Composition for repairing Kras variation by RNA (Ribonucleic Acid) single-base editing technology and application of composition

Abstract

The invention relates to the field of single-base editing, in particular to a composition for repairing Kras variation through an RNA single-base editing technology and application of the composition, gRNA comprises a targeting sequence targeting KrasG12S nucleic acid molecules, and the nucleotide sequence of the targeting sequence is shown as any one of SEQ ID NO.2-5. According to the composition for repairing the Kras variation, AGT-TO-GGT fixed-point repair is carried out on a KrasG12S mutant non-small cell lung cancer mRNA transcript, a base A is deaminated into a base I at the RNA level, the base I is finally translated into a wild type Kras protein, the proliferation capacity of repaired cells is obviously inhibited, the cell apoptosis increase editing efficiency is high, the fidelity is high, the safety is high, and the composition has a good application prospect. A brand-new treatment strategy is provided for treatment of the same type of variant tumors.

Description

Technical Field

[0001] The present invention relates to the field of single-base editing, and in particular to a composition for repairing Kras mutations using RNA single-base editing technology and its use. Background Art

[0002] Globally, lung cancer ranks first in both morbidity and mortality among malignant tumors, with a five-year survival rate of only 18% (Siegel et al., 2018), making it a leading cause of death. The majority (80-85%) of lung cancers are non-small cell lung cancer (NSCLC), and patients often have local or distant metastases by the time they are diagnosed. Lung cancer has a wide range of treatment options, including targeted therapy, immunotherapy, chemoradiotherapy, and surgery, but prognostic improvements have not been significant, with a five-year survival rate of approximately 27% (95% CI: 25–30). Therefore, the development of novel inhibitors to improve lung cancer prognosis has significant scientific significance and potential application value.

[0003] Tumor development and progression is a complex, multifactorial, multi-step, and multi-stage process involving multiple components, including tumor overgrowth, the tumor microenvironment, tumor immunity, epigenetic modifications, invasion, and metastasis. Activation of oncogenes and inactivation of tumor suppressor genes are fundamental drivers of lung cancer. Approximately 60% of cancer driver genes in human lung adenocarcinoma have been identified, including the Kras driver gene. Kras is a murine sarcoma viral oncogene that acts as a switch within the cell, regulating physiological processes such as tumor cell growth and angiogenesis. Kras mutations can continuously stimulate cell growth. Kras mutations occur in 90% of pancreatic cancers, 36% of lung adenocarcinomas, and 51% of colorectal cancers, and are often associated with a poor prognosis. Wild-type Kras protein and its mutants exhibit a featureless, nearly globular structure lacking effective drug binding sites, making them less druggable. Currently, only targeted drugs targeting the KrasG12C mutant have been developed clinically; inhibitors directly targeting the KrasG12S mutant are lacking. Previous treatment strategies often kill cancer cells and / or reduce cell growth by inhibiting the formation of mutant proteins and / or inhibiting the function of abnormal proteins, but they are prone to induce the formation of new variants and make tumor cells drug-resistant.

[0004] The CRISPR / Cas gene editing system can effectively cut the genomes of prokaryotic and eukaryotic cells. Its core component is a ribonucleoprotein (RNP) complex formed by a small guide RNA (sgRNA) and a Cas effector protein. The sgRNA binds to the target nucleic acid through complementary base pairing, guiding the Cas effector protein to cut the target nucleic acid, thereby realizing the gene editing function. By performing targeted mutagenesis and fusion modification on the Cas protein, CRISPR / Cas is able to perform single-base substitution editing on the target nucleic acid molecule, i.e., single-base editing technology. Previous studies have shown that the use of CRISPR / Cas9 single-base editing tools to repair mutant genes such as KrasG12D and KrasG12S in cancer cells at the DNA level can effectively inhibit the progression of tumor cells. However, gene perturbation at the DNA level poses a greater safety risk and is one of the potential obstacles to its clinical application. RNA single-base editing technology performs base conversion on the target molecule at the transcript level, which theoretically has a better safety advantage. Summary of the Invention

[0005] In view of the shortcomings of the prior art described above, the object of the present invention is to provide a composition for repairing Kras mutations using RNA single-base editing technology and its use, so as to solve the problems in the prior art.

[0006] To achieve the above-mentioned and other related purposes, the present invention provides a method for repairing Kras by RNA single-base editing technology. G12S (SEQ ID NO: 1) variant gRNA or its encoding gene, wherein the gRNA includes a target Kras G12S The targeting sequence of the nucleic acid molecule, the nucleotide sequence of the targeting sequence is as shown in any one of SEQ ID NO. 2 to 5 or has a similarity of more than 80% with the sequence shown in any one of SEQ ID NO. 2 to 5. At the same time, a control group gRNA (Ctrl) (SEQ ID NO. 6) is set, which cannot target Kras G12S and human transcriptome sequences.

[0007] The present invention also provides a method for repairing Kras using RNA single base editing technology. G12S A variant composition comprising:

[0008] 1) the gRNA or the gene encoding the gRNA;

[0009] 2) A base editor fusion protein, or a nucleotide encoding the base editor fusion protein, wherein the base editor fusion protein includes a Cas protein domain and a deaminase domain.

[0010] The present invention also provides a nucleic acid construct, which comprises the gene encoding the gRNA in the aforementioned composition, the nucleotides encoding the base editor fusion protein, and a vector skeleton.

