Application of royal jelly acid ceramide in preparation of skin care product

Abstract

The invention belongs to the technical field of biological medicines, and provides application of royal jelly acid ceramide in preparation of a skin care product. The royal jelly acid ceramide is one or more of royal jelly acid sphingosine, royal jelly acid dihydrosphingosine, royal jelly acid phytosphingosine and royal jelly acid 6-hydroxysphingosine. Compared with royal jelly acid and ceramide NP, the royal jelly acid ceramide has more excellent multiple effects of enhancing skin tissue healing ability, improving skin elasticity and toughness, resisting skin aging and the like, and has potential application value in preparation of cosmetics with corresponding effects or medicines for corresponding indications or medical instruments such as medical dressings.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine and relates to the use of royal jelly acid ceramide in the preparation of skin care products. Background Art

[0002] Royal jelly, also known as royal jelly and bee milk, has been shown to nourish the skin, enhance immunity, promote growth, strengthen the body, and aid sleep. The Chinese Materia Medica states that royal jelly's composition includes 66% water, 0.82% ash, 12.34% protein, 5.46% fat, 12.49% reducing substances, and 2.84% unknown substances, with its composition varying depending on the larval stage. Royal jelly contains over 90 fatty acids, of which royal jelly (also known as royal jelly acid, chemically known as 10-hydroxy-2-decenoic acid) is the most abundant. This unsaturated fatty acid has been shown to enhance immunity, fight bacteria and inflammation, and strongly inhibit various cell types, including lymphoma and breast cancer. It also strengthens the body, prevents hair loss, and treats acute radiation damage and chemical damage.

[0003] Ceramide is an important physiological lipid in the skin and the main component of intercellular lipids in the skin's stratum corneum. It not only acts as a second messenger molecule in the sphingomyelin pathway, but also plays an important role in the formation process of the epidermal stratum corneum. It has the functions of maintaining the skin barrier, soothing, moisturizing, anti-aging, whitening and disease treatment.

[0004] Chinese invention patent CN115433100B discloses a novel ceramide compound formed by the condensation of functional carboxylic acids such as ferulic acid, caffeic acid, sinapinic acid, and royal jelly acid with sphingosine, phytosphingosine, and dihydrosphingosine. It has been preliminarily verified that the ceramides obtained by the condensation of ferulic acid with sphingosine, phytosphingosine, and dihydrosphingosine have certain antioxidant properties. However, the efficacy of royal jelly acid ceramides formed by the condensation of royal jelly acid with other sphingosine bases in skin care has not been deeply studied.

[0005] In recent years, ceramides have gained increasing attention for their efficacy beyond skin barrier repair, as well as for products with multiple functions. For example, Chinese invention patent application CN119424274A discloses a specific mass ratio of inositol, ceramide-NP, phytosphingosine, golden camellia extract, bayberry bark extract, and cnidium monnieri extract. The combined use of these six components can form a powerful anti-aging network, working together from multiple aspects to improve the penetration-promoting, repairing, moisturizing, anti-aging, and soothing effects of the anti-aging composition. Chinese invention patent application CN112402282A discloses a ceramide composition and cosmetics with repair functions. The ceramides include: three or more of ceramide EOS, ceramide NS, ceramide NP, and ceramide AP. These components synergistically repair the orderly organized multi-layer lipid structure between keratinocytes, repair the skin barrier, reduce the penetration of irritants, thereby improving the skin's defense against external stimuli, and significantly increasing the water content of the skin's stratum corneum, and enhancing the skin's ability to lock in moisture, eliminating the problem of skin redness.

[0006] However, existing ceramides require the synergistic combination of multiple components or other plant extracts to achieve multiple benefits. The development of a single-component ceramide with multiple skincare benefits is crucial for reducing the cost and increasing the efficiency of skincare products. By combining the structural characteristics and physiological activity of royal jelly acid with the properties of the sphingoid base in ceramides, in-depth research on the multifaceted applications of royal jelly acid ceramides in skin care has significant research significance and practical value. Summary of the Invention

[0007] In response to the problems existing in the existing technology, the present invention discovered that royal jelly acid ceramide has multiple functions in skin care, such as enhancing the healing ability of skin tissue, improving the elasticity and toughness of the skin, and resisting skin aging. This solves the problem that existing products usually require the coordinated use of multiple components to achieve multiple skin care effects.

