Transplanting type targeted single antigen cell combination as well as preparation method and application thereof
By constructing cell lines or clones that express highly rejection antigens, problems such as missed detection and false positives in existing rejection antibody screening technologies have been solved, and high specificity, sensitivity and stability of rejection antibody detection has been achieved.
Patent Information
- Application Number
- CN202510700067.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-28
- Publication Date
- 2025-08-19
AI Technical Summary
The existing rejection antibody screening technology has problems such as missing tissue-specific antibodies, insufficient sensitivity to low-expression antibodies, inability to determine the type of target antigen, poor method stability and difficult standardization.
By screening host cells expressing reject antigens, immortalizing treatment and knocking out interfering antigen genes, cell lines or clones that express reject antigens are constructed for screening of rejection antibodies.
It improves the specificity and sensitivity of the test, reduces false positive results, ensures the stability and standardization of the test, and is suitable for a variety of transplant types.
Smart Images

Figure CN120505280A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedical technology and relates to a screening technology for rejection antibodies in transplant immunity, and in particular to a transplant type-targeted single antigen cell combination and its preparation method and application. Background Art
[0002] Current screening technologies for rejection antibodies in organ, tissue, or (stem) cell transplantation include cytological detection and purified antigen detection (Chinese Medical Journal, 2022, 102(10):705-717.DOI:10.3760 / cma.j.cn112137-20210830-01973).
[0003] Cytological testing: Starting in the 1960s, the detection of rejection antibodies in kidney transplant patients was first done by cytological testing, namely crossmatching. This method has been used to this day and has gradually become widely used in all types of transplants. This method usually uses peripheral blood mononuclear cells (PBMC) or lymphocytes as target cells to detect antibodies corresponding to rejection antigens on the surface of target cells (J Immunol. 1964 Jan; 92: 128-38; Nature. 1964 Dec 5; 204: 998-1000. doi: 10.1038 / 204998b0; Transplantation. 1966 Nov; 4(6): 688-99. doi: 10.1097 / 00007890-196611000-00004; N Engl J Med. 1969 Apr 3; 280(14): 735-9. doi: 10.1056 / NEJM196904032801401). The cytological detection method has the greatest advantage of good antigen integrity on the cell surface and can truly reflect the natural state of the rejection antigen. However, the cell method has four major defects (Chinese Medical Journal, 2022, 102(10):705-717.DOI:10.3760 / cma.j.cn112137-20210830-01973): 1) This method uses unified target cells to detect antibodies to rejection antigens in all different transplant types, which can easily miss antibodies to rejection antigens unique to specific transplant types; 2) The target cells used in this method may have low expression levels of certain specific rejection antigens, resulting in insufficient sensitivity in detecting their corresponding antibodies; 3) The target cells used in this method usually express multiple rejection antigens at the same time, and for the detected antibodies, it is impossible to determine the exact target antigen type they are targeting; 4) The target cells used in this method are extremely prone to cell death or reduced activity due to poor storage, transportation, and experimental conditions, resulting in poor stability and difficulty in standardization of this method.
[0004] Purified antigen detection: With the advancement of research, transplant immunology researchers have discovered that antibodies to human leukocyte antigens (HLA) are one of the main causes of antibody-mediated rejection. Based on this, the method of detecting HLA antibodies using purified HLA antigens has been widely used in the clinical detection of rejection antibodies since the 1990s. Among them, 1) In 1995, the ELISA method (Enzyme-Linked Immunosorbent Assay) using purified HLA antigen began to be used for the detection of HLA antibodies (Transplantation.1995 Dec27;60(12):1594-9.doi:10.1097 / 00007890-199560120-00037; Transplantation.1996 Jul 27;62(2):201-5.doi:10.1097 / 00007890-199607270-00009; Eur J Immunogenet.1996 Oct;23(5):383-7.doi:10.1111 / j.1744-313x.1996.tb00011.x). 2) In 2003, purified HLA antigens were used for HLA antibody detection using the flow cytometric microsphere method (Transplantation. 2003 Jan 15; 75(1): 43-9. Doi: 10.1097 / 00007890-200301150-00008.) and subsequently the Luminex microsphere method using purified HLA antigens (Ann Biol Clin (Paris). 2004 Jan-Feb; 62(1): 93-8.). Currently, the Luminex single antigen microsphere method is the most widely used HLA antibody detection method in transplant immunology. The purified antigen method has the advantages of clear target antigens, high sensitivity due to sufficient antigen dosage, and easy standardization of experimental methods. However, due to the inevitable denaturation of antigens during the purification and carrier immobilization process, its biggest drawback is the detection of false positive antibodies due to denatured antigens.