[0011] The present invention also provides use of the aforementioned composition or the aforementioned nucleic acid construct in preparing any of the following products:

[0012] 1) In vitro editing of Kras G12S Positive cellular RNA products;

[0013] 2) Prevention or treatment of Kras G12S Positive cancer products.

[0014] The present invention also provides an in vitro editing Kras G12S The method comprises: introducing the aforementioned gene editing composition or the aforementioned nucleic acid construct into a cell line containing Kras G12S Mutated isolated cells to repair the cellular Kras at the RNA level G12S mutation.

[0015] As described above, the composition of the present invention for repairing Kras mutations using RNA single-base editing technology and its use have the following beneficial effects: the xABE system has high editing efficiency and strong fidelity, and the fusion protein is smaller than the currently reported similar family proteins, and can be efficiently reprinted by adeno-associated virus (AAV); the present invention repairs mutants at the transcriptome level, and its safety is superior to genome-level editing; the present invention provides a new treatment strategy for the treatment of similar mutant tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a diagram of the guide RNA design and vector construction of the present invention.

[0017] Figure 2 This is a diagram for identifying the Kras genotype of A549 cells, a lung cancer model used in the present invention.

[0018] Figure 3 Repairing Kras for the gene editing vector of the present invention G12S Variant efficiency plot.

[0019] Figure 4 Kras of the present invention G12S Diagram of tumor cell proliferation ability and stemness evaluation after variant repair.

[0020] Figure 5 Kras of the present invention G12S Evaluation of tumor cell apoptosis and cell cycle profiles after variant repair.

[0021] Figure 6 Kras of the present invention G12S Tumor cell migration and invasion profiles were evaluated after variant repair.

[0022] Figure 7 Kras of the present invention G12S Transcriptome sequencing analysis of Kras mutation frequency and KRAS signaling pathway activation in A549 cells after variant repair.

[0023] Figure 8 This is a diagram of off-target analysis after xABE editing A549 cells of the present invention. DETAILED DESCRIPTION

[0024] The present invention uses CRISPR / Cas-mediated single-base editing technology to repair Kras at the mRNA level. G12S Mutating transcripts so that they are ultimately translated into wild-type Kras protein, thereby eliminating the genetic factors that drive the occurrence and development of lung adenocarcinoma, thereby inhibiting tumor cell growth. G12S The mutation is caused by the mutation of the codon encoding glycine at position 12, GGT, to AGT. The present invention uses adenine base editor (CRISPR / Cas13x.1adenine base editor, xABE) to modify Kras G12S AGT-TO-GGT site-specific repair is performed on mutant non-small cell lung cancer (NSCLC) mRNA transcripts, which deaminates base A to base I (functionally equivalent to base G) at the RNA level, ultimately leading to its translation into wild-type Kras protein. The repaired cells' proliferation ability is significantly inhibited, and cell apoptosis is increased.

[0025] The present invention provides a method for repairing Kras using RNA single-base editing technology. G12S A variant guide RNA (gRNA) or its encoding gene, wherein the gRNA includes a target Kras G12S A targeting sequence of a nucleic acid molecule, wherein the nucleotide sequence of the targeting sequence is as shown in any one of SEQ ID NOs. 2 to 5 or a sequence having a similarity of more than 80% with the sequence shown in any one of SEQ ID NOs. 2 to 5.

[0026] The Kras G12S The mutation means that, compared with normal cells, the glycine in the 12th codon encoding the Kras protein is replaced by serine, and the coding base changes from GGT to AGT.

[0027] The targeting sequence can bind to Kras G12SThe coding sequence undergoes base complementary pairing and can guide the single-base editing system to repair base G at the target site A.

[0028] In certain embodiments of the present invention, the gRNA further comprises a direct repeat sequence (DR sequence, SEQ ID NO: 7), wherein the direct repeat sequence is located at the 3' end of the gRNA, and the nucleotide sequence of the direct repeat sequence is as shown in SEQ ID NO. 7 or a sequence having more than 80% similarity to the sequence shown in SEQ ID NO. 7.

[0029] The terms "homology" or "identity" or "similarity" refer to the sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing corresponding positions in different polypeptides or nucleic acid molecules. When the same position in the sequence of the compared molecules is occupied by the same base or amino acid in the different sequences, then the molecules are homologous at that position. The degree of homology between sequences is determined as a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence should have less than 20% homology to one of the sequences disclosed herein. A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) having a certain percentage of sequence homology (e.g., 80%, 90%, 95%, 98%, or 99%) with another polynucleotide or polynucleotide region (or polypeptide or polypeptide region) means that, when compared, that percentage of bases (or amino acids) are identical in the two sequences being compared. This comparison and percentage homology or sequence identity can be determined using software programs and methods known in the art.

[0030] The similar sequence can be a sequence generated by replacing, deleting or adding one or more bases based on the sequence shown in SEQ ID NO. 2 to 6 of the present invention (including modifications of 1, 2, 3, 4, 5, 6, 7 or 8 bases on this basis).

[0031] The targeting sequence is located at the 3' end of the direct repeat sequence.

[0032] The present invention also provides a method for repairing Kras using RNA single base editing technology. G12S A variant composition (or xABE system) comprising:

[0033] 1) the gRNA or the gene encoding the gRNA;

[0034] 2) A base editor fusion protein, or a nucleotide encoding the base editor fusion protein, wherein the base editor fusion protein includes a Cas protein domain and a deaminase domain.

[0035] In certain embodiments of the present invention, the base editor fusion protein is an adenine single-base editor fusion protein.

[0036] The Cas protein domain and the deaminase domain are connected by a linker.

