex to a target site.

[0032] In some embodiments, the CRISPR nuclease comprises a sequence at least 90% identical to the amino acid sequence shown in SEQ ID NO: 1, and at least one RNA molecule comprises a sequence selected from SEQ ID NOs: 4-22.

[0033] In some embodiments, the CRISPR nuclease comprises a sequence at least 90% identical to the amino acid sequence shown in SEQ ID NO: 1, and at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from SEQ ID NOs: 5-8.

[0034] In some embodiments, the composition further comprises a trans-activating CRISPR RNA (tracrRNA) molecule comprising the sequence shown in SEQ ID NOs: 9-19, 21, and 22.

[0035] In some embodiments, the CRISPR nuclease comprises a sequence at least 90% identical to the amino acid sequence shown in SEQ ID NO: 1, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from SEQ ID NOs: 4-22.

[0036] In some embodiments, the CRISPR nuclease is a nickase with an inactivated RuvC domain generated by amino acid substitutions at the positions provided in column 5 of Table 1 for the CRISPR nuclease.

[0037] In some embodiments, the CRISPR nuclease is a nickase with an inactivated HNH domain generated by amino acid substitution at the positions provided in column 6 of Table 1 for the CRISPR nuclease.

[0038] In some embodiments, the CRISPR nuclease is a catalytically inactive nuclease having an inactivated RuvC domain and an inactivated HNH domain generated by substitution at the positions provided for the CRISPR nuclease in Table 1, column 7.

[0039] For example, the nickase of the OMNI-335 nuclease can be generated by inactivating its RuvC domain by substituting the aspartic acid residue (D) at position 10 of the amino acid sequence of OMNI-335 (SEQ ID NO: 1) for another amino acid, such as alanine (A). For each amino acid position shown in columns 5-7 of Table 1, any other amino acid substitution is allowed.

[0040] In some embodiments, the CRISPR nuclease is a nickase generated by amino acid substitution at position D10, E733, H949, or D952.

[0041] In some embodiments, the CRISPR nuclease is a nickase generated by amino acid substitution at position D817, H818, or N841.

[0042] In some embodiments, the CRISPR nuclease is a catalytically inactive nuclease produced by an amino acid substitution at any of positions D10, E733, H949, or D952 and an amino acid substitution at any of positions D817, H818, or N841.

[0043] In some embodiments, the CRISPR nuclease utilizes a protospacer adjacent motif (PAM) sequence provided for the CRISPR nuclease in column 2 or 3 of Table 3.

[0044] The present invention also provides a method for modifying a nucleotide sequence at a DNA target site in a cell-free system or a cell genome, the method comprising introducing any of the above compositions into a cell. In some embodiments, the composition comprises a CRISPR nuclease and a crRNA:tracrRNA complex or an sgRNA molecule.

[0045] In some embodiments, the CRISPR nuclease creates DNA breaks in the DNA strand adjacent to a protospacer adjacent motif (PAM) sequence provided for the CRISPR nuclease in columns 2 or 3 of Table 3, and in the DNA strand adjacent to a sequence complementary to the PAM sequence. For example, the OMNI-335 nuclease with an appropriate targeting sgRNA or crRNA:tracrRNA complex is capable of creating DNA breaks in the DNA strand adjacent to the NVTAYTNN or NRTAYTNN sequence and in the DNA strand adjacent to a sequence complementary to the NVTAYTNN or NRTAYTNN sequence. In some embodiments, the DNA strand is located within the nucleus of the cell.

[0046] In some embodiments, the CRISPR nuclease is a nickase with an inactivated RuvC domain generated by amino acid substitutions at the positions provided for the CRISPR nuclease in Table 1, column 5, and effects DNA breakage in the DNA strand adjacent to the sequence complementary to the PAM sequence.

[0047] In some embodiments, the CRISPR nuclease is a nickase with an inactivated HNH domain generated by amino acid substitutions at the positions provided for the CRISPR nuclease in Table 1, column 6, and effects DNA breaks in the DNA strand adjacent to the PAM sequence.

[0048] In some embodiments, the CRISPR nuclease is a catalytically inactive nuclease having an inactivated RuvC domain and an inactivated HNH domain generated by substitution at the positions provided for the CRISPR nuclease in Table 1, column 7, and effects DNA breakage in the DNA strand adjacent to the PAM sequence.

[0049] The present invention also provides a method for modifying a nucleotide sequence at a DNA target site in a cell-free system or a cell genome, the method comprising introducing into the cell any one of the compositions provided above.

[0050] In some embodiments, the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:1, wherein the CRISPR nuclease effects DNA strand breaks adjacent to an NVTAYTNN or NRTAYTNN protospacer adjacent motif (PAM) sequence, and / or effects DNA strand breaks adjacent to a sequence that is complementary to the PAM sequence.

[0051] In some embodiments, the CRISPR nuclease is a nickase generated by amino acid substitution at position D10, E733, H949, or D952, and effects DNA strand breaks adjacent to the PAM sequence.

[0052] In some embodiments, the CRISPR nuclease is a nickase generated by amino acid substitution at position D817, H818, or N841, and effects DNA strand breaks adjacent to a sequence complementary to the PAM sequence.

[0053] In some embodiments, the cell is a eukaryotic cell or a prokaryotic cell.

[0054] In some embodiments, the cell is a mammalian cell.

[0055] In some embodiments, the cells are human cells.

[0056] The present invention also provides a method for modifying a nucleotide sequence at a target site in a cell genome, the method comprising introducing into the cell:

[0057] (i) a CRISPR nuclease comprising a sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 1;

[0058] (ii) a crRNA molecule comprising a guide sequence portion; and

[0059] (iii) a tracrRNA molecule comprising a nuclease-binding RNA sequence.

[0060] In some embodiments, the crRNA molecule further comprises a portion having a sequence selected from SEQ ID NOs: 5-8.

[0061] In some embodiments, the tracrRNA molecule further comprises a portion having a sequence selected from SEQ ID NOs: 9-19, 21, and 22.

[0062] In some embodiments, the crRNA molecule and the tracrRNA molecule are fused in the form of a single-stranded guide RNA molecule.

[0063] In some embodiments, the sgRNA molecule comprises a sequence selected from SEQ ID NOs: 4-22.

[0064] In some embodiments, the CRISPR nuclease comprises an amino acid sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, or 82% amino acid sequence identity to the CRISPR nuclease of SEQ ID NO: 1. In one embodiment, the sequence encoding the CRISPR nuclease has at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, or 82% identity to a nucleic acid sequence selected from SEQ ID NO: 2-3.

[0065] The present invention also provides a non-naturally occurring composition comprising a CRISPR nuclease, wherein the CRISPR nuclease comprises an amino acid sequence corresponding to the amino acid sequence of at least one of domain A, domain B, domain C, domain D, domain E, domain F, domain G, domain H, domain I, or domain J of SEQ ID NO: 1,

[0066] a) wherein domain A comprises amino acids 1-43 of SEQ ID NO: 1 that are at least 90%, 91%, 92%, 93%, 94%,

[0067] sequences with 95%, 96%, 97%, 98%, 99% or 100% identity;

[0068] b) wherein domain B comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to amino acids 44-81 of SEQ ID NO: 1;

[0069] c) wherein domain C comprises amino acids 82-157 of SEQ ID NO: 1 that are at least 90%, 91%, 92%, 93%,

[0070] sequences with 94%, 95%, 96%, 97%, 98%, 99% or 100% identity;

[0071] d) wherein domain D comprises amino acids 158-304 that are at least 90%, 91%, 92%, 93%,

[0072] sequences with 94%, 95%, 96%, 97%, 98%, 99% or 100% identity;

[0073] e) wherein domain E comprises amino acids 305-494 that are at least 90%, 91%, 92%, 93%,

[0074] sequences with 94%, 95%, 96%, 97%, 98%, 99% or 100% identity;

[0075] f) wherein domain F comprises amino acids 495-682 of SEQ ID NO: 1 that are at least 90%, 91%, 92%, 93%,

[0076] sequences with 94%, 95%, 96%, 97%, 98%, 99% or 100% identity;

[0077] g) wherein domain G comprises amino acids 683-735 that are at least 90%, 91%, 92%, 93%,

[0078] sequences with 94%, 95%, 96%, 97%, 98%, 99% or 100% identity;

[0079] h) wherein domain H comprises amino acids 736-885 that are at least 90%, 91%, 92%, 93%,

[0080] sequences with 94%, 95%, 96%, 97%, 98%, 99% or 100% identity;

[0081] i) wherein domain I comprises amino acids 886-1020 of SEQ ID NO: 1 that are at least 90%, 91%, 92%, 93%,

[0082] sequences with 94%, 95%, 96%, 97%, 98%, 99% or 100% identity; and

[0083] j) wherein domain J comprises amino acids 1021-1297 of SEQ ID NO: 1 that are at least 90%, 91%, 92%, 93%,

[0084] Sequences that are 94%, 95%, 96%, 97%, 98%, 99% or 100% identical.

[0085] According to some aspects of the present invention, the disclosed compositions comprise a DNA construct or vector system comprising a nucleotide sequence encoding a CRISPR nuclease or variant CRISPR nuclease. In some embodiments, the nucleotide sequence encoding the CRISPR nuclease or variant CRISPR nuclease is operably linked to a promoter operable in a cell of interest. In some embodiments, the cell of interest is a eukaryotic cell. In some embodiments, the cell of interest is a mammalian cell. In some embodiments, the nucleic acid sequence encoding the engineered CRISPR nuclease is codon-optimized for use in cells from a specific organism. In some embodiments, the nucleic acid sequence encoding the nuclease is codon-optimized for Escherichia coli. In some embodiments, the nucleic acid sequence encoding the nuclease is codon-optimized for eukaryotic cells. In some embodiments, the nucleic acid sequence encoding the nuclease is codon-optimized for mammalian cells.

[0086] In some embodiments, the composition comprises a recombinant nucleic acid comprising a heterologous promoter operably linked to a polynucleotide encoding a CRISPR enzyme having at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90% identity to SEQ ID NO: 1. Each possibility represents a separate embodiment.

[0087] In one embodiment of the composition, the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95% or 97% identity to the amino acid sequence as shown in SEQ ID NO: 1, or the sequence encoding the CRISPR nuclease has at least 75%, 80%, 85%, 90%, 95% or 97% sequence identity to a nucleotide sequence selected from SEQ ID NO: 2 and 3.

[0088] According to some embodiments, an engineered or non-naturally occurring composition is provided, comprising: a CRISPR nuclease comprising a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80% identity to the amino acid sequence of SEQ ID NO: 1; or a nucleic acid molecule comprising a sequence encoding the CRISPR nuclease. Each possibility represents a separate embodiment.

[0089] In one embodiment, the CRISPR nuclease is engineered or non-naturally occurring. CRISPR nucleases can also be recombinant. These CRISPR nucleases are produced using laboratory methods (e.g., molecular cloning) to bring together genetic material from multiple sources, creating sequences that would not otherwise be found in biological organisms.

[0090] In one embodiment, the CRISPR nuclease further comprises an RNA-binding portion capable of interacting with a DNA-targeting RNA molecule (gRNA) and an activity portion that exhibits site-directed enzymatic activity.

[0091] In one embodiment, the composition further comprises a DNA-targeting RNA molecule or a DNA polynucleotide encoding a DNA-targeting RNA molecule, wherein the DNA-targeting RNA molecule comprises a guide sequence portion, i.e., a nucleotide sequence that is complementary to a sequence in the target region, wherein the DNA-targeting RNA molecule and the CRISPR nuclease are not naturally found together.

[0092] In one embodiment, the DNA-targeting RNA molecule further comprises a nucleotide sequence that can form a complex with a CRISPR nuclease.

[0093] The present invention also provides a non-naturally occurring composition comprising a CRISPR-associated system, the CRISPR-associated system comprising:

[0094] a) one or more RNA molecules comprising a guide sequence portion linked to a direct repeat sequence, wherein the guide sequence is capable of hybridizing to a target sequence or one or more nucleotide sequences encoding the one or more RNA molecules; and

[0095] b) a CRISPR nuclease comprising an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1, or a nucleic acid molecule comprising a sequence encoding a CRISPR nuclease;

[0096] wherein the one or more RNA molecules hybridize to a target sequence, wherein the target sequence is adjacent to a pre-spacer adjacent motif (PAM), and the one or more RNA molecules form a complex with the RNA-guided nuclease.

[0097] In one embodiment, the composition further comprises an RNA molecule comprising a nucleotide sequence that can form a complex with a CRISPR nuclease (e.g., a tracrRNA molecule) or a DNA polynucleotide comprising a sequence encoding an RNA molecule that can form a complex with a CRISPR nuclease.