[0005] In summary, among the two current rejection antibody screening technologies, the cytological detection method has the defects of missing antibodies to tissue-specific antigens, insufficient sensitivity to antibodies to certain low-expression antigens, inability to determine the target antigen in the test results, poor method stability and difficulty in standardization, while the purified antigen detection method has the defect of false-positive antibody detection due to denatured antigens. Summary of the Invention
[0006] In response to the above technical problems, the present invention provides a transplant type-targeted single antigen cell combination, a preparation method and application thereof, and through a series of treatments such as selection of specific transplant type-targeted host cells, immortalization induction, knockout of interfering antigen genes, establishment of rejection antigen-expressing cell lines, and screening of high-expressing cell lines or clones, a single antigen-expressing cell series of rejection antigens is constructed. If necessary, after adhesion treatment, it is used for screening of rejection antibodies.
[0007] The technical solution adopted by the present invention to achieve the technical purpose is:
[0008] The present invention provides a transplant-type targeted single antigen cell combination, including screening host cells expressing rejection antigens, immortalizing them and knocking out interfering antigen genes, and then expressing the rejection antigens and screening the resulting high-expressing cell lines / clones.
[0009] Preferably, the host cells expressing the rejection antigens include the main target cells of the transplant known to cause rejection (such as vascular endothelial cells, etc.), parenchymal cells of organs or tissues (such as hepatocytes, etc.), or other cell types that have tissue homology with the transplant cells and similar cell surface antigens.
[0010] The present invention also provides a product for screening rejection antibodies, comprising the above-mentioned transplant type-targeted single antigen cell combination.
[0011] Preferably, the above product further comprises a solid phase carrier for combining the transplant type-specific single antigen cell combination, and the solid phase carrier comprises one or more of a polystyrene culture plate, a glass cover slip, a cell culture dish, a microporous filter membrane, and a biochip.
[0012] The present invention also provides a method for preparing a transplant type targeted single antigen cell combination, comprising:
[0013] 1) According to different transplant types, select the corresponding transplant type-specific tissue cells as host cells expressing rejection antigens;
[0014] 2) immortalizing the host cell;
[0015] 3) Knock out all known antigen genes that interfere with specific rejection antibodies;
[0016] 4) Establish rejection antigen-expressing cell lines and screen high-expressing cell lines or clones.
[0017] Preferably, in step 1), the host cells expressing the rejection antigen include the main target cells of known rejection reactions contained in the graft (such as vascular endothelial cells, etc.), parenchymal cells of organs or tissues (such as hepatocytes, etc.), or other cell types with tissue homology and similar cell surface antigens to the graft cells; in step 2), the methods for immortalization treatment include but are not limited to: viral transformation, gene editing, transfection, fusion and chemical induction; in step 3), the methods for knocking out the antigen gene include but are not limited to: CRISPR / Cas9, TALEN, ZFN and RNA interference technology; step 4) specifically includes: constructing a rejection antigen expression vector, transfecting or infecting cells, identifying expression levels, screening high-expressing cell lines, and / or further cloning high-expressing cell lines.
