Compounds and methods for modulating SMN2

Abstract

Compounds, methods, and pharmaceutical compositions for modulating SMN2RNA and / or protein in a cell or subject are provided. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom of a neurodegenerative disorder. Such symptoms include: reduced muscle strength; a person cannot sit straight, stand and / or walk, or the ability thereof is reduced; neuromuscular activity is reduced; the electrical activity of one or more muscles is reduced; the respiratory action is reduced; without help, no eating, drinking and / or breathing or its ability is reduced; weight loss or weight gain reduction; and / or the survival rate is reduced.

Description

[0001] This application is a divisional application of Chinese Patent Application No. 202180017318.9, filed on February 26, 2021, entitled "Compounds and Methods for Regulating SMN2," the original application being the national phase application of International Application No. PCT / US2021 / 019934. This application claims the benefit of U.S. Provisional Patent Application No. US62 / 983545, filed on February 28, 2020, which is incorporated herein by reference in its entirety.

[0002] Sequence Listing

[0003] This application is submitted together with an electronic sequence listing. The sequence listing is provided as a file titled BIOL0367WOSEQ_ST25.txt, created on February 26, 2021, and is 44KB in size. Information from the electronic sequence listing is incorporated herein by reference in its entirety. Technical Field

[0004] Compounds, methods, and pharmaceutical compositions for regulating SMN2 RNA in cells or subjects are provided. These compounds, methods, and pharmaceutical compositions can be used to improve at least one symptom of neurodegenerative diseases. Such symptoms include: decreased muscle strength; inability to sit, stand, and / or walk, or reduced ability thereof; decreased neuromuscular activity; decreased electrical activity in one or more muscles; decreased respiration; inability to eat, drink, and / or breathe without assistance, or reduced ability thereof; weight loss or decreased weight gain; and / or decreased survival. Background Art

[0005] Proximal spinal muscular atrophy (SMA) is a hereditary neurodegenerative disease characterized by the loss of motor neurons in the spinal cord. SMA is an early-onset autosomal recessive disorder and a leading genetic cause of infant mortality. The severity of SMA varies from patient to patient and is therefore classified into four types. Type I SMA is the most severe form, presenting at birth or within 6 months and usually leading to death within 2 years. Children with type I SMA are unable to sit or walk. Type II SMA is an intermediate form, and patients are able to sit but cannot stand or walk. Type III SMA (a chronic form of the disease) typically develops after 18 months of age (Lefebvre et al., Hum. Mol. Genet., 1998, 7, 1531-1536). Type IV SMA is a milder form and usually develops after age 18, sometimes after age 10; patients with type IV SMA experience limited, mild motor impairment, are able to walk in adulthood, and usually do not have respiratory or nutritional problems (Farrar et al., Ann. Neurol., 2017, 81, 355-368; D'Amico et al., Orphanet J. of Rare Diseases, 2011, 6:71).

[0006] The molecular basis of SMA is the loss of two copies of the survival motor neuron gene 1 (SMN1), also known as the SMN telomere, which encodes a protein believed to be part of a multiprotein complex involved in snRNP biogenesis and recycling. A nearly identical gene, SMN2 (also known as the SMN centromere), resides in a repetitive region on chromosome 5q13 and regulates disease severity. Although SMN1 and SMN2 have the potential to encode the same protein, expression of the normal SMN1 gene results only in the expression of the full-length survival motor neuron (SMN) protein, while expression of the SMN2 gene results in two distinct protein forms: the full-length SMN2 protein and the truncated SMN2 protein (SMNΔ7 protein). SMN2 contains a translational silencing mutation at exon 7+6, which leads to inefficient inclusion of exon 7 in the SMN2 transcript. Therefore, the dominant form of SMN2 is a truncated form lacking exon 7, which is unstable and inactive (Cartegni and Kraner, Nat. Genet., 2002, 30, 377-384). Expression of the SMN2 gene results in approximately 10-20% of the full-length SMN protein and 80-90% of the unstable / nonfunctional SMNΔ7 protein. SMN proteins play a recognized role in spliceosome assembly and also mediate mRNA transport in neuronal axons and nerve terminals.

[0007] The objective of this article is to provide compounds, methods, and pharmaceutical compositions for the treatment of SMA. Summary of the Invention

[0008] This document provides compounds, methods, and pharmaceutical compositions for regulating SMN2 RNA splicing in cells or subjects. In some embodiments, the compound used to regulate SMN2 RNA splicing is an oligomeric compound. In some embodiments, the oligomeric compound increases the amount of SMN2 RNA including exon 7. In some embodiments, the oligomeric compound increases the expression of full-length SMN2 protein. In some embodiments, the oligomeric compound comprises a modified oligonucleotide. In some embodiments, the subject has a neurodegenerative disease. In some embodiments, the subject has spinal muscular atrophy (SMA).