[0098] In one embodiment, the composition further comprises a donor template for homology directed repair (HDR).

[0099] In one embodiment, the composition is capable of editing a target region in the genome of a cell.

[0100] According to some embodiments, there is provided a non-naturally occurring composition comprising:

[0101] (a) a CRISPR nuclease or a polynucleotide encoding the CRISPR nuclease, the CRISPR nuclease comprising:

[0102] RNA binding moiety; and

[0103] An active portion that exhibits site-directed enzymatic activity, wherein the CRISPR nuclease is at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80% identical to SEQ ID NO: 1; and

[0104] (b) one or more RNA molecules or DNA polynucleotides encoding the one or more RNA molecules, the one or more RNA molecules comprising:

[0105] i) a DNA-targeting RNA sequence comprising a nucleotide sequence that is complementary to a sequence in the target DNA sequence; and

[0106] ii) an RNA sequence binding protein capable of interacting with the RNA binding portion of the CRISPR nuclease,

[0107] wherein the DNA-targeting RNA sequence and the CRISPR nuclease are not naturally present together. Each possibility represents a separate embodiment.

[0108] In some embodiments, a single RNA molecule comprising a DNA-targeting RNA sequence and a protein-binding RNA sequence is provided, wherein the RNA molecule can form a complex with the CRISPR nuclease and serve as a DNA-targeting module. In some embodiments, the RNA molecule has a length of at most 1000 bases, 900 bases, 800 bases, 700 bases, 600 bases, 500 bases, 400 bases, 300 bases, 200 bases, 100 bases, 50 bases. Each possibility represents a separate embodiment. In some embodiments, a first RNA molecule comprising a DNA-targeting RNA sequence and a second RNA molecule comprising a protein-binding RNA sequence interact through base pairing or alternatively fuse together to form one or more RNA molecules that are compounded with the CRISPR nuclease and serve as a DNA-targeting module.

[0109] The present invention also provides a non-naturally occurring composition comprising:

[0110] a) a CRISPR nuclease comprising a sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1, or a nucleic acid molecule comprising a sequence encoding a CRISPR nuclease; and

[0111] b) one or more RNA molecules, or one or more DNA polynucleotides encoding said one or more RNA molecules, comprising at least one of:

[0112] i) a nuclease-binding RNA nucleotide sequence capable of interacting / binding to said CRISPR nuclease; and

[0113] ii) a DNA-targeting RNA nucleotide sequence comprising a sequence complementary to a sequence in the target DNA sequence,

[0114] wherein the CRISPR nuclease is capable of complexing with the one or more RNA molecules to form a complex capable of hybridizing to the target DNA sequence.

[0115] In one embodiment, a CRISPR nuclease and one or more RNA molecules form a CRISPR complex that is capable of binding to a target DNA sequence to effect cleavage of the target DNA sequence.

[0116] In one embodiment, the CRISPR nuclease and at least one of the one or more RNA molecules are not found together in nature.

[0117] In one embodiment:

[0118] a) CRISPR nucleases comprise an RNA-binding portion and an active portion that exhibits site-directed enzymatic activity;

[0119] b) the DNA-targeting RNA nucleotide sequence comprises a nucleotide sequence that is complementary to a sequence in the target DNA sequence; and

[0120] c) the nuclease-binding RNA nucleotide sequence comprises a sequence that interacts with the RNA-binding portion of the CRISPR nuclease.

[0121] In one embodiment, the nuclease-binding RNA nucleotide sequence and the DNA-targeting RNA nucleotide sequence are located on a single-stranded guide RNA molecule (sgRNA), wherein the sgRNA molecule can form a complex with the CRISPR nuclease and serve as a DNA-targeting module.

[0122] In one embodiment, the nuclease-binding RNA nucleotide sequence is located on a first RNA molecule and the DNA-targeting RNA nucleotide sequence is located on a second RNA molecule, and wherein the first and second RNA molecules interact through base pairing or are fused together to form an RNA complex or sgRNA that forms a complex with the CRISPR nuclease and acts as a DNA-targeting module.

[0123] In one embodiment, the sgRNA has a length of at most 1000 bases, 900 bases, 800 bases, 700 bases, 600 bases, 500 bases, 400 bases, 300 bases, 200 bases, 100 bases, 50 bases.

[0124] In one embodiment, the composition further comprises a donor template for homology directed repair (HDR).

[0125] In one embodiment, the CRISPR nuclease is non-naturally occurring.

[0126] In one embodiment, the CRISPR nuclease is engineered and comprises non-natural or synthetic amino acids.

[0127] In one embodiment, the CRISPR nuclease is engineered and comprises one or more of a nuclear localization sequence (NLS), a cell penetrating peptide sequence, and / or an affinity tag.

[0128] In one embodiment, the CRISPR nuclease comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of a CRISPR complex comprising a detectable amount of the CRISPR nuclease in the nucleus of a eukaryotic cell.

[0129] The present invention also provides a method of modifying a nucleotide sequence at a target site in a cell-free system or a cell genome, the method comprising introducing into the cell any of the compositions of the present invention.

[0130] In one embodiment, the cell is a eukaryotic cell.

[0131] In another embodiment, the cell is a prokaryotic cell.

[0132] In some embodiments, the one or more RNA molecules further comprise an RNA sequence comprising a nucleotide molecule that can form a complex with an RNA nuclease (tracrRNA) or a DNA polynucleotide encoding an RNA molecule comprising a nucleotide sequence that can form a complex with a CRISPR nuclease.

[0133] In one embodiment, the CRISPR nuclease comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs at or near the amino terminus, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs at or near the carboxy terminus, or a combination of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs at or near the amino terminus and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs at or near the carboxy terminus. In one embodiment, the NLS is fused to the CRISPR nuclease. In one embodiment, the NLS is located within the open reading frame (ORF) of the CRISPR nuclease.

[0134] Methods for fusing an NLS at or near the amino terminus, at or near the carboxyl terminus, or within an ORF of an expressed protein are well known in the art. As an example, to fuse an NLS to the amino terminus of a CRISPR nuclease, the nucleic acid sequence of the NLS is placed immediately after the start codon of the CRISPR nuclease on the nucleic acid encoding the NLS-fused CRISPR nuclease. Conversely, to fuse an NLS to the carboxyl terminus of a CRISPR nuclease, the nucleic acid sequence of the NLS is placed after the codon encoding the last amino acid of the CRISPR nuclease and before the stop codon.

[0135] Any combination of NLS, cell penetrating peptide sequences and / or affinity tags at any position along the ORF of the CRISPR nuclease is encompassed by the present invention.

[0136] The amino acid and nucleic acid sequences of the CRISPR nucleases provided herein can include an inserted NLS and / or TAG so as to interrupt the contiguous amino acid or nucleic acid sequence of the CRISPR nuclease.

[0137] In one embodiment, one or more NLSs are repeated in tandem.

[0138] In one embodiment, one or more NLSs are considered to be near the N- or C-terminus when the most recent amino acid of the NLS is located within about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, or more amino acids along the polypeptide chain from the N- or C-terminus.

[0139] As discussed, CRISPR nucleases can be engineered to contain one or more nuclear localization sequences (NLS), cell-penetrating peptide sequences, and / or affinity tags.

[0140] In one embodiment, the composition further comprises a recombinant nucleic acid molecule comprising a heterologous promoter operably linked to the nucleotide molecule comprising a sequence encoding a CRISPR nuclease.

[0141] In one embodiment, the CRISPR nuclease or a nucleic acid molecule containing a sequence encoding the CRISPR nuclease is non-naturally occurring or engineered.

[0142] The invention also provides non-naturally occurring or engineered compositions comprising a vector system comprising a nucleic acid molecule comprising a sequence encoding any of the CRISPR nucleases of the invention.

[0143] The present invention also provides use of any composition of the present invention for treating an individual suffering from a disease associated with a genomic mutation, comprising modifying the nucleotide sequence at a target site in the genome of the individual.

[0144] The present invention provides a method for modifying a nucleotide sequence at a target site in the genome of a mammalian cell, the method comprising introducing into the cell (i) a composition comprising a CRISPR nuclease having at least 95% identity to the amino acid sequence of SEQ ID NO: 1, or a nucleic acid molecule comprising a sequence encoding a CRISPR nuclease having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 2-3, and (ii) a DNA-targeting RNA molecule or a DNA polynucleotide encoding the DNA-targeting RNA molecule comprising a nucleotide sequence complementary to a sequence in the target DNA.

[0145] In some embodiments, the method is performed ex vivo. In some embodiments, the method is performed in vivo. In some embodiments, some steps of the method are performed ex vivo and some steps are performed in vivo. In some embodiments, the mammalian cell is a human cell.

[0146] In one embodiment, the method further comprises introducing into the cell: (iii) an RNA molecule comprising a tracrRNA sequence or a DNA polynucleotide encoding an RNA molecule comprising a tracrRNA sequence.

[0147] In one embodiment, the DNA-targeting RNA molecule comprises crRNA repeat sequences.

[0148] In one embodiment, an RNA molecule comprising a tracrRNA sequence is capable of binding to a DNA-targeting RNA molecule.

[0149] In one embodiment, the DNA-targeting RNA molecule and the RNA molecule comprising a tracrRNA sequence interact to form an RNA complex, and the RNA complex is capable of forming an active complex with a CRISPR nuclease.

[0150] In one embodiment, the DNA-targeting RNA molecule and the RNA molecule comprising a nuclease-binding RNA sequence are fused in the form of a single-stranded guide RNA molecule suitable for forming an active complex with the CRISPR nuclease.

[0151] In one embodiment, the guide sequence portion comprises a sequence complementary to the protospacer sequence.

[0152] In one embodiment, the CRISPR nuclease forms a complex with a DNA-targeting RNA molecule and creates a double-stranded break in the 3' or 5' region of the protospacer adjacent motif (PAM).

[0153] In one embodiment of any of the methods described herein, the method is for treating an individual suffering from a disease associated with a genomic mutation, comprising modifying a nucleotide sequence at a target site in the genome of the individual.

[0154] In one embodiment, the method comprises first selecting an individual suffering from a disease associated with a genomic mutation and obtaining cells from the individual.

[0155] The present invention also provides one or more modified cells obtained by any method as described herein. In one embodiment, these one or more modified cells can produce daughter cells. In one embodiment, these one or more modified cells can produce daughter cells after transplantation.

[0156] The present invention also provides a composition comprising the modified cells and a pharmaceutically acceptable carrier. Also provided is an in vitro or ex vivo method for preparing the composition, comprising mixing the cells with a pharmaceutically acceptable carrier.

[0157] The present invention also provides a composition comprising: a CRISPR nuclease comprising a sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 1; and a non-naturally occurring RNA molecule comprising a crRNA repeat sequence portion and a guide sequence portion, wherein the RNA molecule forms a complex with the OMNI-335 nuclease in the presence of a tracrRNA sequence and targets the OMNI-335 nuclease to a DNA target site, wherein the tracrRNA sequence is encoded by the tracrRNA portion of the RNA molecule or the tracrRNA portion of a second RNA molecule.

[0158] In some embodiments, the RNA molecule comprises a tracrRNA portion, and further comprises a crRNA repeat sequence portion and a guide sequence portion.

[0159] In some embodiments, the tracrRNA portion is covalently linked to the crRNA repeat sequence through a polynucleotide linker portion.

[0160] In some embodiments, the polynucleotide linker portion is 4-10 nucleotides in length.

[0161] In some embodiments, the polynucleotide linker has a GAAA sequence.

[0162] In some embodiments, the composition further comprises an OMNI-335 CRISPR nuclease, wherein the OMNI-335 CRISPR nuclease has at least 95% identity to the amino acid sequence of SEQ ID NO: 1.

[0163] In some embodiments, the RNA molecules are formed by in vitro transcription (IVT) or solid phase artificial oligonucleotide synthesis.

[0164] In some embodiments, the RNA molecule comprises modified nucleotides.

[0165] The present invention also provides a polynucleotide molecule encoding the RNA molecule of any one of the above embodiments.

[0166] The present invention also provides a method for modifying a nucleotide sequence at a DNA target site in a cell-free system or a cell genome, comprising introducing into the system or cell any RNA molecule described herein and a CRISPR nuclease having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 1.

[0167] In some embodiments, the cell is a eukaryotic cell or a prokaryotic cell.

[0168] In some embodiments, the cell is a human cell or a plant cell.

[0169] The present invention also provides a kit for modifying a nucleotide sequence at a DNA target site in a cell-free system or cell genome, comprising introducing into the system or cell a composition according to any one of the above embodiments, a CRISPR nuclease having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 1, and instructions for delivering the RNA molecule and the CRISPR nuclease to the cell.