[0018] Preferably, the above preparation method further comprises subjecting the non-adherent cells to an adhesion treatment.
[0019] More preferably, methods for adhesion treatment include but are not limited to: chemical treatment, physical treatment, bioengineering treatment and co-cultivation.
[0020] The present invention also provides the use of the above-mentioned transplant type targeted single antigen cell combination in the preparation of a product for screening rejection antibodies.
[0021] Preferably, the method for screening rejection antibodies includes but is not limited to: cytological ELISA detection method, cytological fluorescence signal detection method.
[0022] The beneficial effects of the present invention are:
[0023] (I) Improve the specificity of detection: by selecting target cells for specific transplant types, such as graft parenchymal cells or syngeneic cells, ensure that the detected antigen is consistent with the real graft target, and avoid detection errors caused by antigen type deviation; combine immortalized cell treatment with interfering antigen gene knockout, by knocking out non-target interfering antigens (such as cross-reactive antigens) and overexpressing specific rejection antigens to cover tissue-specific antigens (such as MICA,
[0024] MICB and other non-HLA antigens), construct a combination of single rejection antigen presenting cells as detection cells, clarify the specific target antigen type targeted by the detected antibodies, improve the specificity and comprehensiveness of the test, avoid missed detection, and solve the problem that the existing cytological detection method cannot determine the target antigen type.
[0025] (2) Improving detection sensitivity: By constructing cell lines or cell clones that highly express specific rejection antigens, the sensitivity of detection is improved, and low-titer antibodies can be detected more accurately, solving the problem of insufficient sensitivity of existing cytological detection methods to antibodies against low-expressing antigens.
[0026] (3) Improve detection stability: Use immortalized adherent or suspension cell adherent tissue-specific host cells to ensure stable cell growth and stable expression of rejection antigens, which are not affected by cell storage or transportation conditions.
[0027] (IV) Reduce false positives: Use immortalized target cells as the presenting subject of rejection antigens to ensure the natural state and integrity of the rejection antigens on the cell surface, and avoid false positive antibody detection caused by denatured antigens in purified antigen detection methods.
[0028] (V) Standardization and consistency: Through immortalization treatment and screening of high-expressing cell lines / clones, the standardization and consistency of the detection method are ensured, reducing the fluctuation of the test results caused by poor cell preservation, transportation and experimental conditions; through solid-phase carriers to fix cells with high antigen expression combined with ELISA / fluorescence detection method, high-throughput and standardized antibody screening can be achieved, which improves the stability and standardization of the test. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 The results of flow cytometry detection of MICA001 surface expression levels are shown. Negative control: cell line that does not express MICA001; positive control: positive clone transfected with MICA001 gene; experimental group: cell line after MICA001 gene knockout. DETAILED DESCRIPTION
[0030] The present invention will be described in detail below with reference to specific embodiments. The following specific embodiments will help those skilled in the art to further understand the present invention, but will not limit the present invention in any form.
[0031] Example
[0032] Vascular endothelial cells are common target cells that can mediate rejection reactions in all solid organ transplants. This example describes the steps for constructing a MICA single antigen-expressing cell panel using commercially available primary human umbilical vein endothelial cells (HUVECs) and screening for MICA antibodies using a cytological ELISA assay.
[0033] 1. Primary Culture and Identification
[0034] 1) Culture conditions
[0035] a. Inoculate in collagen-coated culture flasks (to enhance adhesion) and use endothelial cell culture medium (containing 5% FBS +
[0036] endothelial growth factor);
[0037] b. Culture environment: 37°C, 5% CO2, change medium every 2-3 days.
[0038] 2) Morphological identification: Microscopic observation: Typical cobblestone-like arrangement and polygonal cells with clear boundaries.
[0039] 2. Immortalization of HUVEC Host Cells
[0040] 1) Immortalization technology selection and preparation
[0041] a. We recommend using the SV40 large T antigen (SV40T) lentiviral vector system for transfection. SV40T achieves immortality by binding to p53 and Rb proteins to block the cell senescence pathway.