[0037] In certain embodiments of the present invention, the Cas protein domain is a Cas13 protein or a mutant thereof. The Cas protein is selected from any one of Cas13a, Cas13b, Cas13c, Cas13d, Cas13X / Y (Cas13bt), Cas13g-i or Cas13X.1.

[0038] In certain embodiments of the present invention, the Cas protein domain is miniCas13X.1, and the amino acid sequence of miniCas13X.1 is shown in SEQ ID NO.8.

[0039] In certain embodiments of the present invention, the adenine deaminase is selected from ADAR2 or a mutant thereof.

[0040] ADAR2 (Adenosine Deaminase, RNA-specific 2) is an adenosine deaminase that can catalyze the conversion of adenosine (A) in double-stranded RNA to inosine (I), thereby achieving A-to-I RNA editing.

[0041] The ADAR2 mutant is ADAR2dd, which has higher catalytic activity.

[0042] In certain embodiments of the present invention, the adenine deaminase is hADAR2dd, and the amino acid sequence is shown in SEQ ID NO. 9. The miniCas13X.1 is connected to hADAR2dd via a linker (SEQ ID NO. 10).

[0043] The gene encoding the gRNA and the nucleotide encoding the base editor fusion protein in the composition can be located in the same nucleic acid construct or in different nucleic acid constructs.

[0044] The term "nucleic acid construct" refers to an artificially constructed nucleic acid segment that can be introduced into target cells or tissues. The nucleic acid construct can be various expression vectors, each comprising a vector backbone (i.e., an empty vector) and an expression cassette. The term "expression cassette" refers to a sequence that has the potential to encode a protein.

[0045] The type of expression vector is not specifically limited. An expression vector refers to a nucleic acid molecule that allows the insertion of exogenous nucleotides without disrupting the vector's ability to replicate and / or integrate in a host cell. An expression vector may include a nucleic acid sequence that allows it to replicate in a host cell, such as an origin of replication. An expression vector may also include one or more selectable marker genes and other genetic factors. An expression vector is a vector that contains the necessary regulatory sequences to enable transcription and translation of an inserted gene or genes. The expression vector is selected from a eukaryotic expression vector or a prokaryotic expression vector.

[0046] The prokaryotic expression vector is selected from an Escherichia coli expression vector, a Bacillus subtilis expression vector or a Streptomyces expression vector. In a preferred embodiment, the prokaryotic expression vector is selected from an Escherichia coli expression vector.

[0047] The eukaryotic expression vector is selected from a yeast expression vector, an insect expression vector, or a mammalian expression vector. The mammalian expression vector is a non-viral expression vector or a viral expression vector. The viral expression vector is selected from a retroviral expression vector, a lentiviral expression vector, an adenoviral expression vector, and an adeno-associated viral expression vector. In a preferred embodiment, the eukaryotic expression vector is selected from a retroviral expression vector, which can be stably expressed in a cell line, and an example of a retroviral vector is pMSCV.

[0048] The host cell is selected from a eukaryotic host cell or a prokaryotic host cell. The eukaryotic host cell is selected from a fungus such as yeast, an insect, a bird, a plant, a nematode or a nematode or a mammalian host cell. A non-limiting example of an insect cell is a Spodoptera frugiperda cell. Examples of yeast host cells are Saccharomyces cerevisiae, Kluyveromyces lactis or Yarrowia lipolytica. Examples of mammalian cells are COS cells, baby hamster kidney cells, mouse L cells, LNCaP cells, Chinese hamster ovary (CHO) cells, human embryonic kidney (HEK) cells, African green monkey cells, CV1 cells, Vero or Hep-2 cells. Examples of prokaryotic host cells include bacterial cells, such as Escherichia coli, Streptomyces, Bacillus subtilis, Salmonella typhi or Mycobacterium.

[0049] The present invention also provides a nucleic acid construct, which comprises the gene encoding the gRNA in the aforementioned composition, the nucleotides encoding the base editor fusion protein, and a vector skeleton.

[0050] In some embodiments, the vector backbone is a circular DNA molecule or a linear DNA molecule that can autonomously replicate and express the inserted target gene in cells.

[0051] The nucleic acid construct contains various regulatory elements known in the art, such as promoters, replicons, enhancers, and transcription and translation start and stop codons. Examples of promoters include, but are not limited to, broad-spectrum promoters (e.g., CAG, Ubiquitin, etc.); host cell-dependent specific promoters (e.g., GFAP, Synapsin, etc.);

[0052] In some specific embodiments, the plasmid backbone can be selected from any one or more of pAAV-CAG, pAAV-TRE, pAAV-EF1a, pAAV-GFAP or pAAV-CMV backbones.

[0053] The present invention also provides use of the aforementioned composition or the aforementioned nucleic acid construct in preparing any of the following products:

[0054] 1) In vitro editing of Kras G12S Positive cellular RNA products;

[0055] 2) Prevention or treatment of Kras G12S Positive cancer products.

[0056] The Kras G12S The positive cells are selected from lung cancer cells, intestinal cancer cells, gastric cancer cells or pancreatic cancer cells.

[0057] Kras G12S Positive cancers include Kras G12S Mutated cancer.

[0058] The Kras G12S Positive cancers and / or cells may have other co-mutated genes such as P53 and RB1.

[0059] The Kras G12S The positive cancer is selected from lung cancer, intestinal cancer, gastric cancer or pancreatic cancer. The lung cancer is non-small cell lung cancer.