[0170] In embodiments of the present invention, non-naturally occurring RNA molecules comprise a "spacer" or "guide sequence" portion. A "spacer portion" or "guide sequence portion" of an RNA molecule refers to a nucleotide sequence that is capable of hybridizing to a specific target DNA sequence, e.g., a guide sequence portion has a nucleotide sequence that is fully complementary to the targeted DNA sequence along the length of the guide sequence portion. In some embodiments, the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, or is about 17-30, 17-29, 17-28, 17-27, 17-26, 17-25, 17-24, 18-22, 19-22, 18-20, 17-20, or 21-22 nucleotides in length. Preferably, the full length of the guide sequence portion is fully complementary to the target DNA sequence along the length of the guide sequence portion. The guide sequence portion can be part of an RNA molecule having a "scaffold portion" that can form a complex with and activate the CRISPR nuclease, wherein the guide sequence portion of the RNA molecule serves as the DNA targeting portion of the CRISPR complex. When an RNA molecule having a scaffold portion and a guide sequence portion is present simultaneously with a CRISPR molecule, the RNA molecule is capable of targeting the CRISPR nuclease to a specific target DNA sequence. Each possibility represents a separate embodiment. The spacer sequence portion of the RNA molecule can be custom designed to target any desired sequence.

[0171] In one embodiment, the nuclease-binding RNA nucleotide sequence and the DNA-targeting RNA nucleotide sequence (e.g., a spacer sequence or a guide sequence portion) are located on a single-stranded guide RNA molecule (sgRNA), wherein the sgRNA molecule can form a complex with the OMNI-335 CRISPR nuclease and serve as a DNA-targeting module.

[0172] In one embodiment, the nuclease-binding RNA nucleotide sequence is located on a first RNA molecule, the DNA-targeting RNA nucleotide sequence is located on a second RNA molecule, and the first and second RNA molecules interact through base pairing and complex with the CRISPR nuclease to act as a targeting module.

[0173] According to some aspects of the invention, the disclosed methods include methods of modifying a nucleotide sequence at a target site in a cell-free system or a cell genome, the method comprising introducing into the cell a composition of any of the embodiments described herein.

[0174] The present invention also provides the use of any composition or method of the present invention for modifying a nucleotide sequence at a target site of DNA in a cell.

[0175] The present invention provides a method for modifying a nucleotide sequence at a target site in the genome of a eukaryotic cell.

[0176] The present invention provides a method for modifying a nucleotide sequence at a target site in the genome of a mammalian cell. In some embodiments, the mammalian cell is a human cell.

[0177] The present invention provides a method for modifying a nucleotide sequence at a target site in the genome of a plant cell.

[0178] In some embodiments, the method is performed ex vivo. In some embodiments, the method is performed in vivo. In some embodiments, some steps of the method are performed ex vivo and some steps are performed in vivo. In some embodiments, the mammalian cell is a human cell.

[0179] The present invention also provides one or more modified cells obtained by any method as described herein. In one embodiment, these one or more modified cells can produce daughter cells. In one embodiment, these one or more modified cells can produce daughter cells after transplantation.

[0180] The present invention also provides a composition comprising the modified cells and a pharmaceutically acceptable carrier. Also provided is an in vitro or ex vivo method for preparing the composition, comprising mixing the cells with a pharmaceutically acceptable carrier.

[0181] The present invention also provides a kit for modifying a nucleotide sequence at a DNA target site in a cell-free system or cell genome, comprising introducing into the system or cell a CRISPR nuclease having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 1, one or more RNA molecules configured to form a complex with the CRISPR nuclease and / or target the complex to the target site, and instructions for delivering the RNA molecule and the CRISPR nuclease to the cell. For example, the kit can be used as a diagnostic kit to detect the presence of a target site (e.g., a DNA sequence) in a nucleotide molecule in a cell or test tube.

[0182] DNA-targeting RNA molecules

[0183] The "guide sequence portion" of an RNA molecule refers to a nucleotide sequence that is capable of hybridizing to a specific target DNA sequence, for example, a guide sequence portion has a nucleotide sequence that is partially or completely complementary to the targeted DNA sequence along the length of the guide sequence portion. In some embodiments, the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or is about 17-50, 17-49, 17-48, 17-47, 17-46, 17-45, 17-44, 17-43, 17-42, 17-41, 17-40, 17-41, 17-42, 17-43 20, 18-21, 21-22, or 17-20 nucleotides. The full length of the guide sequence portion is fully complementary to the targeted DNA sequence along the length of the guide sequence portion. The guide sequence portion can be part of an RNA molecule that can form a complex with a CRISPR nuclease, wherein the guide sequence portion acts as the DNA targeting portion of the CRISPR complex. When a DNA molecule having a guide sequence portion is present simultaneously with a CRISPR molecule, the RNA molecule is able to target the CRISPR nuclease to a specific target DNA sequence. Each possibility represents a separate embodiment. RNA molecules can be custom designed to target any desired sequence. Therefore, molecules that comprise a "guide sequence portion" are a class of targeting molecules. In this application, the terms "guide molecule," "RNA guide molecule," "guide RNA molecule," and "gRNA molecule" are synonymous with molecules that comprise a guide sequence portion, and the term "spacer sequence" is synonymous with "guide sequence portion."

[0184] In embodiments of the invention, the CRISPR nuclease has its maximal cleavage activity when used with an RNA molecule comprising a guide sequence portion having 17, 18, 19 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0185] Single-stranded guide RNA (sgRNA) molecules can be used to guide CRISPR nucleases to a desired target site. The single-stranded guide RNA comprises a guide sequence portion and a scaffold portion. The scaffold portion interacts with the CRISPR nuclease and, together with the guide sequence portion, activates the CRISPR nuclease and targets it to the desired target site. The scaffold portion can be further engineered, for example, to have a reduced size.

[0186] According to some aspects of the present invention, the disclosed methods include methods of modifying a nucleotide sequence at a target site in a cell-free system or a cell genome, the methods comprising introducing a composition according to any of the embodiments described herein into a cell.

[0187] In some embodiments, the cell is a eukaryotic cell, preferably a mammalian cell or a plant cell.

[0188] According to some aspects of the invention, the disclosed methods include use of any of the compositions described herein for treating an individual suffering from a disease associated with a genomic mutation, comprising modifying the nucleotide sequence at a target site in the genome of the individual.

[0189] According to some aspects of the present invention, the disclosed methods include methods of treating an individual suffering from a mutation disorder comprising targeting any of the compositions described herein to an allele associated with the mutation disorder.

[0190] In some embodiments, the mutation disorder is associated with any disease or disorder selected from the group consisting of: neoplasia; age-related macular degeneration; schizophrenia; neurological, neurodegenerative, or movement disorders; fragile X syndrome; secretase-related disorders; prion-related disorders; ALS; addiction; autism; Alzheimer's disease; neutropenia; inflammation-related disorders; Parkinson's disease; blood and coagulation diseases and disorders, beta thalassemia, sickle cell anemia; cellular dysregulation and oncology diseases and disorders; inflammation and immune-related diseases and disorders; metabolic, liver, kidney, and protein diseases and disorders; muscle and skeletal diseases and disorders; skin diseases and disorders; neural and neuronal diseases and disorders; and ocular diseases and disorders.

[0191] OMNI CRISPR nuclease domain

[0192] The characteristic targeted nuclease activity of CRISPR nucleases is conferred by the multiple functions of their specific domains. In this application, the OMNI-335 CRISPR nuclease domains are defined as Domain A, Domain B, Domain C, Domain D, Domain E, Domain F, Domain G, Domain H, Domain I, and Domain J.

[0193] The activities of each OMNI-335 CRISPR nuclease domain are described herein, wherein each domain activity provides an aspect of the advantageous characteristics of the nuclease.

[0194] Specifically, Domain A, Domain G, and Domain I form the structural unit of the OMNI CRISPR nuclease, which contains the nuclease active site involved in DNA strand cleavage. The structural unit formed by Domain A, Domain G, and Domain I cleaves the DNA strand displaced by the guide RNA molecule bound to the double-stranded DNA target site.

[0195] When the OMNI CRISPR nuclease binds to the target DNA site, domain B is involved in initiating DNA cleavage activity.

[0196] Domains C, D, E, and F bind to the guide RNA molecule and contribute to the specificity of target site recognition.

[0197] Domain H contains the nuclease active site involved in DNA cleavage. Domain H cleaves the DNA strand to which the guide RNA molecule binds at the DNA target site.

[0198] Domain J is involved in providing PAM site specificity to the OMNI CRISPR nuclease, including aspects of PAM site interrogation and recognition. Domain J also exhibits topoisomerase activity.

[0199] Further description of other CRISPR nuclease domains and their general functions can be found in, inter alia, Mir et al., ACS Chem. Biol. (2019); Palermo et al., Quarterly Reviews of Biophysics (2018); Jiang and Doudna, Annual Review of Biophysics (2017); Nishimasu et al., Cell (2014); and Nishimasu et al., Cell (2015), incorporated herein by reference.

[0200] In one aspect of the invention, amino acid sequences with similarity to the OMNI CRISPR nuclease domain can be used to design and manufacture non-naturally occurring peptides, such as CRISPR nucleases, such that the peptides exhibit the advantageous characteristics of OMNI CRISPR nuclease domain activity.

[0201] In one embodiment, such peptides, e.g., CRISPR nucleases, comprise an amino acid sequence that is at least 100%, 99.5%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, or 70% identical to the amino acid sequence of at least one of Domain A, Domain B, Domain C, Domain D, Domain E, Domain F, Domain G, Domain H, Domain I, or Domain J of OMNI-335 CRISPR nuclease. In some embodiments, the peptide comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or at least eleven amino acid sequences selected from amino acid sequences at least 100%, 99.5%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, or 70% identical to the amino acid sequences of Domain A, Domain B, Domain C, Domain D, Domain E, Domain F, Domain G, Domain H, Domain I, and Domain J of OMNI-335 CRISPR nuclease. In one embodiment, the peptide exhibits extensive amino acid variability relative to the full-length OMNI-335 CRISPR nuclease amino acid sequence other than an amino acid sequence that is at least 100%, 99.5%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, or 70% identical to the amino acid sequence of at least one of Domain A, Domain B, Domain C, Domain D, Domain E, Domain F, Domain G, Domain H, Domain I, or Domain J of the OMNI-335 CRISPR nuclease. In one embodiment, the peptide comprises an intervening amino acid sequence between the two domain sequences.In one embodiment, the length of the intervening amino acid sequence is 1-10, 10-20, 20-40, 40-50, 50-60, 80-100, 100-150, 150-200, 200-250, at most 100, at most 200, or at most 300 amino acids. Each possibility represents a separate embodiment. In one embodiment, the intervening sequence is a base linker sequence. In one embodiment, the CRISPR nuclease comprises multiple domains from an OMNI CRISPR nuclease, and the domains are preferably organized in alphabetical order from the N-terminus to the C-terminus of the CRISPR nuclease. For example, a CRISPR nuclease comprising Domain A, Domain E, and Domain I of OMNI-335 would have domains in the order of Domain A, Domain E, and finally Domain I in the CRISPR nuclease sequence, with the possibility of an intervening sequence at either or both ends of each domain.

[0202] In one aspect of the invention, the amino acid sequence encoding any of the domains of the OMNI CRISPR nucleases described herein may comprise one or more amino acid substitutions relative to the original OMNI CRISPR nuclease domain sequence. The amino acid substitutions may be conservative, i.e., substitutions with amino acids having similar chemical properties as the original amino acid. For example, a positively charged amino acid may be substituted with an alternative positively charged amino acid, e.g., an arginine residue may be substituted with a lysine residue, or a polar amino acid may be substituted with a different polar amino acid. Conservative substitutions are more tolerated, and the amino acid sequence encoding any of the domains of the OMNI CRISPR nuclease may contain up to 10% such substitutions. The amino acid substitution may be radical, i.e., substitutions with amino acids having different chemical properties than the original amino acid. For example, a positively charged amino acid may be substituted with a negatively charged amino acid, e.g., an arginine residue may be substituted with a glutamic acid residue, or a polar amino acid may be substituted with a non-polar amino acid. The amino acid substitutions may be semi-conservative, or substitutions with any other amino acid. Such substitutions may alter the activity relative to the original OMNI CRISPR nuclease domain function, e.g., reduce catalytic nuclease activity.