[0042] b. Prepare lentiviral particles containing the SV40T gene (MOI = 5-10). The virus titer should be ≥ 1 × 10 8 TU / mL.
[0043] 2) SV40T antigen transfection process
[0044] a. Cell Pretreatment
[0045] i) HUVEC primary cells of passage 3-5 (viability > 95%) were selected and seeded into collagen-coated 6-well plates (density: 2×10 5 / hole).
[0046] ii) 24 hours before transfection, the medium was replaced with endothelial cell-specific medium (containing 5% FBS) without antibiotics.
[0047] b. Viral transfection
[0048] i) Add an appropriate amount of virus solution (calculated according to MOI) and Polybrene (final concentration 6 μg / mL) to promote infection.
[0049] ii) After incubation at 37°C for 12 hours, fresh medium was replaced and culture was continued for 48 hours.
[0050] 3) Screening and verification of immortalized cells
[0051] a. Screening and amplification
[0052] i) Add puromycin (the concentration is determined by the resistance gene of the vector, usually 1-2 μg / mL) and continue screening for 7-10 days;
[0053] ii) Observe the surviving clones and isolate monoclonal cell lines by limiting dilution method.
[0054] b. Immortality verification
[0055] i) Proliferation capacity assay: Continuously passage for ≥20 generations and draw growth curves to verify the stability of doubling time.
[0056] ii) Karyotype analysis: G-banding technique is used to detect chromosome stability and exclude abnormal karyotype clones.
[0057] iii) Marker detection: Flow cytometry confirmed the continuous expression of CD31 and vWF, maintaining endothelial characteristics.
[0058] 4) Optimization of immortalized cell culture
[0059] a. Culture medium adjustment
[0060] Use endothelial-specific culture medium (containing ECGS, heparin, growth factors, and 10% FBS) to avoid cell function degradation.
[0061] b. Digestion operation optimization
[0062] The trypsin digestion time was controlled within 1-2 minutes, and after termination, the cells were gently pipetted (using a cell scraper instead of repeated pipetting).
[0063] c. Generation management
[0064] Maintain cell density between 30-80% to avoid over-confluence which may lead to functional abnormalities.
[0065] 3. Knockout of all HLA and MICA genes in immortalized HUVEC host cells (detailed steps are explained using the knockout of the MICA001 gene as an example)
[0066] 1) Experimental design and preliminary preparation
[0067] a. Target gene analysis
[0068] All subtype sequences of the MICA001 gene were obtained (GenBank: Z46847.1). Based on the following sequences, CRISPR-Cas9 sgRNA sequences covering the conserved regions were designed. Three pairs of sgRNA sequences covering the conserved regions were designed as follows (target sequence was 20 bp, PAM was NGG):
[0069] According to the mRNA sequence of MICA001: ccaggactgg tgaagccttc ggagaccctgtccctcacctgcactgtctc tggtgggtcc atcaatagtt actactggag ctggatccgg cagcccccagggaaaggact ggagtggattgggttcatct ctcacagtgg gatcaccaac tacaacccgt cccgcaagagtcgagtcacc atattagtag acacgtccaagaaccagatc tccctgaagc tgagctctgt gaccgctggggacacggccg tgtattactg tgcgagagaggggaaagtat ccagtggctg gcgactctgg tacttcgatctctggggccg tggcaccctg gtcactgtct cctca (as shown in SEQ ID NO.1),
[0070] ①sgRNA-1
[0071] Target sequence position: positive strand 24-43 (GGAGACCCTG TCCCTCACCT GC), as shown in SEQ ID NO. 2;
[0072] sgRNA sequence: GCAGTGAGGGA CAGGGTCTCC, as shown in SEQ ID NO. 3;
[0073] PAM: CGG (located downstream of the target sequence);
[0074] Targeting region: encodes the start region of the α1 domain, which is involved in antigen binding function.