[0060] The present invention also provides an in vitro editing Kras G12S The method comprises: introducing the aforementioned gene editing composition or the aforementioned nucleic acid construct into a cell line containing Kras G12S Mutated isolated cells to repair the cellular Kras at the RNA level G12S mutation.

[0061] In some embodiments, the introduction method is selected from one or more of electroporation, liposome transfection, viral transduction, microinjection, particle bombardment, or gene gun transformation.

[0062] The method does not degrade the encoding Kras G12SThe mutant protein nucleic acid also non-selectively inhibits Kras G12S The function of the mutant protein is not affected by the editing process, but by repairing its incorrect codon at the mRNA level. The edited mRNA shows a sequence similar to that of wild-type Kras and has the same biological function, which re-encodes the wild-type Kras protein, thereby reducing the expression of Kras. G12S Mutant protein load.

[0063] The described method is limited to Kras G12S Repair of the mutant transcript does not involve the wild-type Kras transcript.

[0064] The method is for non-disease treatment or non-disease diagnosis purposes.

[0065] The present invention also provides a method for editing Kras in vivo. G12S The method comprises: introducing the aforementioned composition or the aforementioned nucleic acid construct into a cell line containing Kras G12S Mutant mammals can repair Kras at the RNA level G12S mutation.

[0066] In some embodiments, the mammals include but are not limited to humans, non-human primates, mice, rats, etc.

[0067] The present invention also provides a method for preventing and / or treating cancer, comprising administering a therapeutically effective amount of the aforementioned composition or the aforementioned nucleic acid construct to a subject in need thereof.

[0068] The subject in need is Kras G12S Positive cancer patients or other animals.

[0069] In certain embodiments of the present invention, the method further comprises typing the subject based on Kras mutation before administering the composition or the nucleic acid construct, thereby classifying the subject as Kras G12S Positive subjects and Kras G12S Negative subjects.

[0070] In certain embodiments of the present invention, the treatment method further comprises detecting Kras during the treatment process. G12S Expression and detection of mutant Kras G12S Activity of mutant lung cancer cells and detection of Kras G12S Tumor stemness of mutant lung cancer cells and detection of Kras G12S Apoptosis level of mutant lung cancer cells and detection of Kras G12S Cell cycle alterations in mutant lung cancer.

[0071] In the present invention, the aforementioned composition or nucleic acid construct may also be used in combination with other drugs.

[0072] In the composition or use provided by the present invention, the aforementioned composition or the aforementioned nucleic acid construct is a single active ingredient or is combined with other active ingredients to form a combined preparation. The other active ingredients can be various other drugs that can be used to treat cancer. The content of the active ingredient in the composition is generally a safe and effective amount, which should be adjustable by those skilled in the art. For example, the amount of the active ingredient administered generally depends on the patient's weight, the type of application, the condition and severity of the disease.

[0073] The treatment method can inhibit the proliferation rate of lung cancer cells, and / or change the cell cycle distribution of lung cancer cells, promote lung cancer cell apoptosis, inhibit lung cancer tissue growth, or a combination thereof.

[0074] The present invention also provides a cell, which is obtained by performing RNA single-base editing using the composition or the nucleic acid construct.

[0075] The present invention also provides a method for further evaluating the mutation level, KRAS signal strength, and gene editing off-target level of lung cancer after treatment, comprising the following steps:

[0076] (i) Kras G12S Mutant lung cancer cells were treated with xABE, and the mutational burden of the cells was revealed through deep transcriptome sequencing and analysis;

[0077] (ii) Analysis of Kras G12S The expression abundance of key genes in the KRAS pathway after repair, such as PIK3CA, MAPK1, and RAF1. The expression levels of these genes are positively correlated with KRAS pathway activity;

[0078] (iii) Transcriptome analysis was performed, and the off-target rate of xABE editing was used to evaluate the safety of gene editing.

[0079] The following describes the embodiments of the present invention through specific examples. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. The present invention may also be implemented or applied through various other specific embodiments, and the details in this specification may be modified or altered based on different viewpoints and applications without departing from the spirit of the present invention.

[0080] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing specific specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0081] When the embodiments provide numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the understanding of the prior art by those skilled in the art and the description of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention may also be used to implement the present invention.

[0082] Example 1: Targeting Kras G12S Variant gRNA design and repair vector xABE construction

[0083] a) Design targeting human Kras G12S mRNA (SEQ ID NO: 1), and were named gRNA1#, gRNA2#, gRNA 3#, and gRNA4# ( Figure 1 a). The nucleotide sequence of gRNA1# described in the present invention is shown in SEQ ID NO:2, the nucleotide sequence of gRNA2# is shown in SEQ ID NO:3, the nucleotide sequence of gRNA3# is shown in SEQ ID NO:4, and the nucleotide sequence of gRNA4# is shown in SEQ ID NO:5. gRNA1#, gRNA 2#, gRNA 3#, and gRNA 4# are combined with the DR sequence to form complete gRNA1, gRNA2, gRNA3, and gRNA4, respectively. The 3′ end of the gRNA sequence is the DR sequence, and the nucleotide sequence of the DR is shown in SEQ ID NO:7. A gRNA Ctrl is also set as a negative control group, and the gRNACtrl sequence is shown in SEQ ID NO:6.

[0084]

[0085] Primer design principles: Each gRNA target nucleic acid recognition region is 50 bases long. A mismatched base (C) is designed into the gRNA to form a mismatch with the A in the codon encoding the 12th glycine in Kras, AGT. This base is easily recognized and deaminated by xABE, resulting in the formation of the wild-type GGT transcript. Repair efficiency is highest when the mismatched base is located within 15 to 25 bases 5' of the gRNA recognition region. Therefore, the mismatched bases in gRNAs 1#, 2#, 3#, and 4# are placed at bases 15, 17, 20, and 25, respectively.