[0203] According to some aspects of the invention, the disclosed compositions comprise non-naturally occurring compositions comprising a CRISPR nuclease, wherein the CRISPR nuclease comprises an amino acid sequence corresponding to the amino acid sequence of at least one of domain A, domain B, domain C, domain D, domain E, domain F, domain G, domain H, domain I, or domain J of the OMNI-335 CRISPR nuclease. The amino acid ranges for each domain within their respective OMNI CRISPR nuclease amino acid sequences are provided in Supplementary Table 1. In some embodiments of the invention, the CRISPR nuclease comprises at least one, at least two, at least three, at least four, or at least five amino acid sequences, wherein each amino acid sequence corresponds to any one of the amino acid sequence domain A, domain B, domain C, domain D, domain E, domain F, domain G, domain H, domain I, or domain J of the OMNI-335 CRISPR nuclease. Thus, the CRISPR nuclease can comprise any combination of amino acid sequences corresponding to any one of Domain A, Domain B, Domain C, Domain D, Domain E, Domain F, Domain G, Domain H, Domain I, or Domain J of an OMNI CRISPR nuclease. In some embodiments, the amino acid sequence is at least 100-250, 250-500, 500-1000, 1000-1500, 1000-1700, or 1000-2000 amino acids in length.

[0204] Diseases and treatments

[0205] Certain embodiments of the present invention target nucleases to specific genetic loci associated with a disease or condition in the form of gene editing, treatment methods or therapies. For example, in order to induce editing or knockout of a gene, custom-designed guide RNA molecules can be used to specifically target the pathogenic mutation alleles of the new nuclease disclosed herein. The guide RNA molecule is preferably designed by first considering the PAM requirements of the nuclease, as shown herein, which also depends on the system in which gene editing is performed. For example, the guide RNA molecule intended to target the OMNI-335 nuclease to the target site is designed to contain a spacer region complementary to the DNA chain of the DNA double-stranded region adjacent to the OMNI-335 PAM sequence, such as "NVTAYTNN" or "NRTAYTNN". The guide RNA molecule is also preferably designed to contain a spacer region of sufficient length and preferably optimal length (i.e., a region complementary to the target allele in the guide RNA molecule) to increase the specific activity of the nuclease and reduce off-target effects.

[0206] As non-limiting examples, guide RNA molecules can be designed to target specific regions of nuclease mutant alleles, such as near the start codon, so that after the DNA damage caused by nuclease, non-homologous end joining (NHEJ) pathway is induced and the silencing of mutant alleles is caused by introducing frameshift mutations. The method for this design guide RNA molecule is particularly suitable for changing the effect of dominant negative mutations, thereby treating individuality. As a separate non-limiting example, guide RNA molecules can be designed to target specific pathogenic mutations of mutant alleles, so that after the DNA damage caused by nuclease, homology-directed repair (HDR) pathway is induced, and the correction of template-mediated mutant alleles is caused. The method for this design guide RNA molecule is particularly suitable for changing the haploid deficiency effect (haploinsufficiencyeffect) of mutant alleles, thereby treating individuality.

[0207] Non-limiting examples of specific genes that can be targeted for alteration to treat a disease or condition are presented below. Specific disease-associated genes and mutations that induce mutational conditions are described in the literature. Such mutations can be used to design DNA-targeting RNA molecules to target CRISPR compositions to alleles of disease-associated genes, wherein the CRISPR compositions cause DNA damage and induce DNA repair pathways to alter the alleles and thereby treat mutational conditions.

[0208] Mutations in the ELANE gene are associated with neutropenia. Thus, without limitation, embodiments of the present invention targeting ELANE can be used in methods of treating individuals suffering from neutropenia.

[0209] CXCR4 is a coreceptor for human immunodeficiency virus type 1 (HIV-1) infection. Thus, without limitation, embodiments of the present invention that target CXCR4 can be used in methods of treating an individual suffering from HIV-1 or conferring resistance to HIV-1 infection in an individual.

[0210] Programmed cell death protein 1 (PD-1) destruction enhances CAR-T cell-mediated tumor cell killing, and PD-1 can be a target in other cancer therapies. Thus, without limitation, embodiments of the present invention targeting PD-1 can be used in methods for treating individuals suffering from cancer. In one embodiment, the treatment is CAR-T cell therapy using T cells modified according to the present invention to be PD-1 deficient.

[0211] In addition, BCL11A is a gene that plays a role in inhibiting hemoglobin production. By inhibiting BCL11A, globin production can be increased to treat diseases such as thalassemia or sickle cell anemia. See, for example, PCT International Publication No. WO2017 / 077394A2; U.S. Publication No. US2011 / 0182867A1; Humbert et al., Sci. Transl. Med. (2019); and Canver et al., Nature (2015). Therefore, without limitation, embodiments of the present invention targeting the BCL11A enhancer can be used in methods for treating individuals suffering from beta thalassemia or sickle cell anemia.

[0212] Embodiments of the present invention can also be used to target any disease-associated gene for the study, alteration, or treatment of any disease or condition listed in Table A or Table B below. Indeed, any disease associated with a genetic locus can be studied, altered, or treated by using the nucleases disclosed herein to target appropriate disease-associated genes, such as those listed in U.S. Publication No. 2018 / 0282762A1 and European Patent No. EP3079726B1.

[0213] Table A - Diseases, conditions and their associated genes

[0214]

[0215]

[0216] Table B - Diseases, conditions and their associated genes

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223] Unless otherwise specified, all technical and / or scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present invention belongs. Although methods and materials similar or equivalent to those described herein can be used for the practice or testing of embodiments of the present invention, exemplary methods and / or materials will be described below. In the event of conflict, the patent specification (including definitions) shall prevail. In addition, materials, methods and examples are illustrative only and are not intended to be necessarily limiting.

[0224] In the discussion, unless otherwise indicated, adjectives such as "substantially" and "about" that modify conditions or relational features of one or more features of an embodiment of the present invention should be understood to mean that the condition or feature is defined within an acceptable tolerance range for the operation of the embodiment for its intended application. Unless otherwise indicated, the word "or" in the specification and claims is considered to be inclusive rather than exclusive and indicates at least one and any combination of the items to which it is associated.

[0225] It should be understood that the terms "a" and "an" as used above and elsewhere herein refer to "one or more" of the listed components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Therefore, the terms "a," "an," and "at least one" are used interchangeably in this application.

[0226] For a better understanding of the present teachings and in no way limiting the scope of the present teachings, all numbers and other numerical values ​​expressing quantities, percentages or ratios used in the specification and claims should be understood as being modified in all cases by the term "about," unless otherwise indicated. Therefore, unless otherwise indicated, the numerical parameters set forth in the following specification and the appended claims are approximate values ​​that may vary depending on the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0227] It should be understood that where numerical ranges are recited herein, the invention encompasses every integer between and including the upper and lower limits unless otherwise indicated.

[0228] In the specification and claims of this application, each of the verbs "comprise," "include," and "have," and their variations, is used to indicate that the object or objects of the verb do not necessarily fully list the components, elements, or parts of the subject or subjects of the verb. Other terms used herein are intended to be defined by their commonly understood meanings in the art.

[0229] The terms "polynucleotide," "nucleotide," "nucleotide sequence," "nucleic acid," and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides (deoxyribonucleotides or ribonucleotides or their analogs) of any length. A polynucleotide can have any three-dimensional structure and can perform any known or unknown function. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci defined by linkage analysis (locus), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide can contain one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, the nucleotide structure can be modified before or after polymer assembly. The nucleotide sequence can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, for example by binding to a labeling component.

[0230] The term "nucleotide analogue" or "modified nucleotide" refers to a nucleotide containing one or more chemical modifications (e.g., substitutions) in or on the nitrogenous base of a nucleoside (e.g., cytosine (C), thymine (T) or uracil (U), adenine (A) or guanine (G)), a sugar group (sugarmoiety) (e.g., ribose, deoxyribose, modified ribose, modified deoxyribose, a six-membered sugar analogue or an open-chain sugar analogue) or a phosphate ester of a nucleoside. Each of the RNA sequences described herein may comprise one or more nucleotide analogues.

[0231] As used herein, the following nucleotide identifiers are used to indicate the referenced nucleotide bases:

[0232]

[0233] As used herein, the term "targeting sequence" or "targeting molecule" refers to a nucleotide sequence or a molecule comprising a nucleotide sequence that is capable of hybridizing to a specific target sequence, for example, a targeting sequence having a nucleotide sequence that is at least partially complementary to the targeted sequence along the length of the targeting sequence. The targeting sequence or targeting molecule can be part of a targeting RNA molecule that can form a complex with a CRISPR nuclease, wherein the targeting sequence acts as the targeting portion of the CRISPR complex. When a molecule having a targeting sequence is present at the same time as a CRISPR molecule, the RNA molecule is able to target the CRISPR nuclease to a specific target sequence. Each possibility represents a separate embodiment. Targeting RNA molecules can be custom designed to target any desired sequence.

[0234] The term "targeting" refers to the preferential hybridization of a targeting sequence or targeting molecule to a nucleic acid having a target nucleotide sequence. It should be understood that the term "targeting" encompasses variable hybridization efficiencies, thereby preferentially targeting nucleic acids having a target nucleotide sequence, but unintentional off-target hybridization other than on-target hybridization may also occur. It should be understood that where an RNA molecule targets a sequence, the complex of the RNA molecule and the CRISPR nuclease molecule targets the sequence to provide nuclease activity.

[0235] In the case of targeting a DNA sequence present in multiple cells, it will be understood that targeting encompasses hybridization of the guide sequence portion of the RNA molecule to a sequence in one or more cells, and also encompasses hybridization of the RNA molecule to a target sequence in less than all of the multiple cells. Thus, it will be understood that in the case of an RNA molecule targeting a sequence in multiple cells, the complex of the RNA molecule and the CRISPR nuclease will be understood to hybridize to the target sequence in one or more cells, and may also hybridize to the target sequence in less than all of the cells. Thus, it will be understood that the complex of the RNA molecule and the CRISPR nuclease introduces associated double-strand breaks upon hybridization with the target sequence in one or more cells, and may also introduce associated double-strand breaks upon hybridization with the target sequence in less than all of the cells. As used herein, the term "modified cell" refers to a cell in which double-strand breaks are affected by the complex of the RNA molecule and the CRISPR nuclease as a result of hybridization with the target sequence, i.e., on-target hybridization.

[0236] As used herein, the term "wild-type" is a term understood by those skilled in the art and refers to the typical form of an organism, strain, gene or trait found in nature, as distinguished from mutant or variant forms. Thus, as used herein, where an amino acid or nucleotide sequence refers to a wild-type sequence, a variant refers to a variant of that sequence, e.g., comprising substitutions, deletions, insertions. In embodiments of the present invention, an engineered CRISPR nuclease is a variant CRISPR nuclease that comprises at least one amino acid modification (e.g., substitutions, deletions and / or insertions) compared to any of the CRISPR nucleases shown in Table 1.

[0237] The terms "non-naturally occurring" or "engineered" are used interchangeably and refer to human manipulation. When referring to a nucleic acid molecule or polypeptide, these terms can mean that the nucleic acid molecule or polypeptide is at least substantially free of at least one other component with which it is naturally associated in nature and as found in nature.

[0238] As used herein, the term "amino acid" includes natural and / or unnatural or synthetic amino acids, including glycine and the D- or L-optical isomers, as well as amino acid analogs and peptidomimetics.

[0239] As used herein, "genomic DNA" refers to linear and / or chromosomal DNA and / or plasmid or other extrachromosomal DNA sequences present in one or more cells of interest. In some embodiments, the cells of interest are eukaryotic cells. In some embodiments, the cells of interest are prokaryotic cells. In some embodiments, the method produces a double-strand break (DSB) at a predetermined target site in a genomic DNA sequence, resulting in a mutation, insertion, and / or deletion of the DNA sequence at the target site in the genome.

[0240] "Eukaryotic" cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells, and human cells.

[0241] As used herein, the term "nuclease" refers to an enzyme that is capable of cleaving the phosphodiester bond between the nucleotide subunits of a nucleic acid. The nuclease can be isolated or derived from a natural source. The natural source can be any living organism. Alternatively, the nuclease can be a modified or synthetic protein that retains phosphodiester bond cleavage activity.

[0242] As used herein, the term "PAM" refers to a nucleotide sequence of the target DNA that is located near the targeted DNA sequence and is recognized by the CRISPR nuclease. Depending on the identity of the nuclease, the PAM sequence can be different.

[0243] The term "mutation disorder" or "mutation disease" as used herein refers to any disorder or disease associated with abnormal gene function caused by a mutation. A dysfunctional gene that manifests as a mutation disorder contains a mutation in at least one of its alleles, and the dysfunctional gene is referred to as a "disease-associated gene". The mutation may be in any part of the disease-associated gene, such as in the regulatory, coding, or non-coding parts. The mutation may be any type of mutation, such as a substitution, insertion, or deletion. Depending on the mechanism of any type of mutation, such as recessive, dominant negative, gain-of-function, loss-of-function, or mutation that results in haploinsufficiency of the gene product, mutations in disease-associated genes may manifest as a disorder or disease.