[0075] ②sgRNA-2
[0076] Target sequence position: positive chain 129-148 (GGGTTTATCT CTCACAGTGG), as shown in SEQ ID
[0077] Shown in NO.4;
[0078] sgRNA sequence: CCACTGTGAG AGATAAACCC, as shown in SEQ ID NO. 5;
[0079] PAM: TGG (located downstream of the target sequence);
[0080] Targeted region: upstream of the transmembrane region, regulating protein stability.
[0081] ③sgRNA-3
[0082] Target sequence position: positive strand 241-260 (GACACGGCCG TGTATTACTG), as shown in SEQ ID NO. 6;
[0083] sgRNA sequence: CAGTAATACA CGGCCGTGTC, as shown in SEQ ID NO. 7;
[0084] PAM: CGG (located downstream of the target sequence);
[0085] Targeting region: intracellular signal peptide region, affecting protein secretion.
[0086] The above selected sequences avoid the MICB homologous gene region to avoid off-target effects.
[0087] b. Construction of CRISPR vector
[0088] i) Using a dual-plasmid system (LentiCRISPR v2 vector);
[0089] ii) sgRNA expression cassette (U6 promoter);
[0090] iii) Cas9-P2A-Puro resistance element (EF1α promoter);
[0091] iv) Verify the correct insertion of sgRNA by Sanger sequencing.
[0092] 2) Gene knockout operation process
[0093] a. Lentiviral packaging and titer determination
[0094] i) Co-transfecting the constructed plasmid and packaging plasmid (psPAX2 / pMD2.G) into HEK293T cells (PEI transfection method);
[0095] ii) Collect the viral supernatant 48-72 hours later, concentrate by ultracentrifugation and determine the titer (≥1×10 8 TU / mL).
[0096] b. HUVEC cell transfection
[0097] i) Immortalized HUVEC cells (density 60-70%) were inoculated and infected with virus solution containing Polybrene (8 μg / mL) (MOI = 5-10);
[0098] ii) After 24 hours of infection, the cells were replaced with fresh endothelial-specific culture medium (containing ECGS and heparin).
[0099] c. Positive cell screening
[0100] i) 72 hours after transfection, add puromycin (the concentration is determined based on preliminary experiments, usually 1-2 μg / mL) and screen for 7 days;
[0101] ii) Monoclonal clones were isolated from the surviving cells by limiting dilution.
[0102] 3) Knockout efficiency verification
[0103] a. Molecular level validation
[0104] PCR amplification of the MICA target gene region (design primers spanning the sgRNA binding site):
[0105] ① sgRNA-1 verification primer (targeting α1 domain)
[0106] Forward primer: 5'-CCAGGACTGGTGAAGCCTTC-3' (positions 1-20), as shown in SEQ ID NO. 8;
[0107] Reverse primer: 5'-CCTGCACTGTCTCTGGTGGG-3' (positions 61-80), as shown in SEQ ID NO. 9;
[0108] Amplified fragment: 80 bp (covering positions 24-43 of the sgRNA-1 target sequence).
[0109] ②sgRNA-2 verification primer (targeting the upstream of the transmembrane region)
[0110] Forward primer: 5′-GGGTTTATCTCTCACAGTGG-3′ (positions 129-148), as shown in SEQ ID NO. 10;
[0111] Reverse primer: 5'-GAACCAGATCTCCCTGAAGC-3' (positions 181-200), as shown in SEQ ID NO. 11;
[0112] Amplified fragment: 72bp (covering sgRNA-2 target sequence 129-148).
[0113] ③sgRNA-3 verification primer (targeting signal peptide region)
[0114] Forward primer: 5'-GACACGGCCGTGTATTACTG-3' (positions 241-260), as shown in SEQ ID NO. 12;
[0115] Reverse primer: 5′-GGGCCGTGGCACCCTGGTCA-3′ (positions 301-320), as shown in SEQ ID NO. 13;
[0116] Amplified fragment: 80 bp (covering sgRNA-3 target sequence 241-260).