[0086] (b) The effector protein of the present invention is a fusion protein of Cas13X.1 and ADAR2dd with no endonuclease activity (amino acid sequences are shown in SEQ ID NOs: 8 and 9, respectively). The effector protein and gRNA are linked to the same plasmid vector minidCas13X.1+REPAIRv2 (hADAR2dd)+gRNA+EGFP by molecular cloning. Figure 1 b, the nucleotide sequence is shown in SEQ ID NO: 11), thereby constructing four gene repair vectors: xABE-gRNA 1, xABE-gRNA 2, xABE-gRNA 3, and xABE-gRNA 4, as well as the xABE-Ctrl control editing vector. The effector protein is expressed under the CAG broad-spectrum promoter, the gRNA is expressed under the U6 promoter, and the plasmid vector contains the EGFP fluorescent reporter gene.

[0087] The sequences of the xABE repair vector and the control vector were confirmed by DNA sequencing.

[0088] Example 2xABE-gRNA2 can repair Kras in non-small cell lung cancer G12S variant transcripts

[0089] a) Selecting non-small cell lung cancer cell line A549 cells as research subjects, the cells contain the Kras G12S Mutation site. The genome of the cell line was extracted by the phenol-chloroform method, and the Kras target region was amplified by PCR. The forward primer sequence of the amplification is shown in SEQ ID NO: 12, and the reverse primer sequence of the amplification is shown in SEQ ID NO: 13. Sequencing results indicate that A549 cells contain homozygous Kras. G12S mutation( Figure 2 ).

[0090] b) The xABE-gRNA 1, xABE-gRNA 2, xABE-gRNA 3, xABE-gRNA 4 gene repair vectors and the xABE-Ctrl control vector were introduced into A549 cells by lipofectamine transfection at a plasmid dosage of 1 μg / well (24-well plate) and cultured for 48 hours after transfection.

[0091] c) harvesting cells, isolating cell mRNA using the well-known TRIZOL method, and measuring Kras using real-time fluorescence quantitative method G12S The expression level of the Kras transcript. G12S The forward primer sequence is shown in SEQ ID NO: 14. G12S The reverse primer sequence is shown in SEQ ID NO: 15. The expression level of the GAPDH gene was selected as a reference. The forward primer sequence of the GAPDH amplification is shown in SEQ ID NO: 16, and the reverse primer sequence of the GAPDH amplification is shown in SEQ ID NO: 17. The results showed that the proportion of mutants repaired by the xABE-gRNA 2 vector was 49.84 ± 5.28% ( Figure 3 a). d) preparing transfected cells by the method described in step b), extracting cell mRNA by TRIZOL method, reverse-transcribing it, and then identifying Kras by the method described in step a). G12S Repair efficiency. Sequencing results indicate that after editing with the xABE-gRNA 2 vector, a significant proportion of the A at position 33 of the Kras transcript was repaired to a G. Figure 3 b).

[0092] This example demonstrates that the xABE-gRNA2 editing vector is used to correct Kras G12S Mutations are possible.

[0093] Example 3xABE-gRNA 2 repairs Kras G12S Mutations can suppress the malignancy of tumor cells

[0094] To prove xABE fix Kras G12S After mutation, the malignancy of tumor cells was suppressed. The present invention employed methods well-known in the biological field to assess tumor viability, stemness, apoptosis, cell cycle, invasion, and migration. Specifically, A549 cells were seeded in 96-well plates. When the cell density reached approximately 70%, they were transfected with the xABE-gRNA2 repair vector and the xABE-Ctrl control vector using liposome transfection. Three biological replicates were performed for each sample, with a transfection dose of 100 ng / well. The cells were cultured for 48 hours after transfection.

[0095] 1) The CCK-8 method was used to detect the proliferation ability of tumor cells in each group after treatment. The experimental results showed that xABE-gRNA 2 repaired Kras G12S Mutations can inhibit the activity of A549 cells ( Figure 4 a).

[0096] 2) A549 cells were seeded in 24-well plates and transfected with the xABE-gRNA2 repair vector and the xABE-Ctrl control vector using the liposome method. Three biological replicates were performed for each sample, the transfection dose was 1000 ng / well, and the cells were cultured for 48 hours after transfection. The expression level of the Sox2 gene was determined by real-time fluorescence quantification. The Sox2 amplification forward primer sequence is shown in SEQ ID NO: 18, and the Sox2 amplification reverse primer sequence is shown in SEQ ID NO: 19. The results indicate that after xABE-gRNA 2 vector editing, the Sox2 expression level in A549 cells decreased significantly, indicating that the stemness of tumor cells was reduced and the malignancy was suppressed ( Figure 4 b).

[0097] 3) PI staining was used to evaluate cell apoptosis after gene editing. Flow cytometry analysis results showed that xABE-gRNA2 repaired Kras G12S Mutation can increase the apoptosis level of A549 cells ( Figure 5 a, b).

[0098] 4) Propidium iodide staining was used to evaluate the cell cycle after gene editing. Flow cytometry analysis results showed that xABE-gRNA 2 repaired Kras G12S The mutation did not change the cell cycle of A549 cells ( Figure 5 c, d).

[0099] 5) Using the scratch assay, it was demonstrated that xABE-gRNA 2 repaired Kras G12S The mutation inhibits the migration ability of tumor cells ( Figure 6 a,b).