[0244] Those skilled in the art will appreciate that embodiments of the present invention disclose RNA molecules capable of complexing with a nuclease (e.g., a CRISPR nuclease) to associate with a target genomic DNA sequence of interest proximal to a protospacer adjacent motif (PAM). The nuclease then mediates cleavage of the target DNA to generate a double-strand break within the protospacer sequence.

[0245] In an embodiment of the present invention, the CRISPR nuclease and the targeting molecule form a CRISPR complex that binds to the target DNA sequence to achieve cutting of the target DNA sequence. The CRISPR nuclease can form a CRISPR complex comprising the CRISPR nuclease and the RNA molecule without an additional separate tracrRNA molecule. Alternatively, the CRISPR nuclease can form a CRISPR complex between the CRISPR nuclease, the RNA molecule, and the tracrRNA molecule.

[0246] The term "protein binding sequence" or "nuclease binding sequence" refers to a sequence capable of binding to a CRISPR nuclease to form a CRISPR complex. A skilled artisan will understand that a tracrRNA capable of binding to a CRISPR nuclease to form a CRISPR complex comprises a protein binding sequence or a nuclease binding sequence.

[0247] The "RNA-binding portion" of a CRISPR nuclease refers to the portion of a CRISPR nuclease that can bind to an RNA molecule to form a CRISPR complex, such as the nuclease-binding sequence of a tracrRNA molecule. The "active portion" or "active portion" of a CRISPR nuclease refers to the portion of a CRISPR nuclease that, for example, when complexed with a DNA-targeting RNA molecule, effects a double-strand break in a DNA molecule.

[0248] The RNA molecule may comprise a sequence that is sufficiently complementary to the tracrRNA molecule so as to hybridize with the tracrRNA through base pairing and promote the formation of the CRISPR complex. (See U.S. Patent No. 8,906,616). In embodiments of the present invention, the RNA molecule may further comprise a portion having a tracr pairing sequence.

[0249] In embodiments of the present invention, the targeting molecule may further comprise the sequence of a tracrRNA molecule. These embodiments may be designed as a synthetic fusion of the guide portion (gRNA or crRNA) of the RNA molecule and a transactivating crRNA (tracrRNA), together forming a single-stranded guide RNA (sgRNA). (See Jinek et al., Science (2012)). Embodiments of the present invention may also utilize a separate tracrRNA molecule and a separate RNA molecule comprising a guide sequence portion to form a CRISPR complex. In such embodiments, the tracrRNA molecule may hybridize with the RNA molecule by base pairing, and may be advantageous in certain applications of the invention described herein.

[0250] In embodiments of the present invention, the RNA molecule may comprise a "nexus" region and / or a "hairpin" region, which may further define the structure of the RNA molecule (see Briner et al., Molecular Cell (2014)).

[0251] As used herein, the term "direct repeat sequence" refers to two or more repeats of a specific amino acid sequence or nucleotide sequence.

[0252] As used herein, an RNA sequence or molecule capable of "interacting" or "binding" to a CRISPR nuclease refers to an RNA sequence or molecule capable of forming a CRISPR complex with the CRISPR nuclease.

[0253] As used herein, the term "operably linked" refers to a relationship (i.e., fusion, hybridization) between two sequences or molecules that allows them to function in their intended manner. In embodiments of the present invention, when an RNA molecule is operably linked to a promoter, the RNA molecule and the promoter are allowed to function in their intended manner.

[0254] As used herein, the term "heterologous promoter" refers to a promoter that is not naturally present with the molecule or pathway being promoted.

[0255] As used herein, a sequence or molecule has X% "sequence identity" to another sequence or molecule if X% of the bases or amino acids between the molecular sequences are identical and in the same relative positions. For example, a first nucleotide sequence that has at least 95% sequence identity to a second nucleotide sequence will have at least 95% of the same bases in the same relative positions as the other sequence.

[0256] nuclear localization sequence

[0257] The terms "nuclear localization sequence" and "NLS" are used interchangeably to represent an amino acid sequence / peptide that instructs a protein associated therewith to be transported from the cytoplasm of a cell through the nuclear envelope barrier (nuclear envelope barrier). The term "NLS" not only includes the nuclear localization sequence of a specific peptide, but also includes derivatives thereof that can instruct cytoplasmic polypeptides to pass through the translocation of the nuclear envelope barrier. When connected to the N-terminus, C-terminus, or both the N- and C-termini of a polypeptide, NLS can instruct the nuclear translocation of a polypeptide. In addition, a polypeptide having an NLS coupled to an amino acid side chain randomly positioned along the amino acid sequence of a polypeptide by its N- or C-terminus will be translocated. Typically, NLS consists of one or more short sequences of positively charged lysine or arginine exposed on the protein surface, and other types of NLS are known. Non-limiting examples of NLSs include NLS sequences derived from SV40 virus large T antigen, nuclear plasmin, c-myc, hRNPAl M9 NLS, the IBB domain from importin-α, myoma T protein, human p53, mouse c-abl IV, influenza virus NS1, hepatitis virus delta antigen, mouse Mx1 protein, human poly (ADP-ribose) polymerase, and steroid hormone receptor (human) glucocorticoid.

[0258] deliver

[0259] The CRISPR nucleases or CRISPR compositions described herein can be delivered as proteins, DNA molecules, RNA molecules, ribonucleoproteins (RNPs), nucleic acid vectors, or any combination thereof. In some embodiments, the RNA molecules comprise chemical modifications. Non-limiting examples of suitable chemical modifications include 2'-O-methyl (M), 2'-O-methyl, 3' thiophosphate (MS) or 2'-O-methyl, 3' thioPACE (MSP), pseudouridine, and 1-methylpseudouridine. Each possibility represents a separate embodiment of the present invention.

[0260] The CRISPR nucleases described herein and / or polynucleotides encoding CRISPR nucleases, and optionally additional proteins (e.g., ZFPs, TALENs, transcription factors, restriction enzymes) and / or nucleotide molecules such as guide RNAs, can be delivered to target cells by any suitable means. The target cell can be any type of cell, such as a eukaryotic or prokaryotic cell, in any environment, such as isolated or unisolated, maintained in culture, in vitro, ex vivo, in vivo, or in plants.

[0261] In some embodiments, the composition to be delivered includes an mRNA for a nuclease and a guide RNA. In some embodiments, the composition to be delivered includes an mRNA for a nuclease, a guide RNA, and a donor template. In some embodiments, the composition to be delivered includes a CRISPR nuclease and a guide RNA. In some embodiments, the composition to be delivered includes a CRISPR nuclease, a guide RNA, and a donor template for gene editing via, for example, homology-directed repair. In some embodiments, the composition to be delivered comprises an mRNA for a nuclease, a DNA-targeting RNA, and a tracrRNA. In some embodiments, the composition to be delivered includes an mRNA for a nuclease, a DNA-targeting RNA and a tracrRNA, and a donor template. In some embodiments, the composition to be delivered includes a CRISPR nuclease, a DNA-targeting RNA and a tracrRNA. In some embodiments, the composition to be delivered includes a CRISPR nuclease, a DNA-targeting RNA and a tracrRNA, and a donor template.

[0262] Any suitable viral vector system can be used to deliver RNA compositions. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acid and / or CRISPR nuclease into cells (e.g., mammalian cells, plant cells, etc.) and target tissues. Such methods can also be used to administer the encoding nucleic acid and / or CRISPR nuclease protein to cells in vitro. In certain embodiments, nucleic acid and / or CRISPR nuclease are administered for in vivo or ex vivo gene therapy purposes. Non-viral vector delivery systems include naked nucleic acids and nucleic acids compounded with delivery vectors such as liposomes or poloxamer. For reviews of gene therapy approaches, see Anderson, Science (1992); Nabel and Felgner, TIBTECH (1993); Mitani and Caskey, TIBTECH (1993); Dillon, TIBTECH (1993); Miller, Nature (1992); Van Brunt, Biotechnology (1988); Vigne et al., Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer and Perricaudet, British Medical Bulletin (1995); Haddada et al., Current Topics in Microbiology and Immunology (1995); and Yu et al., Gene Therapy 1:13-26 (1994).

[0263] Non-viral delivery methods for nucleic acids and / or proteins include electroporation, lipofection, microinjection, biolistics, particle gun acceleration, virosomes, liposomes, immunoliposomes, lipid nanoparticles (LNPs), polycationic or lipid:nucleic acid conjugates, artificial virions, and agent-enhanced nucleic acid uptake, or can be delivered to plant cells via bacteria or viruses (e.g., Agrobacterium, Rhizobium sp. NGR234, Sinorhizobium meliloti, Mesorhizobium loti, tobacco mosaic virus, potato virus X, cauliflower mosaic virus, and cassava vein mosaic virus). See, e.g., Chung et al., Trends Plant Sci. (2006). Sonoporation, using, for example, the Sonitron 2000 system (Rich-Mar), can also be used to deliver nucleic acids. Cationic lipid-mediated delivery of proteins and / or nucleic acids is also considered for in vivo, ex vivo, or in vitro delivery methods. See Zuris et al., Nat. Biotechnol. (2015); Coelho et al., N. Engl. J. Med. (2013); Judge et al., Mol. Ther. (2006); and Basha et al., Mol. Ther. (2011).

[0264] Non-viral vectors (e.g., transposon-based systems, such as the recombinant Sleeping Beauty transposon system or the recombinant PiggyBac transposon system) can also be delivered to target cells and used to transpose the polynucleotide sequence of the composition molecule or the polynucleotide sequence encoding the composition molecule in the target cell.

[0265] Additional exemplary nucleic acid delivery systems include those consisting of Biosystems (Cologne, Germany), Maxcyte Corporation (Rockville, Maryland), BTX Molecular Delivery System (Holliston, Massachusetts) and those provided by Copernicus Therapeutics (see, e.g., U.S. Patent No. 6,008,336). Lipofection is described in, e.g., U.S. Patent No. 5,049,386, U.S. Patent No. 4,946,787; and U.S. Patent No. 4,897,355) and lipofection reagents are sold commercially (e.g., Transfectam.TM., Lipofectin.TM. and Lipofectamine.TM. RNAiMAX). Cationic and neutral lipids suitable for efficient receptor recognition lipofection of polynucleotides include those disclosed in PCT International Publication Nos. WO / 1991 / 017424 and WO / 1991 / 016024. Delivery can be performed to cells (ex vivo) or target tissues (in vivo).

[0266] Preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipisomes, is well known to those skilled in the art (see, e.g., Crystal, Science (1995); Blaese et al., Cancer Gene Ther. (1995); Behr et al., Bioconjugate Chem. (1994); Remy et al., Bioconjugate Chem. (1994); Gao and Huang, Gene Therapy (1995); Ahmad and Allen, Cancer Res., (1992); U.S. Pat. Nos. 4,186,183; 4,217,344; 4,235,871; 4,261,975; 4,485,054; 4,501,728; 4,774,085; 4,837,028; and 4,946,787).

[0267] Other delivery methods include packaging the nucleic acid to be delivered into EnGeneIC delivery vectors (EDVs). These EDVs are specifically delivered to target tissues using bispecific antibodies, where one arm of the antibody is specific for the target tissue and the other arm is specific for the EDV. The antibody brings the EDV to the surface of the target cell and then brings the EDV into the cell through endocytosis. Once inside the cell, the contents are released (see, MacDiamid et al., Nature Biotechnology (2009)).

[0268] Delivery vehicles include, but are not limited to, bacteria, preferably non-pathogenic; vectors, nanoparticles, exosomes, microvesicles, gene gun delivery, for example, by attaching the composition to gold particles and injecting the gold particles into cells using a "gene gun"; viral vectors, including but not limited to lentivirus, AAV and retrovirus, virus-like particles (VLP), large VLP (LVLP), lentivirus-like particles, transposons, viral vectors, naked vectors, DNA or RNA, and other delivery vehicles known in the art.

[0269] Delivery of CRISPR nucleases and / or polynucleotides encoding CRISPR nucleases and optional additional nucleotide molecules and / or additional proteins or peptides can be performed using a single delivery vehicle or method or a combination of different delivery vehicles or methods. For example, CRISPR nucleases can be delivered to cells using LNPs, and crRNA molecules and tracrRNA molecules can be delivered to cells using AAVs. Alternatively, CRISPR nucleases can be delivered to cells using AAV particles, and crRNA molecules and tracrRNA molecules can be delivered to cells using separate AAV particles, which may be advantageous due to size limitations.