[0117] Results: The wild-type amplification products should be 72 and 80 bp, but no corresponding bands were observed after knockout.
[0118] b. Protein expression verification
[0119] Flow cytometry was used to detect the surface expression level of MICA001 (using MICA-specific antibodies such as clone 6D4). Figure 1 shown.
[0120] 4) Functional maintenance verification
[0121] a. Immortalization stability verification
[0122] Continuously passage for more than 50 generations and monitor the stability of MICA expression at different stages (see step 4.4)
[0123] 4. Establishment of MICA-expressing cell lines and screening of high-expressing cell clones (the steps are explained using the construction of MICA001 single antigen cells as an example)
[0124] 1) Expression vector design and construction
[0125] a. Target gene acquisition
[0126] Synthesize MICA001 cDNA fragment according to 3.1) a.MICA001 and add restriction enzyme sites (EcoRI / XhoI)
[0127] Used for cloning.
[0128] b. Vector selection
[0129] i) Use a lentiviral expression system (such as pCDH-CMV-MCS-EF1-Puro) containing a strong promoter
[0130] (CMV / EF1α) and puromycin resistance marker;
[0131] ii) Optionally, a fluorescent tag (such as GFP) can be added to facilitate subsequent screening.
[0132] 2) Host cell transfection and stable strain screening
[0133] a. Cell line selection
[0134] i) Select HEK293T cells (high transfection efficiency and low endogenous MICA expression);
[0135] ii) Pre-culture to 80% confluency and switch to serum-free medium to improve transfection efficiency.
[0136] b. Lentiviral Packaging and Infection
[0137] i) Co-transfect the packaging plasmid (psPAX2 / pMD2.G) and the MICA001 expression vector into HEK293T cells (PEI transfection method);
[0138] ii) Collect virus supernatant after 48-72 hours, infect target cells (MOI=10-20) and add Polybrene (6
[0139] μg / mL).
[0140] c. Stable strain screening
[0141] i) Add puromycin 72 hours after infection (concentration determined in pre-experimental experiments, usually 2-4 μg / mL) and continue screening for 7-10 days;
[0142] ii) Isolate monoclonal cell lines (≤1 cell per well) by limiting dilution.
[0143] 3) Identification of high-expressing clones
[0144] a. mRNA level verification: Total cellular RNA was extracted and MICA001 expression was detected by RT-qPCR (two pairs of primers were designed, corresponding to the α1 domain, transmembrane region, and intracellular signal peptide, respectively);
[0145] ① Primer pair 1
[0146] Amplification region: α1 domain (functional key region)
[0147] Forward primer (F1):
[0148] 5'-CCAGGACTGGTGAAGCCTTC-3' (positions 1-20), as shown in SEQ ID NO. 8;
[0149] Reverse primer (R1):
[0150] 5'-GAGACAGTGACCCAGGTGCC-3' (positions 301-320, reverse complement), as shown in SEQ ID NO. 14;
[0151] Product length: 320 bp.
[0152] ② Primer pair 2
[0153] Amplification region: transmembrane region and intracellular signal peptide (regulatory region)
[0154] Forward primer (F2):
[0155] 5'-GCTGGATCCGGCAGCCCC-3' (positions 61-78), as shown in SEQ ID NO. 15;
[0156] Reverse primer (R2):
[0157] 5'-TGGCACGGCCACAGAGATC-3' (positions 241-260, reverse complement), as shown in SEQ ID NO. 16;
[0158] Product length: 200 bp.
[0159] b. Protein expression detection
[0160] Flow cytometry: Use MICA-specific monoclonal antibodies (e.g., clone 6D4) to detect cell surface expression levels (see Figure 1 positive control in ).