[0100] 6) Transwell assay demonstrated that xABE-gRNA2 repaired Kras G12S Mutation inhibits the invasion and migration ability of tumor cells ( Figure 6 c, d).

[0101] Example 4 Transcriptome sequencing reveals Kras G12S After mutation repair, A549 cell proliferation-related signaling pathways were significantly inhibited

[0102] a) A549 cells were seeded in 10 cm culture dishes. When the cell density reached approximately 70%, they were transfected with the xABE-gRNA2 repair vector and the xABE-Ctrl control vector using lipofectamine. Two biological replicates were performed for each sample, with a transfection dose of 20 μg / dish. Culture was continued for 48 hours after transfection.

[0103] b) Enrichment of EGFP by flow cytometry + Cells, each group has about 300,000 cells. The experimental method is shown in the figure below. Figure 7 a;

[0104] c) extracting mRNA from cells using TRIZOL and performing transcriptome sequencing;

[0105] Transcriptome sequencing results suggest that the xABE-gRNA 2 treatment group (1) Kras G12S The repair efficiency was 69.23% in the xABE-gRNA 2 treatment group (2) Kras G12S The repair efficiency was 48.65%, while the xABE-Ctrl control group showed Kras G12S The proportion of variants remains 100.00% ( Figure 7 b~d). Based on the fact that the control group xABE-gRNA 2 treatment group (1) has a higher editing efficiency, the present invention compared the transcriptome differences between it and the control group cells, and found that the expression levels of KRAS pathway-related genes were reduced after the mutation was repaired ( Figure 7 e, f). The above results reveal that the xABE-gRNA 2 system of the present invention has the ability to inhibit non-small cell lung cancer.

[0106] In addition, the present invention also screened ten targets and related genes with high homology to gRNA2 through homology analysis, and confirmed that the expression of homologous genes was almost unaffected by xABE ( Figure 8 a, b), proving that xABE has high targeting and safety.

[0107] The nucleotide and amino acid sequences used in the present invention are as follows:

[0108] Kras G12S Base sequence (SEQ ID NO: 1, GGT>AGT):

[0109] ATGACTGAATATAAACTTGTGGTAGTTGGAGCTAGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCTTTTATTGAAACATCAGCAAAGACAAGACAGAGAGTGGAGGATGCTTTTTATACATTGGTGAGAGAGATCCGACAATACAGATTGAAAAAAATCAGCAAAGAAGAAAAGACTCCTGGCTGTGTGAAAATTAAAAAATGCATTATAATGTAA

[0110] MinidCas13x.1 Amino Acid Sequence (SEQ ID NO:8)

[0111] LSMYCLKDSRFTKAWDKRVLLFRDILAQLGRIPAEAYEYYHGEQGDKKRANDNEGTNPKRHKDKFIEFALHYLEAQHSEICFGRRHIVREEAGAGDEHKKHRTKGKVVVDFSKKDEDQSYYISKNNVIVRIDKNAGPRSYRMGLNELKYLVLLSLQGKGDDAIAKLYRYRQHVENILDVVKVTDKDNHVFLPRFVLEQHGIGRKAFKQRIDGRVKHVRGVWEKKKAATNEMTLHEKARDILQYVNENCTRSFNPGEYNRLLVCLVGKDVENFQAGLKRLQLAERIDGRVYSIFAQTSTINEMHQVVCDQILNRLCRIGDQKLYDYVGLGKKDEIDYKQKVAWFKEHISIRRGFLRKKFWYDSKKGFAKLVEEHLESGGGQRDVGLDKKYYHIDAIGRFEGANPALYETLARDRLCLMMAQYFLGSVRKELGNKIVWSNDSIELP

[0112] REPAIRv2(hADAR2dd)(SEQ ID NO:9)

[0113] QLHLPQVLADAVSRLVLGKFGDLTDNFSSPHARRKVLAGVVMTTGTDVKDAKVISVSTGGKCINGEYMSDRGLALNDCHAEIISRRSLLRFLYTQLELYLNNKDDQKRSIFQKSERGGFRLKENVQFHLYISTSPCGDARIFSPHEPILEEPADRHPNRKARGQLRTKIESGQGTIPVRSNASIQTWDGVLQGERLLTMSCSDKIARWNVVGIQGSLLSIFVEPIYFSSIILGSLYHGDHLSRAMYQRISNIEDLPPLYTLNKPLLSGISNAEARQPGKAPNFSVNWTVGDSAIEVINATTGKDELGRASRLCKHALYCRWMRVHGKVPSHLLRSKITKPNVYHESKLAAKEYQAAKARLFTAFIKAGLGAWVEKPTEQDQFSLT

[0114] Linker sequence (SEQ ID NO:10)

[0115] GGGGGSGGGGSGGGGSGGGGS minidCas13X.1+REPAIRv2(hADAR2dd)+gRNA+EGFP(SEQID NO:11)

[0116] CGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCT

[0117] GATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTC

[0118] CCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCT

[0119] GAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGA

[0120] GTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTAT

[0121] CCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAG

[0122] TACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCAT

[0123] AACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACC

[0124] GCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGC

[0125] CATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTA

[0126] ACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGC

[0127] AGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGC

[0128] GTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACA

[0129] CGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGAT

[0130] TAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAAT

[0131] TTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGT

[0132] TCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTA

[0133] ATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTAC

[0134] CAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAG

[0135] CCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTA

[0136] CCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGA

[0137] TAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTA

[0138] CACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGC

[0139] GGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAA

[0140] ACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCT

[0141] CGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTG

[0142] CTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTCTCGAGgagggcctatttcccatgattccttcatat