[0008] The technical solutions of the present invention are as follows:

[0009] The present invention provides a use of royal jelly acid ceramide in preparing a skin care product. The royal jelly acid ceramide is one or more of royal jelly acid sphingosine, royal jelly acid dihydrosphingosine, royal jelly acid phytosphingosine and royal jelly acid 6-hydroxysphingosine.

[0010] Among them, the structure of royal jelly acid sphingosine is as follows:

[0011] R is

[0012] The structure of sphingosine royal jelly acid is as follows:

[0013] R is

[0014] The structure of royal jelly acid phytosphingosine is as follows:

[0015] R is

[0016] The structure of 6-hydroxysphingosine royal jelly acid is as follows:

[0017] R is

[0018] Furthermore, the skin care is to promote skin wound repair.

[0019] Furthermore, the royal jelly acid ceramide achieves skin wound repair by promoting cell migration.

[0020] Furthermore, the skin care is anti-skin aging.

[0021] Furthermore, the skin aging is skin aging caused by overexpression of MMP-1 caused by UVA and / or UVB.

[0022] Furthermore, the royal jelly acid ceramide achieves anti-skin aging by inhibiting the activity of elastase and interstitial collagenase.

[0023] Furthermore, the skin care is to improve skin elasticity and toughness.

[0024] Furthermore, the royal jelly acid ceramide improves skin elasticity and toughness by increasing the activity of collagen Col-1.

[0025] Furthermore, the skin care product is a cosmetic, a medicine or a medical device.

[0026] Furthermore, the cosmetics include any one of lotion, emulsion, essence and cream.

[0027] Furthermore, the medical device is a medical dressing.

[0028] The present invention also provides a composition containing royal jelly acid ceramide, which comprises one or more of royal jelly acid sphingosine, royal jelly acid phytosphingosine, royal jelly acid dihydrosphingosine and royal jelly acid 6-hydroxysphingosine.

[0029] The present invention also provides use of the royal jelly acid ceramide-containing composition in preparing skin care products.

[0030] The present invention also provides a liposome comprising the above-mentioned composition containing royal jelly acid ceramide; and further comprising one or more of an emulsifier, a moisturizer, a skin conditioner and a preservative.

[0031] Furthermore, the mass percentage of the composition containing royal jelly acid ceramide in the liposome is 1-5%.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The present invention condenses royal jelly acid with sphingoid base to produce a series of royal jelly acid ceramides. Compared with royal jelly acid and traditional ceramide NPs, the royal jelly acid ceramides of the present invention are more effective in enhancing skin tissue healing, improving skin elasticity and toughness, and resisting photoaging and other anti-aging effects. The royal jelly acid ceramides provided by the present invention have potential application value in the preparation of cosmetics, pharmaceuticals, or medical devices such as medical dressings with corresponding efficacy or indications. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Figure 2 shows the wound healing results of the blank control group in Example 2; A is a photo of the scratch at the time of scratching (0 h), and B is a photo of the scratch after 24 h of culture;

[0035] Figure 2 Figure 2 shows the results of the scratch healing of the royal jelly acid group in Example 2; A is a photo of the scratch at the time of scratching (0 h), and B is a photo of the scratch after 24 h of incubation;

[0036] Figure 3 The results of the wound healing in the sphingosine royal jelly acid group in Example 2 are shown; A is a photo of the scratch at the time of scratching (0 h), and B is a photo of the scratch after 24 h of culture;

[0037] Figure 4 Figure 2 shows the results of the scratch healing in the royal jelly acid phytosphingosine group in Example 2; A is a photo of the scratch at the time of scratching (0 h), and B is a photo of the scratch after 24 h of culture;

[0038] Figure 5 Graphs showing the wound healing results of the dihydrosphingosine royal jelly acid group in Example 2; wherein, A is a photograph of the scratch at the time of scratching (0 h), and B is a photograph of the scratch after 24 h of culture. DETAILED DESCRIPTION

[0039] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the embodiments described are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. It is worth noting that the raw materials used in the present invention are all common commercially available products, and their sources are not specifically limited.