[0270] The use of RNA or DNA virus-based systems to deliver nucleic acids utilizes a highly evolved process of targeting viruses to specific cells in the body and transporting viral payloads to the nucleus. Viral vectors can be directly administered to patients (in vivo), or they can be used to treat cells in vitro, and the modified cells are administered to patients (ex vivo). Conventional viral-based systems for delivering nucleic acids include, but are not limited to, recombinant retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, vaccinia, and herpes simplex virus vectors for gene transfer. However, RNA viruses are preferably used to deliver RNA compositions described herein. In addition, high transduction efficiencies have been observed in many different cell types and target tissues. The nucleic acids of the present invention can be delivered by non-integrating lentiviruses. Optionally, lentiviruses are used to deliver RNA. Optionally, the lentivirus includes mRNA for a nuclease, a guide RNA. Optionally, the lentivirus includes mRNA for a nuclease, a guide RNA, and a donor template. Optionally, the lentivirus includes a nuclease protein, a guide RNA. Optionally, the lentivirus comprises a nuclease protein, a guide RNA, and / or a donor template for gene editing via, for example, homology-directed repair. Optionally, the lentivirus comprises an mRNA for the nuclease, an RNA targeting DNA, and a tracrRNA. Optionally, the lentivirus comprises an mRNA for the nuclease, an RNA targeting DNA, and a tracrRNA, and a donor template. Optionally, the lentivirus comprises a nuclease protein, an RNA targeting DNA, and a tracrRNA. Optionally, the lentivirus comprises a nuclease protein, an RNA targeting DNA, and a tracrRNA, and a donor template for gene editing via, for example, homology-directed repair.

[0271] As described above, the compositions described herein may be administered using a non-integrating lentiviral particle approach, e.g. The system is delivered to the target cell. This method can be used to deliver mRNA or other types of RNA to the target cell, so that delivery of the RNA to the target cell results in assembly of the composition described herein within the target cell. See also PCT International Publication Nos. WO2013 / 014537, WO2014 / 016690, WO2016185125, WO2017194902, and WO2017194903.

[0272] The tropism of retroviruses can be altered by incorporating exogenous envelope proteins, thereby expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells and generally produce high viral titers. The choice of retroviral gene transfer system depends on the target tissue. Retroviral vectors are composed of cis-acting long terminal repeats (LTRs) and have a packaging capacity of up to 6-10 kb of exogenous sequence. The minimal cis-acting LTR is sufficient to replicate and package the vector, which is then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those systems based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher Panganiban, J. Virol. (1992); Johann et al., J. Virol. (1992); Sommerfelt et al., Virol. (1990); Wilson et al., J. Virol. (1989); Miller et al., J. Virol. (1991); PCT International Publication No. WO / 1994 / 026877A1).

[0273] Currently, at least six viral vector approaches are available for gene transfer in clinical trials, utilizing methods that involve complementing defective vectors by inserting genes into helper cell lines to produce the transducing agent.

[0274] pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (Dunbar et al., Blood (1995); Kohn et al., Nat. Med. (1995); Malech et al., PNAS (1997)). PA317 / pLASN was the first therapeutic vector used in gene therapy trials (Blaese et al., Science (1995)). Transduction efficiencies of 50% or greater have been observed with MFG-S-packaged vectors (Ellem et al., Immunol. Immunother. (1997); Dranoff et al., Hum. Gene Ther. (1997)).

[0275] Packaging cells are used to form viral particles capable of infecting host cells. Such cells include 293 cells that package adenoviruses and AAVs and psi.2 cells or PA317 cells that package retroviruses. Viral vectors used for gene therapy are typically generated by production cell lines that package nucleic acid vectors into viral particles. The vector typically contains the minimum viral sequences required for packaging and subsequent integration into the host (if applicable), with other viral sequences replaced by expression cassettes encoding the protein to be expressed. The missing viral functions are provided in trans by the packaging cell line. For example, AAV vectors used for gene therapy typically only have inverted terminal repeat (ITR) sequences from the AAV genome, which are essential for packaging and integration into the host genome. The viral DNA is packaged in a cell line that contains a helper plasmid that encodes other AAV genes (i.e., rep and cap) but lacks ITR sequences. The cell line is also infected with adenovirus as a helper virus. The helper virus promotes the replication of the AAV vector and the expression of the AAV genes in the helper plasmid. Due to the lack of ITR sequences, the helper plasmid cannot be packaged in large quantities. Adenovirus contamination can be reduced, for example, by heat treatment, to which adenovirus is more sensitive than AAV. Additionally, AAV can be produced on a clinical scale using a baculovirus system (see, U.S. Patent No. 7,479,554).

[0276] In many gene therapy applications, it is desirable that gene therapy vectors are delivered to specific tissue types with a high degree of specificity. Therefore, it is possible to modify the ligand by expressing it as a fusion protein with the viral coat protein on the outer surface of the virus so that it is specific to a given cell type. Select a ligand with affinity for the receptor known to be present on the target cell type. For example, Han et al., Proc. Natl. Acad. Sci. USA (1995), reported that Moloney's murine leukemia virus can be modified to express heregulin fused to gp70, and that recombinant viruses infect certain human breast cancer cells expressing human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs, wherein the target cell expresses receptors, and the virus expresses a fusion protein comprising a ligand for a cell surface receptor. For example, filamentous phage can be engineered to display an antibody fragment (such as FAB or Fv) with specific binding affinity to almost any selected cell receptor. Although the above description is mainly applied to viral vectors, the same principle can be applied to non-viral vectors. Such vectors can be engineered to contain specific uptake sequences that facilitate uptake by specific target cells.

[0277] Gene therapy vectors can be delivered in vivo by being administered to individual patients, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial infusion) or topical administration, as described below. Alternatively, vectors can be delivered ex vivo to cells, such as cells (e.g., lymphocytes, bone marrow aspirates, biopsies) or universal donor hematopoietic stem cells taken out from individual patients, and then typically, after selecting the cells into which the vector has been incorporated, the cells are reimplanted in the patient. In some embodiments, mRNA can be delivered in vivo and ex vivo as well as RNP.

[0278] Ex vivo cell transfection for diagnosis, research, or gene therapy (e.g., by reinfusion of the transfected cells into a host organism) is well known to those skilled in the art. In a preferred embodiment, cells are isolated from a subject organism, transfected with an RNA composition, and reinfused back into the subject organism (e.g., a patient). Various cell types suitable for ex vivo transfection are well known to those skilled in the art (see, e.g., Freshney, "Culture of Animal Cells, A Manual of Basic Technique and Specialized Applications" (6th ed., 2010) and the references cited therein for discussions of how to isolate and culture cells from patients).

[0279] Suitable cells include, but are not limited to, eukaryotic and prokaryotic cells and / or cell lines. Non-limiting examples of such cells or cell lines generated by such cells include COS, CHO (e.g., CHO-S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NSO, SP2 / 0-Ag14, HeLa, HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T), and perC6 cells, any plant cell (differentiated or undifferentiated), and insect cells such as Spodoptera fugiperda (Sf), or fungal cells such as Saccharomyces, Pichia, and Schizosaccharomyces. In certain embodiments, the cell line is a CHO-K1, MDCK or HEK293 cell line. In addition, primary cells can be separated and used in vitro for introduction into an individual to be treated after treatment with a nuclease (e.g., ZFN or TALEN) or a nuclease system (e.g., CRISPR). Suitable primary cells include peripheral blood mononuclear cells (PBMCs) and other blood cell subsets, such as, but not limited to, CD4+ T cells or CD8+ T cells. Suitable cells also include stem cells, such as embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells (CD34+), neuronal stem cells, and mesenchymal stem cells.

[0280] In one embodiment, stem cells are used for cell transfection and gene therapy in ex vivo methods. The advantage of using stem cells is that they can be differentiated into other cell types in vitro or can be introduced into a mammal (e.g., a cell donor) where they will be engrafted into the bone marrow. Methods for using cytokines such as GM-CSF, IFN-γ, and TNF-α to differentiate CD34+ cells in vitro into clinically important immune cell types are known (as a non-limiting example, see, Inaba et al., J. Exp. Med. (1992)).

[0281] Stem cells are isolated using known methods for transduction and differentiation. For example, stem cells are isolated from bone marrow cells by panning bone marrow cells with antibodies that bind to unwanted cells, such as CD4+ and CD8+ (T cells), CD45+ (panB cells), GR-1 (granulocytes), and Iad (differentiated antigen-presenting cells) (as a non-limiting example, see, Inaba et al., J. Exp. Med. (1992)). In some embodiments, modified stem cells can also be used.

[0282] It is noteworthy that any of the CRISPR nucleases described herein can be applied to genome editing of post-mitotic cells or any cells that are not actively dividing, such as arrested cells. Examples of post-mitotic cells that can be edited using the CRISPR nucleases of the present invention include, but are not limited to, muscle cells, cardiomyocytes, hepatocytes, bone cells, and neurons.

[0283] The carrier (for example, retrovirus, liposome etc.) containing therapeutic RNA compositions can also be directly administered to organism for in vivo cell transduction. Alternatively, naked RNA or mRNA can be administered. By being generally used for introducing any approach that molecule is finally contacted with blood or tissue cells, administer, described approach includes but is not limited to injection, infusion, topical application and electroporation. The suitable method of administering this type of nucleic acid is obtainable and well known to those skilled in the art, and although more than one approach can be used to administer a particular composition, a particular approach can usually provide a more direct and more effective reaction than another approach.

[0284] Vectors suitable for introducing transgenes into immune cells (eg, T cells) include non-integrating lentiviral vectors. See, for example, US Patent Publication No. 2009 / 0117617.

[0285] Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as the particular method used to administer the composition. Thus, as described below, there are a variety of suitable pharmaceutical composition formulations available for use (see, e.g., Remington's Pharmaceutical Sciences, 17th edition, 1989).

[0286] DNA repair by homologous recombination

[0287] The term "homologous directed repair" or "HDR" refers to a mechanism for repairing DNA damage in cells, for example, during the repair of double-stranded and single-stranded breaks in DNA. HDR requires nucleotide sequence homology and uses a "nucleic acid template" (nucleic acid template or donor template are used interchangeably herein) to repair a sequence (e.g., a DNA target sequence) in which a double-stranded or single-stranded break has occurred. This results in the transfer of genetic information from, for example, a nucleic acid template to a DNA target sequence. If the nucleic acid template sequence is different from the DNA target sequence, and part or all of the nucleic acid template polynucleotide or oligonucleotide is incorporated into the DNA target sequence, HDR can result in alterations (e.g., insertions, deletions, mutations) in the DNA target sequence. In some embodiments, a complete nucleic acid template polynucleotide, a portion of a nucleic acid template polynucleotide, or a copy of the nucleic acid template is integrated at the site of the DNA target sequence.

[0288] The terms "nucleic acid template" and "donor" refer to a nucleotide sequence that is inserted or copied into a genome. A nucleic acid template comprises a nucleotide sequence of, for example, one or more nucleotides that will be added to a target nucleic acid or that will be used as a template to change the target nucleic acid, or that can be used to modify a target sequence. A nucleic acid template sequence can be any length, for example, a length between 2 and 10,000 nucleotides (or any integer value therebetween or above), preferably a length between about 100 and 1,000 nucleotides (or any integer therebetween), more preferably a length between about 200 and 500 nucleotides. A nucleic acid template can be a single-stranded nucleic acid or a double-stranded nucleic acid. In some embodiments, a nucleic acid template comprises a nucleotide sequence, for example, a nucleotide sequence of one or more nucleotides that corresponds to the wild-type sequence of the target nucleic acid at, for example, the target position. In some embodiments, a nucleic acid template comprises a ribonucleotide sequence, for example, a ribonucleotide sequence of one or more ribonucleotides that corresponds to the wild-type sequence of the target nucleic acid at, for example, the target position. In some embodiments, a nucleic acid template comprises modified ribonucleotides.

[0289] Insertion of exogenous sequences (also referred to as "donor sequences", "donor templates" or "donors") can also be performed, for example, for correction of mutant genes or for increasing expression of wild-type genes. It will be apparent that donor sequences are generally not identical to the genomic sequences in which they are located. Donor sequences can contain non-homologous sequences that are flanked by two regions of homology to allow for efficient HDR at the target location. Additionally, donor sequences can comprise vector molecules containing sequences that are not homologous to the target region in the cellular chromatin. Donor molecules can contain several discontinuous regions that are homologous to the cellular chromatin. For example, in order to target the insertion of sequences that are not normally present in the target region, the sequences can be present in the donor nucleic acid molecule and flanked by regions that are homologous to sequences in the target region.