[0143] ttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtt

[0144] tgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaggacgaaacaccggggtcttcga

[0145] tattcaagcgtcggaagacctgctggagcagcccccgatttgtggggtgattacagcTTTTTTTgtggacggtGATATCggcattgattattgactagttatta

[0146] atagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccat

[0147] tgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgt

[0148] atcatatgccaagtccgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttacgggactttcctacttggcagtacatctac

[0149] gtattagtcatcgctattaccatggtgatgcggttttggcagtacaccaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaat

[0150] gggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaataaccccgccccgttgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataa

[0151] gcagaggtcgtttagtgaaccgtcagatcactagtagctttattgcggtagtttatcacagttaaattgctaacgcagtcagtgctcgactgatcacaggtaagtatcaag

[0152] gttacaagacaggtttaaggaggccaatagaaactgggcttgtcgagacagagaagattcttgcgtttctgataggcacctattggtcttactgacatccactttgcctttc

[0153] tctccacagggtacCGAAGCCGCTAGTCGACgccaccATGCCCAAGAAGAAGCGGAAGGTGCTGAGCATGTAC

[0154] TGCCTGAAGGACAGCAGATTCACCAAGGCCTGGGATAAGCGGGTGCTGCTGTTCAGAGACATCCTGG

[0155] CCCAGCTGGGAAGAATCCCCGCCGAGGCCTACGAGTACTACCACGGCGAGCAGGGTGATAAGAAGA

[0156] GAGCTAACGACAATGAGGGCACAAATCCCAAGCGGCACAAGGACAAGTTCATCGAATTTGCACTGCA

[0157] CTACCTGGAAGCCCAGCACAGCGAGATCTGCTTCGGCAGACGCCACATCGTGCGGGAAGAGGCCGG

[0158] CGCCGGCGATGAGCACAAGAAGCACCGGACCAAGGGAAAGGTGGTGGTGGACTTCAGCAAAGAAGG

[0159] ACGAGGACCAGAGCTACTATATCTCCAAGAACAACGTGATCGTGCGGATCGACAAGAACGCCGGCCC

[0160] TAGAAGCTACCGGATGGGCCTGAACGAGCTGAAGTACCTCGTGCTGCTGAGCCTGCAGGGGAAGGG

[0161] CGACGATGCCATCGCCAAGCTGTACAGATACAGACAGCACGTGGAGAACATCCTGGATGTGGTGAAG

[0162] GTGACCGATAAGGATAACCACGTGTTCCTGCCCCGCTTCGTGCTGGAGCAGCACGGCATCGGCAGAA

[0163] AGGCCTTCAAGCAGCGGATCGATGGACGGGTGAAGCACGTGCGGGGCGTGTGGGAGAAGAAGAAG

[0164] GCCGCCACCAATGAAATGACCCTGCACGAGAAGGCCAGAGACATCCTGCAGTACGTGAACGAAAAC

[0165] TGCACCCGGTCCTTCAACCCTGGCGAATACAACAGACTGCTGGTGTGCCTGGTGGGCAAGGACGTGG

[0166] AGAACTTTCAGGCCGGCCTGAAGCGGCTGCAGCTGGCCGAAAGGATCGATGGCCGGGTGTACTCCAT

[0167] CTTCGCCCAGACCAGCACCATCAATGAGATGCACCAGGTGGTGTGCGACCAGATCCTGAACCGGCTG

[0168] TGCAGAATCGGCGACCAGAAGCTGTACGATTACGTGGGACTGGGCAAGAAGGACGAAATCGACTAC

[0169] AAGCAGAAGGTGGCCTGGTTCAAGGAGCACATCAGCATCCGGAGAGGATTCCTGAGAAAGAAGTTC

[0170] TGGTACGATAGCAAGAAGGGATTCGCAAAGCTGGTGGAGGAACACCTGGAGTCCGGCGGCGGCCAG

[0171] CGCGACGTGGGCCTGGACAAGAAGTACTACCACATCGACGCCATCGGCAGATTCGAGGGCGCCAACC

[0172] CCGCCCTGTACGAGACCCTGGCCAGAGATCGGCTGTGCCTCATGATGGCCCAGTACTTCCTGGGCAGC

[0173] GTGAGAAAGGAACTGGGCAACAAGATTGTGTGGAGCAACGACAGCATCGAACTGCCTCCCAAGAAG

[0174] AAGCGGAAGGTGGGTGGAGGCGGAGGTTCTGGGGGAGGAGGTAGTGGCGGTGGTGGTTCAGGAGG

[0175] CGGCGGAAGCcagctgcatttaccgcaggttttagctgacgctgtctcacgcctggtcctgggtaagtttggtgacctgaccgacaacttctcctcccctcacg

[0176] ctcgcagaaaagtgctggctggagtcgtcatgacaacaggcacagatgttaaagatgccaaggtgataagtgtttctacaggaggcaaatgtattaatggtgaatacat

[0177] gagtgatcgtggccttgcattaaatgactgccatgcagaaataatatctcggagatccttgctcagatttctttatacacaacttgagctttacttaaataacaaagatgatc

[0178] aaaaaagatccatctttcagaaatcagagcgaggggggtttaggctgaaggagaatgtccagtttcatctgtacatcagcacctctccctgtggagatgccagaatcttc