[0040] Example 1:

[0041] Royal jelly acid ceramide was prepared according to the following synthetic route:

[0042]

[0043] The specific steps are as follows:

[0044] To a reaction vessel, add 100 mmol of royal jelly acid, 120 mmol of the condensation reagent 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI), and 110 mmol of N-hydroxysuccinimide (HOSu). The mixture is reacted in methanol for 1 hour. Then, 100 mmol of the corresponding sphingoid base is added and the reaction is continued at room temperature for 12 hours. TLC monitoring indicates that the reaction between the sphingoid base and royal jelly acid is complete, primarily yielding the target product P2, along with a small amount of esterified byproduct P1. 20 mmol of sodium hydroxide is then added to the reaction system, and stirring is continued at room temperature for 2 hours until byproduct P1 is completely converted to P2. Finally, water is added to quench the reaction, resulting in the precipitation of a solid, which is filtered to obtain a crude solid. The crude product is recrystallized from methanol, filtered to obtain a wet solid, which is then dried to yield the corresponding royal jelly acid ceramide.

[0045] The H NMR spectrum results of the prepared royal jelly acid ceramide are as follows:

[0046] Sphingosine royal jelly acid:

[0047] 1 H NMR(400MHz,MeOD)δ=6.79(dt,J=15.4,7.0Hz,1H),5.92-5.83(m,1H),5.71(dt,J=14.3,6.8Hz ,1H),5.52-5.42(m,1H),4.17(t,J=6.2Hz,1H),3.90(q,J=4.9Hz,1H),3.80(dd,J=11.4,5.0Hz ,1H),3.66(dd,J=11.4,4.0Hz,1H),3.54(t,J=6.8Hz,2H),2.23-2.13(m,2H),2.02(q,J=7.2Hz ,2H),1.52(p,J=7.2Hz,2H),1.45(t,J=7.2Hz,2H),1.38-1.22(m,28H),0.86(t,J=6.7Hz,3H).

[0048] Sphingosine royal jelly acid:

[0049] 1H NMR (400MHz, MeOD) δ = 6.79 (dt, J = 14.5, 6.9Hz, 1H), 3.82 (ddt, J = 11.5, 7.9, 4.3Hz, 2H), 3.64 (tt, J = 9.4, 4.0Hz, 2H), 3.54 (t, J = 6.7Hz, 2H), 2.15 (q, J = 7.2Hz, 2H), 1.58-1.36 (m, 7H), 1.36-1.10 (m, 31H), 0.84 (t, J = 6.6Hz, 3H).

[0050] Royal Jelly Acid Phytosphingosine:

[0051] 1 H NMR (600MHz, Methanol-d4) δ = 6.81 (dt, J = 15.3, 7.0 Hz, 1H), 6.02 (dt, J = 15.3, 1.5Hz,1H),4.19(td,J=5.8,4.3Hz,1H),3.81(dd,J=11.3,4.4Hz,1H),3.76(d d,J=11.2,5.8Hz,1H),3.62(t,J=5.8Hz,1H),3.58-3.53(m,3H),2.23(qd,J=7 .2,1.6Hz,2H),1.57-1.49(m,5H),1.39-1.29(m,32H),0.92(t,J=7.0Hz,3H).

[0052] 6-Hydroxysphingosine Royal Jelly Acid:

[0053] 1 H NMR(400MHz,MeOD)δ=6.62(dt,J=15.4,7.0Hz,1H),5.92-5.83(m,1H),5.71(dt,J=14.3,6.8Hz ,1H),5.52-5.42(m,1H),4.18(t,J=6.2Hz,1H),3.90(q,J=4.9Hz,1H),3.80(dd,J=11.4,5.0Hz ,1H),3.66(dd,J=11.4,4.0Hz,1H),3.54(t,J=6.8Hz,2H),2.23-2.13(m,2H),1.58(q,J=7.2Hz ,2H),1.46(p,J=7.2Hz,2H),1.43(t,J=7.2Hz,2H),1.38-1.22(m,26H),0.86(t,J=6.7Hz,3H).

[0054] Example 2: In vitro cell migration assay

[0055] The cell scratch test is an in vitro method for studying cell migration. When keratinocytes grow to a fused monolayer, a blank area (scratch) is artificially created on the fused monolayer. Cells at the edge of the scratch gradually move into the blank area, healing the "scratch." This, to a certain extent, simulates the migration process of epidermal keratinocytes. By observing the state of cells in the scratch area at different times, the migration ability of cells can be determined. This is an important in vitro method for studying skin wound healing and repair.

[0056] 1. Experimental methods:

[0057] The cell scratch method was used to verify the effect of the royal jelly acid ceramide, royal jelly acid and ceramide NP of the present invention on promoting cell migration. The specific operation is as follows:

[0058] (1) Marking the culture plate: First, mark horizontal lines evenly at intervals of 0.5-1 cm at the back of a 6-well plate, crossing the wells horizontally, with at least 5 lines crossing each well.