[0290] Donor polynucleotides can be single-stranded and / or double-stranded DNA or RNA and can be introduced into cells in linear or circular form. See, for example, U.S. Patent Publication Nos. 2010 / 0047805; 2011 / 0281361; 2011 / 0207221; and 2019 / 0330620. If introduced in linear form, the end of the donor sequence can be protected (for example, from exonucleolytic degradation) by methods known to those skilled in the art. For example, one or more dideoxynucleotide residues are added to the 3' end of the linear molecule and / or a self-complementary oligonucleotide is connected to one or both ends. See, for example, Chang and Wilson, Proc. Natl. Acad. Sci. USA (1987); Nehls et al., Science (1996). Other methods for protecting exogenous polynucleotides from degradation include, but are not limited to, adding terminal amino groups and using modified internucleotide bonds, such as phosphorothioate, phosphoramidate, and O-methyl ribose or deoxyribose residues.

[0291] Thus, embodiments of the present invention that use donor templates for repair can use DNA or RNA, single-stranded and / or double-stranded donor templates, which can be introduced into cells in linear or circular form. In embodiments of the present invention, a gene editing composition comprises: (1) an RNA molecule comprising a guide sequence that affects a double-strand break in a gene before repair and (2) a donor RNA template for repair, the RNA molecule comprising the guide sequence being a first RNA molecule and the donor RNA template being a second RNA molecule. In some embodiments, the guide RNA molecule and the template RNA molecule are joined as part of a single molecule.

[0292] Donor sequences can also be oligonucleotides and used for gene correction or targeted alteration of endogenous sequences. Oligonucleotides can be introduced into cells on a vector, can be electroporated into cells, or can be introduced by other methods known in the art. Oligonucleotides can be used to "correct" mutant sequences in endogenous genes (e.g., sickle cell mutations in beta globin), or can be used to insert sequences with a desired purpose into an endogenous locus.

[0293] The polynucleotide can be introduced into the cell as part of a vector molecule with additional sequences (e.g., origin of replication, promoter, and genes encoding antibiotic resistance). In addition, the donor polynucleotide can be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as liposomes or poloxamers, or can be delivered by recombinant viruses (e.g., adenovirus, AAV, herpes virus, retrovirus, lentivirus, and integrase-deficient lentivirus (IDLV)).

[0294] Typically the donor is inserted such that its expression is driven by an endogenous promoter at the integration site, i.e., a promoter driving expression of the endogenous gene into which the donor is inserted. However, it will be apparent that the donor may comprise a promoter and / or enhancer, such as a constitutive promoter or an inducible or tissue-specific promoter.

[0295] The donor molecule can be inserted into the endogenous gene so that all, some or all of the endogenous genes are expressed or not expressed. For example, the transgenics described herein can be inserted into the endogenous locus so that some of the endogenous sequences (the N-terminus and / or C-terminus of the transgenic) are expressed, for example, as a fusion with the transgenic or not expressed. In other embodiments, the transgenic (e.g., with or without additional coding sequences such as endogenous genes) is integrated into any endogenous locus, such as a safe harbor locus, for example, a CCR5 gene, a CXCR4 gene, a PPP1R12c (also known as AAVS1) gene, an albumin gene, or a Rosa gene. (See, e.g., U.S. Patent Nos. 7,951,925 and 8,110,379; U.S. Publication Nos. 2008 / 0159996; 20100 / 0218264; 2010 / 0291048; 2012 / 0017290; 2011 / 0265198; 2013 / 0137104; 2013 / 0122591; 2013 / 0177983 and 2013 / 0177960 and U.S. Provisional Application No. 61 / 823,689).

[0296] When an endogenous sequence (an endogenous sequence of a transgenic gene or a portion thereof) is expressed with a transgenic gene, the endogenous sequence can be a full-length sequence (wild type or mutant) or a partial sequence. Preferably, the endogenous sequence is functional. Non-limiting examples of the functions of these full-length or partial sequences include increasing the serum half-life of a polypeptide expressed by the transgenic gene (e.g., a therapeutic gene) and / or acting as a carrier.

[0297] Additionally, although not required for expression, the exogenous sequences may also include transcriptional or translational regulatory sequences, such as promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides and / or polyadenylation signals.

[0298] In certain embodiments, the donor molecule comprises a sequence selected from the group consisting of a gene encoding a protein (e.g., a coding sequence encoding a protein that is deficient in the cell or individual or an alternative form of a gene encoding a protein), a regulatory sequence, and / or a sequence encoding a structural nucleic acid such as a microRNA or siRNA.

[0299] For the aforementioned embodiments, each embodiment disclosed herein is considered applicable to each other disclosed embodiment.For example, it should be understood that any RNA molecule or composition of the invention can be used in any method of the invention.

[0300] As used herein, all headings are for organizational purposes only and are not intended to limit the disclosure in any way. The contents of any individual section may apply equally to all sections.

[0301] Other objects, advantages and novel features of the present invention will become apparent to those skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as described above and claimed herein are experimentally supported in the following examples.

[0302] It should be understood that, for the sake of clarity, certain features of the present invention described in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, for the sake of brevity, various features of the present invention described in the context of a single embodiment may also be provided individually or in any suitable subcombination or as appropriate in any other described embodiment of the present invention. Certain features described in the context of various embodiments should not be considered essential features of those embodiments unless the embodiment will not function without those elements.

[0303] In general, the nomenclature used herein and the laboratory methods used in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. These techniques are fully explained in the literature. See, for example, Sambrook et al., "Molecular Cloning: A laboratory Manual" (1989); Ausubel, RM (ed.), "Current Protocols in Molecular Biology" Volumes I-III (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (ed.), "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New New York (1998); as described in U.S. Patent Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cellis, JE (ed.), "Cell Biology: A Laboratory Handbook", Volumes I-III (1994); Freshney, "Culture of Animal Cells - A Manual of Basic Technique" Third Edition, Wiley-Liss, NY (1994); Coligan JE (ed.), "Current Protocols in Immunology" Volumes I-III (1994); Stites et al. (eds.), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds.), "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); Clokie and Kropinski (eds.), "Bacteriophage Methods and Protocols", Volume 1: Isolation, Characterization, and Interactions (2009), all of which are incorporated herein by reference. Other general references are provided herein.

[0304] Provide examples below to facilitate a more complete understanding of the present invention. The following examples illustrate exemplary modes for making and implementing the present invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples, which are intended to illustrate the present invention.

[0305] Experimental details

[0306] Provide examples below to facilitate a more complete understanding of the present invention. The following examples illustrate exemplary modes for making and implementing the present invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples, which are intended to illustrate the present invention.

[0307] Example: OMNI-335 CRISPR Nuclease

[0308] CRISPR repeat (crRNA), transactivating RNA (tracrRNA), nuclease polypeptide (OMNI), and protospacer adjacent motif (PAM) sequences were predicted from a metagenomic database of environmental sample sequences.

[0309] Construction of OMNI-335 nuclease polypeptide

[0310] To construct novel OMNI-335 nuclease polypeptides, the open reading frame of OMNI-335 nuclease was codon-optimized for expression in human cell lines. The ORF was cloned into the bacterial expression plasmid pET9a (Table 4).

[0311] sgRNA prediction and construction

[0312] The OMNI-335 single-stranded guide RNA (sgRNA) was predicted by examining the CRISPR repeat array sequences and tracrRNA in the corresponding bacterial genome. The natural premature crRNA and tracrRNA sequences were linked in silico to a tetraloop 'gaaa' sequence, and the secondary structural elements of the duplex were predicted using RNA secondary structure prediction tools.

[0313] The secondary structure of the predicted full double-stranded RNA element (crRNA-tracrRNA chimera) is used to identify possible tracrRNA sequences to design sgRNA. In order to overcome potential transcription and structural limitations and evaluate the plasticity of sgRNA scaffolds in the context of human cell environment, in some cases small changes were made to the nucleotide sequence of sgRNA design (Table 2, referred to as "v2"). Finally, up to two designed scaffolds were synthesized for OMNI-335, connected downstream to a universal unique spacer sequence of 22 nucleotides (T2, SEQ ID NO: 30), and cloned into a bacterial expression plasmid (pShuttleGuide, Table 4) under an inducible T7 promoter combined with a U6 promoter for mammalian expression.

[0314] T2–GGAAGAGCAGAGCCUUGGUCUC(SEQ ID NO:30)

[0315] In vitro depletion assay by TXTL

[0316] According to Maxwell et al., Methods.2018, PAM sequences are consumed in vitro. In brief, linear DNA expressing OMNI nuclease and sgRNA under the T7 promoter are added to a cell-free transcription-translation in vitro system (TXTL mix, Arbor Bioscience) together with a linear construct expressing T7 polymerase. RNA expression and protein translation of the TXTL mixture lead to the formation of a ribonucleoprotein (RNP) complex. Due to the use of linear DNA, the Chi6DNA sequence is added to the TXTL reaction mixture to inhibit the exonuclease activity of RecBCD, thereby protecting the linear DNA from degradation. The sgRNA spacer sequence is designed to target a plasmid library (pbPOS T2 library, Table 4) containing a pre-target spacer sequence, which is flanked by 8N randomized potential PAM sequence groups. The consumption of the PAM sequence from the library is measured by high-throughput sequencing using PCR to add the necessary linkers and indexes to the cut library and the control library expressing non-target gRNA. After deep sequencing, in vitro activity was confirmed by the fraction of depleted sequence relative to a control with the same PAM sequence, indicating cleavage of functional DNA by the OMNI nuclease (Table 3).

[0317] Table 1 - OMNI CRISPR nuclease sequences

[0318]

[0319] Table 1. OMNI nuclease sequences: Table 1 lists the OMNI name, its corresponding nuclease protein sequence, its DNA sequence, its human optimized DNA sequence, alternative positions to be substituted to generate a nickase with an inactivated RuvC domain, alternative positions to be substituted to generate a nickase with an inactivated HNH domain, and alternative positions to be substituted to generate a catalytically inactive nuclease with inactivated RuvC and HNH domains. For each amino acid position shown in columns 5-7, substitutions with any other amino acid are allowed unless followed by an asterisk, which indicates that any substitution other than aspartic acid (D) to glutamic acid (E) or glutamic acid (E) to aspartic acid (D) results in inactivation.

[0320] Supplementary Table 1 – OMNI-335 Domain Structure

[0321]

[0322] Supplementary Table 1. OMNI Domains: The amino acid ranges for each defined domain of the OMNI CRISPR nucleases are listed in Supplementary Table 1. For example, domain G of OMNI-335 is defined as amino acids 683-735 of SEQ ID NO: 1. The listed amino acid ranges are based on a preferred analysis of local alignments generated using the Smith-Waterman algorithm; however, the start or end of each domain range may be increased or decreased by up to five amino acids.

[0323] Table 2 – OMNI-335 crRNA, tracrRNA, and sgRNA scaffold sequences

[0324]

[0325]

[0326] Table 3 - OMNI PAM sequences showing activity of each sgRNA tested

[0327]

[0328] *Depletion score - average of the ratios from the two most depleted sites

[0329] Table 4 - Plasmids and constructs

[0330]

[0331]

[0332] Table 4 Appendix - Details of construct elements

[0333] element Protein sequence DNA sequence HA tag SEQ ID NO:26 SEQ ID NO:28 NLS SEQ ID NO:27 SEQ ID NO:29

[0334] References

[0335] 1. Ahmad and Allen (1992) “Antibody-mediated Specific Binging and Cytotoxicity of Lipsome-entrapped Doxorubicin to Lung Cancer Cells in Vitro”, Cancer Research 52:4817-20.

[0336] 2. Anderson (1992) “Human gene therapy”, Science 256:808-13.

[0337] 3. Basha et al. (2011) “Influence of Cationic Lipid Composition on Gene Silencing Properties of Lipid Nanoparticle Formulations of siRNA in Antigen-Presenting Cells”, Mol. Ther. 19(12):2186-200.

[0338] 4. Behr (1994) “Gene transfer with synthetic cationic amphiphiles: Prospects for gene therapy”, Bioconjuage Chem 5:382-89.

[0339] 5. Blaese et al. (1995) “Vectors in cancer therapy: how will they deliver”, Cancer Gene Ther. 2:291-97.

[0340] 6. Blaese et al. (1995) “T lympocyte-directed gene therapy for ADA-SCID: initial trial results after 4 years”, Science 270(5235):475-80.

[0341] 7. Briner et al. (2014) “Guide RNA functional modules direct Cas9 activity and orthognality”, Molecular Cell 56:333-39.

[0342] 8. Buchschacher and Panganiban (1992) “Human immunodeficiency virus vectors for inducible expression of foreign genes”, J. Virol. 66:2731-39.

[0343] 9. Burstein et al. (2017) “New CRISPR-Cas systems from uncultivated microbes”, Nature 542:237-41.

[0344] 10. Canver et al., (2015) "BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis", Nature Vol.527, Pgs.192-214.

[0345] 11. Chang and Wilson (1987) “Modification of DNA ends can decrease end-joining relative to homologous recombination in mammalian cells”, Proc. Natl. Acad. Sci. USA 84:4959-4963.