[0179] tcaccacatgagccaatcctggaagaaccagcagatagacacccaaatcgtaaagcaagaggacagctacggaccaaaatagagtctggtcaggggacgattcca

[0180] gtgcgctccaatgcgagcatccaaacgtgggacggggtgctgcaaggggagcggctgctcaccatgtcctgcagtgacaagattgcacgctggaacgtggtgggc

[0181] atccagggatcactgctcagcattttcgtggagcccatttacttctcgagcatcatcctgggcagcctttaccacggggaccacctttccagggccatgtaccagcggat

[0182] ctccaacatagaggacctgccacctctctacaccctcaacaagcctttgctcagtggcatcagcaatgcagaagcacggcagccagggaaggcccccaacttcagt

[0183] gtcaactggacggtaggcgactccgctattgaggtcatcaacgccacgactgggaaggatgagctgggccgcgcgtcccgcctgtgtaagcacgcgttgtactgtc

[0184] gctggatgcgtgtgcacggcaaggttccctcccacttactacgctccaagattaccaagcccaacgtgtaccatgagtccaagctggcggcaaaggagtaccaggc

[0185] cgccaaggcgcgtctgttcacagccttcatcaaggcggggctgggggcctgggtggagaagcccaccgagcaggaccagttctcactcacgTACCCATAC

[0186] GACGTACCAGATTACGCTTAAgaattcCTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAG

[0187] CCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCC

[0188] TAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGG

[0189] GCAGGACAGCAAGGGGGAGGATTGGGAAGAgAATAGCAGGCATGCTGGGGAgcggccgcCGTTACATAA

[0190] CTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTA

[0191] TGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC

[0192] CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATG

[0193] GCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTA

[0194] GTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCA

[0195] CGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGA

[0196] CTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAG

[0197] GTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGcatggtgagcaagggcgaggagctgttcaccggggt

[0198] ggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagt

[0199] tcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagca

[0200] cgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggc

[0201] gacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctat

[0202] atcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacac

[0203] ccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgct

[0204] ggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaGGATCCctgtgccttctagttgccagccatctgttgtttgcccctcccccg

[0205] tgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggg

[0206] gcaggacagcaagggggaggattgggaaAacaatagcaggcatgctggggatgcggtgggctctatggAAGCTT

[0207]

[0208]

[0209] The above examples are intended to illustrate the embodiments disclosed herein and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and variations of the methods in the invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications apparent to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. A method for repairing Kras using RNA single-base editing technology G12S The variant gRNA or its encoding gene is characterized in that The gRNA includes a target for Kras G12S A targeting sequence of a nucleic acid molecule, wherein the nucleotide sequence of the targeting sequence is as shown in any one of SEQ ID NOs: 2 to 5 or has a similarity of more than 80% with the sequence shown in any one of SEQ ID NOs: 2 to 5.

2. The gRNA or its encoding gene according to claim 1, characterized in that The gRNA further includes a direct repeat sequence, which is located at the 3' end of the gRNA. The nucleotide sequence of the direct repeat sequence is as shown in SEQ ID NO.7 or has more than 80% similarity to the sequence shown in SEQ ID NO.

7.

3. A composition for repairing KrasG12S mutation using RNA single-base editing technology, characterized in that: The composition comprises: 1) The gRNA according to claim 1 or 2 or the gene encoding the gRNA; 2) A base editor fusion protein, or a nucleotide encoding the base editor fusion protein, wherein the base editor fusion protein includes a Cas protein domain and a deaminase domain.

4. The composition according to claim 3, characterized in that The base editor fusion protein is an adenine single-base editor fusion protein; and / or, the Cas protein domain is a Cas13 protein or a mutant thereof.

5. The composition according to claim 3, characterized in that The Cas protein domain is selected from any one of Cas13a, Cas13b, Cas13c, Cas13d, Cas13X / Y, Cas13g-i or Cas13X.1; preferably, the Cas protein domain is miniCas13X.1, and the amino acid sequence of the miniCas13X.1 is shown in SEQ ID NO:

8.

6. The composition according to claim 3, characterized in that The deaminase domain is selected from ADAR2 or a mutant thereof; preferably, the mutant of ADAR2 is ADAR2dd, and more preferably, the deaminase domain is hADAR2dd, the amino acid sequence of which is shown in SEQ ID NO:

9.

7. A nucleic acid construct, characterized in that The nucleic acid construct comprises the gene encoding the gRNA in the composition of claim 3, nucleotides encoding the base editor fusion protein, and a vector backbone.

8. Use of the composition according to any one of claims 3 to 6 or the nucleic acid construct according to claim 7 in the preparation of any of the following products: 1) In vitro editing of Kras G12S Positive cellular RNA products; 2) Prevention or treatment of Kras G12S Positive cancer products.

9. The use according to claim 8, characterized in that The Kras G12S Positive cells are selected from lung cancer cells, intestinal cancer cells, gastric cancer cells or pancreatic cancer cells, and / or, the Kras G12S The positive cancer is selected from lung cancer, intestinal cancer, gastric cancer or pancreatic cancer. Preferably, the lung cancer is non-small cell lung cancer.

10. A method for editing Kras in vitro G12S The method of RNA, characterized in that The method comprises: introducing the composition according to any one of claims 3 to 6 or the nucleic acid construct according to claim 7 into a cell line comprising Kras G12S Mutated isolated cells to repair the cellular Kras at the RNA level G12S mutation.

11. A cell obtained by performing RNA single-base editing using the composition according to any one of claims 3 to 6 or the nucleic acid construct according to claim 7.

Images