[0161] 4) Expansion and cryopreservation of high-expressing clones
[0162] a. Expansion culture
[0163] i) Select the top 5% expressing clones and expand them in DMEM medium containing 10% FBS (maintaining the density ≤ 90%);
[0164] ii) 1% non-essential amino acids (NEAA) were added to reduce metabolic stress.
[0165] b. Cell Cryopreservation
[0166] i) Cryopreservation solution formula: 90% FBS + 10% DMSO, divided into cryopreservation tubes (1×10 6 cells / mL);
[0167] ii) After programmed cooling, long-term storage in liquid nitrogen is performed, and stability is verified by regular thawing.
[0168] Following the same method as above, high-expressing cell clones of MICA002, MICA004, MICA007, MICA008, MICA009, MICA010, and MICA011 were obtained. The mean fluorescence intensity results of the antigen expression levels are shown in Table 1.
[0169] Table 1. Mean fluorescence intensity of antigen expression levels detected in primary cells and at different time points after sorting
[0170]
[0171] The background fluorescence intensity of negative host cells was 10.2. Significant cell proliferation began 4-8 weeks after transfection with the MICA gene, and the mean fluorescence intensity of antigen expression detected by flow cytometry with monoclonal antibodies ranged from 217 to 285. The mean fluorescence intensities of high-expressing single-antigen cells MICA001, MICA002, MICA004, MICA007, MICA008, MICA009, MICA010, and MICA011, detected at different time points after sorting, were 1958±57, 1337±29, 1601±15, 1704±44, 1584±63, 1334±10, 1691±78, and 1142±33, respectively. These values were significantly higher than those of the primary negative control host cells (9.46±0.66).
[0172] 5. Finally, the eight MICA single antigen cells and host cells not transfected with any MICA expression gene were inoculated into different wells of a 96-well plate to form a MICA single antigen cell panel. Eight different types of MICA antibodies were screened using a cytological ELISA assay. The specific experimental steps are as follows:
[0173] 1) Cell seeding
[0174] a. Add 100 μL of cell suspension to each well and seed 100,000 cells per well;
[0175] b. For each of the eight MICA single antigen cells, inoculate them into different wells, with at least three replicate wells for each cell type.
[0176] c. For host cells not transfected with any MICA-expressing gene, 100,000 cells were seeded per well and three replicate wells were set up as negative controls.
[0177] d. Ensure that cells are evenly distributed and avoid cell aggregation.
[0178] 2) Cell fixation: After 1 hour of static culture, the cells were washed twice with PBS to remove the culture medium and non-adherent cells.
[0179] 3) Closure:
[0180] a. Add 100 μL of blocking solution (such as 5% BSA) to each well and incubate at room temperature for 1 hour or at 4°C overnight.
[0181] b. Wash cells three times with PBS for 5 minutes each time to remove unbound blocking solution.
[0182] 4) Serum sample incubation:
[0183] a. Add 100 μL of test serum diluted 1:3 to each well and incubate at room temperature for 1-2 hours.
[0184] b. Wash cells three times with PBS for 5 minutes each time to remove unbound primary antibody.
[0185] c. In parallel with the serum samples, a monoclonal antibody detection panel was set up as a positive control for each antigen cell.
[0186] 5) Secondary Antibody Incubation:
[0187] a. Add 100 μL of diluted secondary antibody (HRP-labeled anti-human IgG for serum samples, HRP-labeled anti-mouse IgG for monoclonal antibody panels) to each well and incubate at room temperature for 1 hour.
[0188] b. Wash cells three times with PBS for 5 minutes each time to remove unbound secondary antibody.
[0189] 6) Color reaction:
[0190] a. Add 100 μL of TMB colorimetric solution to each well and incubate at room temperature in the dark for 10-30 minutes to observe the color change.
[0191] b. Add 50 μL of stop solution (such as 2M H2SO4) to each well to terminate the reaction.