[0346] 12. Charlesworth et al. (2019) “Identification of preexisting adaptive immunity to Cas9 proteins in humans”, Nature Medicine, 25(2), 249.

[0347] 13. Chung et al. (2006) “Agrobacterium is not alone: gene transfer to plants by viruses and other bacteria”, Trends Plant Sci. 11(1):1-4.

[0348] 14. Coelho et al. (2013) “Safety and efficacy of RNAi therapy for transthyretin amyloidosis” N. Engl. J. Med. 369, 819 - 829.

[0349] 15. Crystal (1995) “Transfer of genes to humans: early lessons and obstacles to success”, Science 270(5235): 404 - 10.

[0350] 16. Dillon (1993) “Regulation gene expression in gene therapy” Trends in Biotechnology 11(5): 167 - 173.

[0351] 17. Dranoff et al. (1997) “A phase I study of vaccination with autologous, irradiated melanoma cells engineered to secrete human granulocyte macrophage colony stimulating factor”, Hum. Gene Ther. 8(1): 111 - 23.

[0352] 18. Dunbar et al. (1995) “Retrovirally marked CD34 - enriched peripheral blood and bone marrow cells contribute to long - term engraftment after autologous transplantation”, Blood 85: 3048 - 57.

[0353] 19. Ellem et al. (1997) “A case report: immune responses and clinical course of the first human use of ganulocyte / macrophage - colony - stimulating - factor - tranduced autologous melanoma cells for immunotherapy”, Cancer Immunol Immunother 44:10 - 20.

[0354] 20. Gao and Huang (1995) “Cationic liposome - mediated gene transfer” Gene Ther.2(10):710 - 22.

[0355] 21. Haddada et al. (1995) “Gene Therapy Using Adenovirus Vectors”, in: The Molecular Repertoire of Adenoviruses III: Biology and Pathogenesis, ed. Doerfler and pp.297 - 306.

[0356] 22. Han et al. (1995) “Ligand - directed retro - viral targeting of human breast cancer cells”, Proc. Natl. Acad. Sci. USA 92(21):9747 - 51.

[0357] 23. Humbert et al.,(2019) "Therapeutically relevant engraftment of a CRISPR - Cas9–edited HSC - enriched population with HbF reactivation in nonhuman primates", Sci. Trans. Med., Vol.11, Pgs.1 - 13.

[0358] 24. Inaba et al. (1992) “Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte / macrophage colony-stimulating factor”, J Exp Med. 176(6):1693-702.

[0359] 25. Jiang and Doudna (2017) “CRISPR-Cas9 Structures and Mechanisms”, Annual Review of Biophysics 46:505-29.

[0360] 26. Jinek et al. (2012) “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity”, Science 337(6096):816-21.

[0361] 27. Johan et al. (1992) “GLVR1, a receptor for gibbon ape leukemia virus, is homologous to a phosphate permease of Neurospora crassa and is expressed at high levels in the brain and thymus”, J Virol 66(3):1635-40.

[0362] 28. Judge et al. (2006) “Design of noninflammatory synthetic siRNA mediating potent gene silencing in vivo”, Mol Ther. 13(3):494-505.

[0363] 29. Kohn et al. (1995) “Engraftment of gene - modified umbilical cord blood cells in neonates with adenosine deaminase deficiency”, Nature Medicine 1:1017 - 23.

[0364] 30. Kremer and Perricaudet (1995) “Adenovirus and adeno - associated virus mediated gene transfer”, Br. Med. Bull. 51(1):31 - 44.

[0365] 31. Macdiarmid et al. (2009) “Sequential treatment of drug - resistant tumors with targeted minicells containing siRNA or a cytotoxic drug”, Nat Biotechnol. 27(7):643 - 51.

[0366] 32. Malech et al. (1997) “Prolonged production of NADPH oxidase - corrected granulocytes after gene therapy of chronic granulomatous disease”, PNAS 94(22):12133 - 38.

[0367] 33. Maxwell et al. (2018) “A detailed cell - free transcription - translation - based assay to decipher CRISPR protospacer adjacent motifs”, Methods 14348 - 57

[0368] 34. Miller et al. (1991) “Construction and properties of retrovirus packaging cells based on gibbon ape leukemia virus”, J Virol. 65(5):2220 - 24.

[0369] 35. Miller (1992) “Human gene therapy comes of age”, Nature 357:455 - 60.

[0370] 36. Mir et al. (2019) “Type II-C CRISPR-Cas9 Biology, Mechanism and Application”, ACS Chem. Biol. 13(2):357 - 365.

[0371] 37. Mitani and Caskey (1993) “Delivering therapeutic genes – matching approach and application”, Trends in Biotechnology 11(5):162 - 66.

[0372] 38. Nabel and Felgner (1993) “Direct gene transfer for immunotherapy and immunization”, Trends in Biotechnology 11(5):211 - 15.

[0373] 39. Nehls et al. (1996) “Two genetically separable steps in the differentiation of thymic epithelium” Science 272:886 - 889.

[0374] 40. Nishimasu et al. “Crystal structure of Cas9 in complex with guide RNA and target DNA” (2014) Cell 156(5):935 - 49.

[0375] 41. Nishimasu et al. (2015) “Crystal Structure of Staphylococcus aureus Cas9” Cell 162(5):1113 - 26.

[0376] 42. Palermo et al. (2018) “Key role of the REC lobe during CRISPR-Cas9 activation by ‘sensing’, ‘regulating’, and ‘locking’ the catalytic HNH domain” Quarterly Reviews of Biophysics 51, e9, 1-11.

[0377] 43. Remy et al. (1994) “Gene Transfer with a Series of Lipphilic DNA-Binding Molecules”, Bioconjugate Chem. 5(6):647-54.

[0378] 44. Sentmanat et al. (2018) “A Survey of Validation Strategies for CRISPR-Cas9 Editing”, Scientific Reports 8:888, doi:10.1038 / s41598-018-19441-8.

[0379] 45. Sommerfelt et al. (1990) “Localization of the receptor gene for type D simian retroviruses on human chromosome 19”, J. Virol. 64(12):6214-20.

[0380] 46. Van Brunt (1988) “Molecular framing: transgenic animals as bioactors” Biotechnology 6:1149-54.

[0381] 47. Vigne et al. (1995) “Third-generation adenovectors for gene therapy”, Restorative Neurology and Neuroscience 8(1,2):35-36.

[0382] 48. Wagner et al. (2019) “High prevalence of Streptococcus pyogenes Cas9-reactive T cells within the adult human population” Nature Medicine, 25(2), 242

[0383] 49. Wilson et al. (1989) “Formation of infectious hybrid virion with gibbon ape leukemia virus and human T-cell leukemia virus retroviral envelope glycoproteins and the gag and pol proteins of Moloney murine leukemia virus”, J. Virol. 63:2374-78.

[0384] 50. Yu et al. (1994) “Progress towards gene therapy for HIV infection”, Gene Ther. 1(1):13-26.

[0385] 51. Zetsche et al. (2015) “Cpf1 is a single RNA-guided endonuclease of a class 2 CRIPSR-Cas system” Cell 163(3):759-71.

[0386] 52. Zuris et al. (2015) “Cationic lipid-mediated delivery of proteins enables efficient protein based genome editing in vitro and in vivo” Nat Biotechnol. 33(1):73-80.

Claims

1. A non-naturally occurring composition comprising: a CRISPR nuclease comprising a sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 1; or a nucleic acid molecule comprising a sequence encoding the CRISPR nuclease.

2. The composition of claim 1 , further comprising one or more RNA molecules, or a DNA polynucleotide encoding any of the one or more RNA molecules, wherein the one or more RNA molecules and the CRISPR nuclease are not naturally present together, and the one or more RNA molecules are configured to form a complex with the CRISPR nuclease and / or to target the complex to a target site.

3. The composition of claim 2, wherein the CRISPR nuclease comprises a sequence at least 90% identical to the amino acid sequence shown in SEQ ID NO: 1, and the at least one RNA molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 4-22.

4. The composition of claim 3, wherein the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 1, and the at least one RNA molecule is a CRISPR RNA (crRNA) molecule comprising a guide sequence portion and a sequence selected from SEQ ID NOs: 5-8.

5. The composition of claim 4, further comprising a trans-activating CRISPR RNA (tracrRNA) molecule comprising the sequences shown in SEQ ID NOs: 9-19, 21 and 22.

6. The composition of claim 2, wherein the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 1, and at least one RNA molecule is a single-stranded guide RNA (sgRNA) molecule comprising a guide sequence portion and a sequence selected from SEQ ID NOs: 4-22.

7. The composition of any one of claims 1 to 6, wherein the CRISPR nuclease is a nickase generated by amino acid substitution at position D10, E733, H949 or D952.

8. The composition of any one of claims 1 to 6, wherein the CRISPR nuclease is a nickase generated by amino acid substitution at position D817, H818, or N841.

9. The composition of any one of claims 1 to 6, wherein the CRISPR nuclease is a catalytically inactive nuclease produced by an amino acid substitution at any one of positions D10, E733, H949, or D952, and an amino acid substitution at any one of positions D817, H818, or N841.

10. A non-naturally occurring composition comprising a CRISPR nuclease, wherein the CRISPR nuclease comprises an amino acid sequence corresponding to the amino acid sequence of at least one of domain A, domain B, domain C, domain D, domain E, domain F, domain G, domain H, domain I, or domain J of SEQ ID NO: 1, a) wherein domain A comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to amino acids 1-43 of SEQ ID NO: 1; b) wherein domain B comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to amino acids 44-81 of SEQ ID NO: 1; c) wherein domain C comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to amino acids 82-157 of SEQ ID NO: 1; d) wherein domain D comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to amino acids 158-304 of SEQ ID NO: 1; e) wherein domain E comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to amino acids 305-494 of SEQ ID NO: 1; f) wherein domain F comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to amino acids 495-682 of SEQ ID NO: 1; g) wherein domain G comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to amino acids 683-735 of SEQ ID NO: 1; h) wherein domain H comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to amino acids 736-885 of SEQ ID NO: 1; i) wherein domain 1 comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to amino acids 886-1020 of SEQ ID NO: 1; and j) wherein domain J comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to amino acids 1021-1297 of SEQ ID NO:

1.

11. A method for modifying a nucleotide sequence at a DNA target site in a cell-free system or a cell genome, comprising introducing the composition of any one of claims 1 to 11 into a cell.

12. The method of claim 11, wherein the CRISPR nuclease comprises a sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 1, wherein the CRISPR nuclease effects DNA strand breaks adjacent to an NVTAYTNN or NRTAYTNN protospacer adjacent motif (PAM) sequence, and / or effects DNA strand breaks adjacent to a sequence that is complementary to the PAM sequence.

13. The method of claim 11, wherein the CRISPR nuclease is a nickase generated by amino acid substitution at position D10, E733, H949 or D952, and effects DNA strand breaks adjacent to the PAM sequence.

14. The method of claim 11, wherein the CRISPR nuclease is a nickase generated by amino acid substitution at position D817, H818, or N841, and effects DNA strand breaks adjacent to a sequence complementary to the PAM sequence.

15. The method according to any one of claims 11 to 14, wherein the cell is a eukaryotic cell or a prokaryotic cell.

16. The method of claim 15, wherein the cell is a mammalian cell.

17. The method of claim 16, wherein the cells are human cells.

18. A method for modifying a nucleotide sequence at a target site in a cell genome, the method comprising introducing into the cell (i) the composition of claim 1; (ii) a crRNA molecule comprising a guide sequence portion; and (iii) a tracrRNA molecule comprising a nuclease-binding RNA sequence.

19. The method of claim 18, wherein the crRNA molecule further comprises a portion having a sequence selected from SEQ ID NOs: 5-8.

20. The method of claim 18 or 19, wherein the tracrRNA comprises a portion having a sequence selected from SEQ ID NOs: 9-19, 21, and 22.

21. The method of any one of claims 18 to 20, wherein the crRNA molecule and the tracrRNA molecule are fused in the form of a single-stranded guide RNA molecule.

22. The method of any one of claims 18 to 21, wherein the sgRNA molecule comprises a sequence selected from SEQ ID NOs: 4-22.

23. The method of any one of claims 18 to 22, wherein the guide sequence portion is complementary to a DNA target site immediately adjacent to the PAM site of NVTAYTNN or NRTAYTNN.

24. A kit for modifying a nucleotide sequence at a DNA target site in a cell-free system or cell genome, comprising introducing into the system or cell the composition of any one of claims 1-11, and instructions for delivering an RNA molecule and a CRISPR nuclease to the cell.

25. A composition, method, product, process, system, kit or use, characterized in that One or more elements disclosed in this application.

Images