[0059] (2) Cell plating: Add approximately 5×10 5 cells (the number of different cells varies and is adjusted according to the growth rate of the cells). The inoculation principle is that the fusion rate reaches 100% after overnight.

[0060] (3) Cell streaking: On the second day, use the tip of the pipette, perpendicular to the cell plane, to scratch the cell layer along the line drawn on the back of the plate on the first day.

[0061] (4) Washing cells: After the scratching is completed, wash the cells three times with sterile PBS to wash away the cells that are not attached to the wall, that is, the cells that are scratched during the scratching process. The gaps left after the scratching are clearly visible, and then replace with fresh serum-free culture medium.

[0062] (5) Cell culture and observation: Sphingosine royal jelly acid, phytosphingosine royal jelly acid, dihydrosphingosine royal jelly acid, royal acid, and ceramide NP were diluted with fresh serum-free medium to a concentration of 10 mg / L and added to a cell culture dish. Fresh serum-free medium was used as a blank control group. The cells were cultured in a 37°C, 5 wt% CO2 incubator for 24 h, then the cells were removed and observed under a microscope to measure the area of the scratch and take pictures. The results are as follows: Figure 1-5 As shown, the healing rate was calculated using Image J software. The healing rate calculation formula is as follows:

[0063] Healing rate = (area before culture - area after 24 h of culture) / area before culture × 100%.

[0064] 2. Experimental results:

[0065] The results of the effects of royal jelly acid ceramide, royal jelly acid, and ceramide NP on cell migration are shown in Table 1. Royal jelly acid and royal jelly acid ceramide have different degrees of cell healing effects. Among them, royal jelly acid phytosphingosine has a very obvious cell healing effect.

[0066] Table 1

[0067] Group Healing rate (%) Blank control group 2.38％ Royal jelly acid 5.01％ Sphingosine royal jelly acid 7.32％ Royal jelly acid phytosphingosine 41.75％ Sphingosine royal jelly acid 15.04％

[0068] Example 3: Elastase inhibition experiment

[0069] Elastase can degrade collagen, elastin and other proteins. The degradation of elastin in skin tissue by elastase is closely related to the occurrence of skin aging. Resisting the degradation of elastin by elastase and restoring skin elasticity are important ways to delay skin aging.

[0070] 1. Experimental methods:

[0071] The elastase substrate, N-succinyl-L-alanyl-L-alanyl-L-alanine 4-nitroanilide (Suc-Ala-Ala-Ala-p-NA), was dissolved in 0.1 mol / L Tis-HCl buffer (pH 8.0) to a concentration of 1.015 mmol / L as the substrate working solution. To a 96-well plate, 130 μL of the substrate working solution and 10 μL of samples (royal jelly acid ceramide, royal jelly acid, and ceramide NP) at varying concentrations were added. After mixing on a shaker, 15 μL of 0.5 U of elastase was added. The plates were shaken for 30 minutes at room temperature, and the absorbance at 410 nm was measured. 0.015 mM EGCG was added as a positive control. Elastase inhibition rate = (A3-A1+A2) / A3×100%, wherein A1 is the absorbance value of the system with sample and enzyme; A2 is the absorbance value of the system with sample but no enzyme; A3 is the absorbance value of the system with enzyme but no sample.

[0072] 2. Experimental results:

[0073] The inhibition of elastase by royal jelly ceramide, royal jelly acid, and ceramide NP at different concentrations is shown in Table 2. It can be seen that royal jelly ceramide has a significantly better inhibitory effect on elastase than royal jelly acid and ceramide NP. This indicates that royal jelly ceramide can effectively delay skin aging.

[0074] Table 2

[0075]

[0076] Example 4: Experiment on promoting the expression of collagen Col-1

[0077] Collagen Col-1 is primarily found in the skin, and its content is closely related to skin elasticity and toughness. It also has skin repair and wound healing benefits. Therefore, the effects of Col-1 expression in human foreskin fibroblasts (HFF-1) on improving skin elasticity and promoting wound healing could be studied.