[0192] c. Measure the absorbance at a wavelength of 450 nm using an enzyme-labeled instrument.
[0193] 7) The test results are shown in Table 2:
[0194] Table 2. Results of screening for 8 different types of MICA antibodies by cytological ELISA
[0195]
[0196] The experimental data summarized in the table above are the detection results of the experimental method of the present invention using sera collected in the laboratory that were identified as MICA antibody negative (sera 1-3) and positive (sera 4-10) by the single antigen microsphere method.
[0197] The mean and standard deviation of the reactivity values for the tested samples and the host cells used as negative controls were 0.104 and 0.015, respectively. The mean and standard deviation of the reactivity values for the positive control MICA monoclonal antibody and all MICA cells were 1.482 and 0.068, respectively. The reactivity values of the various MICA antibodies tested in this experiment ranged from 0.256 to 1.322, all significantly higher than the mean absorbance values of the negative cells. Each value in the table represents the average of three replicate wells.
[0198] Obviously, the above embodiments of the present invention are merely examples to more clearly illustrate the present invention, and are not limitations on the implementation methods of the present invention. For ordinary technicians in the relevant field, other different forms of changes or modifications can be made based on the above description. It is impossible to enumerate all implementation methods here. All obvious changes or modifications derived from the technical solution of the present invention are still within the scope of protection of the present invention.
Claims
1. Transplant type targeted single antigen cell combination, characterized in that, It includes screening host cells expressing rejection antigens, immortalizing them and knocking out the interfering antigen genes, expressing the rejection antigens and screening the resulting high-expressing cell lines / clones.
2. The transplant type targeted single antigen cell combination according to claim 1, characterized in that: The host cells expressing the rejection antigens include the main target cells of the transplant, the parenchymal cells of the organ or tissue known to be involved in the rejection reaction, or other cell types that have tissue homology with the transplant cells and have similar cell surface antigens.
3. A product for screening rejection antibodies, characterized in that: It comprises the transplant type-targeted single antigen cell combination according to claim 1 or 2.
4. The product according to claim 3, characterized in that It also includes a solid phase carrier for combining the transplant type-specific single antigen cell combination, and the solid phase carrier includes one or more of a polystyrene culture plate, a glass cover slip, a cell culture dish, a microporous filter membrane, and a biochip.
5. A method for preparing a transplant type targeted single antigen cell combination, characterized in that: include: 1) According to different transplant types, select the corresponding transplant type-specific tissue cells as host cells expressing rejection antigens; 2) immortalizing the host cells; 3) Knock out all known antigen genes that interfere with specific rejection antibodies; 4) Establish rejection antigen-expressing cell lines and screen high-expressing cell lines or clones.
6. The preparation method according to claim 5, characterized in that In step 1), the host cells expressing the rejection antigens include the main target cells of the transplant, the parenchymal cells of the organ or tissue known to cause rejection, or other cell types that have tissue homology with the transplant cells and have similar cell surface antigens; In step 2), the methods for immortalization treatment include: viral transformation, gene editing, transfection, fusion and chemical induction; in step 3), the methods for knocking out antigen genes include: CRISPR / Cas9, TALEN, ZFN and RNA interference technology; step 4) specifically includes: constructing a rejection antigen expression vector, transfecting or infecting cells, identifying expression levels, screening high-expressing cell lines, and / or further cloning high-expressing cell lines.
7. The preparation method according to claim 5 or 6, characterized in that: It also includes the treatment of non-adherent cells to allow them to adhere.
8. The preparation method according to claim 7, characterized in that Methods for adhesion treatment include: chemical treatment, physical treatment, bioengineering treatment and co-cultivation.
9. Use of the transplant-type targeted single antigen cell combination according to claim 1 or 2 in the preparation of a product for screening rejection antibodies.
10. The use according to claim 9, characterized in that The method for screening rejection antibodies includes: cytological ELISA detection method and cytological fluorescence signal detection method.