[0078] 1. Experimental methods:

[0079] HFF-1 cells were cultured at 1×10 6 Cells were seeded at a density of 100 μL / well in a 6-well plate and incubated overnight in a 5% CO2, 37°C incubator. After 24 hours, the supernatant was discarded and 100 μL of culture medium containing different concentrations of samples (royal jelly acid ceramide, royal jelly acid) was added. The blank control group consisted of DMEM medium without drug, and the positive control was 150 μM magnesium ascorbyl phosphate. 48 hours after administration, total RNA was extracted from three replicates in each group, and the RNA was reverse transcribed into cDNA. Fluorescence quantitative PCR was used to quantify the expression of collagen Col-1 in HFF-1 cells, and the relative expression level to the blank control group was calculated.

[0080] Primer sequences:

[0081] Col1a1-F:CGATGGATTCCCGTTCGAGT

[0082] Col1a1-R:GAGGCCTCGGTGGACATTAG

[0083] 2. Experimental results:

[0084] Table 3 shows the relative expression of Col-1 in fibroblasts promoted by royal jelly ceramide, royal jelly acid, and ceramide NP at different concentrations. It can be seen that royal jelly ceramide and royal jelly acid increased Col-1 expression and improved skin elasticity and toughness in a dose-dependent manner. Higher sample concentrations resulted in more significant increases in Col-1 content and, consequently, in skin elasticity and toughness. Royal jelly ceramide significantly outperformed royal jelly acid and ceramide NP in increasing collagen content in fibroblasts.

[0085] Table 3

[0086]

[0087]

[0088] Example 5: Anti-light aging experiment

[0089] MMP-1, also known as interstitial collagenase and matrix metalloproteinase, belongs to the matrix metalloproteinase family. Its primary substrate is fibrillar collagen. It degrades collagen fibers and gelatin in the extracellular matrix and alters the cellular microenvironment. MMP-1 plays a crucial role in elastin production. Inhibiting MMP-1 can enhance collagen and elastin synthesis in fibroblasts, while reducing MMP-1 activity can increase the rate of collagen synthesis.

[0090] 1. Experimental methods:

[0091] HFF-1 cells were cultured at 1×10 5 The cells were seeded in a 96-well plate at a density of 100 μL / well and incubated overnight in an incubator. After 24 hours, the supernatant was discarded and 100 μL of DMEM medium containing different concentrations of royal jelly acid phytosphingosine, royal jelly acid sphingosine, royal jelly acid dihydrosphingosine, royal jelly acid 6-hydroxysphingosine or royal jelly acid (no drug was added to the model group) was added. The negative control group was a DMEM medium without drugs. Each group had 3 replicates. After incubation for 4 hours in an environment of 5% CO2 and 37°C, UVA or UVB ultraviolet rays were irradiated. The distance between the ultraviolet radiation light source and the cells was 15 cm, and the UVA or UVB intensity was 200 mJ / cm 2 The irradiation time was 1 hour. After the irradiation, the cells were incubated in the incubator for 24 hours. The expression of MMP-1 gene in the cells was detected using an MMP-1 ELISA kit, and the relative expression level was calculated compared with that in the blank control group.

[0092] Primer sequences:

[0093] Col1a1-F:CGATGGATTCCCGTTCGAGT

[0094] Col1a1-R:GAGGCCTCGGTGGACATTAG

[0095] 2. Experimental results:

[0096] After ultraviolet (UVA or UVB) irradiation, the relative expression of MMP-1 in fibroblasts promoted by keratinocytes at different concentrations of royal jelly acid ceramide, royal jelly acid and ceramide NP is shown in Table 4. It can be seen that compared with the negative control group, after the cells in the model group were irradiated with ultraviolet (UVA or UVB), keratinocytes promoted the increase of MMP-1 expression in fibroblasts, thereby causing the degradation of skin extracellular matrix and skin collagen, leading to skin photoaging.

[0097] Compared with the model group, royal jelly acid phytosphingosine, royal jelly acid sphingosine, royal jelly acid dihydrosphingosine, royal jelly acid 6-hydroxysphingosine, and royal jelly acid significantly inhibited UV-induced MMP-1 overexpression, showing a clear dose-dependent effect. Furthermore, royal jelly acid ceramide was significantly more effective than royal jelly acid in inhibiting UV-induced MMP-1 overexpression. This could inhibit UV-induced MMP-1 production in fibroblasts, potentially playing a role in preventing skin photoaging.

[0098] Table 4

[0099]

[0100] In summary, the royal jelly acid ceramide of the present invention has excellent ability to promote skin tissue healing, improve skin elasticity and toughness, and can also achieve anti-skin aging effects by resisting photoaging. It has potential application value in the preparation of cosmetics, drugs or medical devices such as medical dressings with corresponding efficacy or indications.

[0101] Example 6: Efficacy test of royal jelly acid ceramide composition in improving skin elasticity and toughness

[0102] (1) Preparation of liposomes:

[0103] Royal jelly acid ceramide liposomes and royal jelly acid / ceramide NP composite liposomes were prepared according to the formula shown in Table 5. The specific preparation process is as follows:

[0104] Phase A, phase B, and phase C are stirred and heated separately to dissolve or disperse evenly; phase B is added to phase C and mixed to obtain a BC phase mixture; then phase A is added to the BC phase mixture, homogenized and emulsified, and homogenized under high pressure to obtain the target liposomes.

[0105] Table 5

[0106]

[0107] (2) Preparation of Class II medical dressing (liquid type):

[0108] Medical dressings containing royal jelly acid-ceramide liposomes and medical dressings containing royal jelly acid / ceramide NP composite liposomes were prepared according to the formula shown in Table 6. The specific preparation process is as follows:

[0109] Phase A (water, xanthan gum, sodium hyaluronate) was mixed homogeneously, and the raw materials in phase B (collagen, liposomes, phenoxyethanol) were added in sequence, and stirred evenly to prepare a liquid dressing.

[0110] Table 6

[0111]

[0112]

[0113] (3) Efficacy test:

[0114] Referring to the method of Example 4, the effects of medical dressings prepared with 2% royal jelly acid ceramide liposomes and medical dressings prepared with 1% royal jelly acid / 1% ceramide NP composite liposomes on improving skin elasticity and toughness were compared. Blank liposomes without active ingredients (royal jelly acid ceramide, ceramide NP and royal jelly acid) (wherein the amount of active ingredients was supplemented by water) were used as blank controls, and commercially available VC emulsion was used as a positive control.

[0115] 2. Experimental results:

[0116] The relative expression of Col-1 mRNA in the blank control group was set to 100.50, the relative expression of Col-1 in the positive control group at a concentration of 20 mg / L was 145.20, the relative expression of Col-1 in the medical dressing containing 2% royal jelly acid ceramide liposomes at a concentration of 20 mg / L was 138.00, and the relative expression of Col-1 in the medical dressing containing 1% royal jelly acid / 1% ceramide NP composite liposomes at a concentration of 20 mg / L was 119.70. It can be seen that the royal jelly acid ceramide composition of the present invention is significantly better than the royal jelly acid / ceramide NP composition in improving skin elasticity and toughness.

[0117] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. Use of royal jelly acid ceramide in preparing skin care products, characterized in that, The royal jelly acid ceramide is one or more of royal jelly acid sphingosine, royal jelly acid dihydrosphingosine, royal jelly acid phytosphingosine and royal jelly acid 6-hydroxysphingosine.

2. The use according to claim 1, characterized in that The skin care is any one of promoting skin wound repair, resisting skin aging, and improving skin elasticity and toughness.

3. The use according to claim 2, characterized in that The skin aging is skin aging caused by overexpression of MMP-1 caused by UVA and / or UVB.

4. The use according to claim 2, characterized in that The royal jelly acid ceramide achieves skin wound repair by promoting cell migration; and / or the royal jelly acid ceramide achieves anti-skin aging by inhibiting elastase activity and MMP-1 activity; and / or the royal jelly acid ceramide improves skin elasticity and toughness by increasing collagen Col-1 activity.

5. The use according to claim 1, characterized in that The skin care product is a cosmetic, a medicine or a medical device.

6. The use according to claim 5, characterized in that The cosmetics include any one of lotions, emulsions, essences and creams; and the medical device is a medical dressing.

7. A composition containing royal jelly acid ceramide, characterized in that: The composition comprises one or more of sphingosine royal jelly acid, phytosphingosine royal jelly acid, dihydrosphingosine royal jelly acid and 6-hydroxysphingosine royal jelly acid.

8. Use of the composition containing royal jelly acid ceramide according to claim 7 in preparing skin care products.

9. A liposome, characterized in that The composition comprising the royal jelly acid ceramide according to claim 7 further comprises one or more of an emulsifier, a moisturizer, a skin conditioner and a preservative.

10. The liposome according to claim 9, characterized in that The mass percentage of the composition containing royal jelly acid ceramide in the liposome is 1-5%.

Images