[0009] Methods for improving at least one symptom of a neurodegenerative disease are also provided. In some embodiments, the neurodegenerative disease is SMA. In some embodiments, symptoms include: decreased muscle strength; inability to sit, stand, and / or walk, or a reduced ability thereof; decreased neuromuscular activity; decreased electrical activity in one or more muscles; decreased respiration; inability to eat, drink, and / or breathe without assistance, or a reduced ability thereof; weight loss or decreased weight gain; and / or decreased survival. In some embodiments, modified oligonucleotides for treating SMA are provided herein. DETAILED DESCRIPTION

[0010] It should be understood that the foregoing general description and the following detailed description are exemplary and illustrative only and are not restrictive. In this document, the use of the singular includes the plural unless otherwise specified. As used herein, the use of “or” means “and / or” unless otherwise specified. Furthermore, the use of the term “including” and other forms (e.g., “includes” and “included”) is not restrictive. Similarly, unless otherwise specified, terms such as “element” or “component” cover elements and components comprising one unit as well as elements and components comprising more than one subunit.

[0011] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions thereof cited in this application, including but not limited to patents, patent applications, articles, books and papers, as well as the GenBank and NCBI reference sequence records relating to the documents discussed herein, are expressly incorporated by reference in their entirety.

[0012] definition

[0013] Unless specifically defined otherwise, the nomenclature, procedures, and techniques used in conjunction with the analytical chemistry, synthetic organic chemistry, and pharmaceutical and pharmaceutical chemistry described herein are well-known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications and data cited throughout this disclosure are incorporated herein by reference in their entirety.

[0014] Unless otherwise indicated, the following terms have the following meanings:

[0015] As used herein, “2’-deoxyribonucleoside” means a nucleoside containing a 2’-H(H)-deoxyribosyl sugar moiety. In some embodiments, the 2’-deoxyribonucleoside is a 2’-β-D-deoxyribonucleoside containing a 2’-β-D-deoxyribosyl sugar moiety having the β-D conformation found in naturally occurring deoxyribonucleic acid (DNA). In some embodiments, the 2’-deoxyribonucleoside may contain modified nucleotides or may contain RNA nucleotides (uracil).

[0016] As used herein, “2'-MOE” means that the 2'-OH group of the ribosyl sugar moiety is replaced by the 2'-OCH2CH2OCH3 group. The “2'-MOE sugar moiety” is the sugar moiety in which the 2'-OH group of the ribosyl sugar moiety is replaced by the 2'-OCH2CH2OCH3 group. Unless otherwise indicated, the 2'-MOE sugar moiety is β-D configured. “MOE” means O-methoxyethyl.

[0017] As used in this article, "2'-MOE nucleoside" refers to a nucleoside containing the 2'-MOE sugar moiety.

[0018] As used herein, “2'-NMA” means that the 2'-OH group of the ribosyl sugar moiety is replaced by the -O-CH2-C(=O)-NH-CH3 group. The “2'-NMA sugar moiety” is a sugar moiety in which the 2'-OH group of the ribosyl sugar moiety is replaced by the 2'–O-CH2-C(=O)-NH-CH3 group. Unless otherwise indicated, the 2'-NMA sugar moiety is β-D configured. “NMA” means ON-methylacetamide.

[0019] As used in this article, "2'-NMA nucleoside" refers to a nucleoside containing the 2'-NMA sugar moiety.

[0020] As used herein, “2'-OMe” means the 2'-OH group of the ribosyl sugar moiety is replaced by the 2'-OCH3 group. “2'-OMe sugar moiety” is the sugar moiety in which the 2'-OH group of the ribosyl sugar moiety is replaced by the 2'-OCH3 group. Unless otherwise indicated, the 2'-OMe sugar moiety is β-D configured. “OMe” means O-methyl.

[0021] As used herein, “2’-OMe nucleoside” means a nucleoside containing a 2’-OMe sugar moiety. As used herein, “2’-substituted nucleoside” means a nucleoside containing a 2’-substituted sugar moiety. As used herein, “2’-substituted” with respect to the sugar moiety means a sugar moiety containing at least one 2’-substituent other than H or OH.

[0022] As used herein, "5-methylcytosine" refers to cytosine modified with a methyl group attached to the 5-position. 5-methylcytosine is a modified nucleobase.

[0023] As used in this article, “administration” means providing a medicine to the subject.

[0024] As used herein, “improvement” in relation to treatment means an improvement in at least one symptom relative to the same symptom in the absence of said treatment. In some embodiments, improvement is a reduction in the severity or frequency of symptoms, or a delayed onset of symptoms, or a slower progression of severity or frequency. In some embodiments, symptoms include: decreased muscle strength; inability to sit, stand, and / or walk, or a reduced ability thereof; decreased neuromuscular activity; decreased electrical activity in one or more muscles; decreased respiration; inability to eat, drink, and / or breathe without assistance, or a reduced ability thereof; weight loss or decreased weight gain; and / or decreased survival.

[0025] As used herein, “antisense activity” means any detectable and / or measurable change attributable to the hybridization of an antisense compound with its target nucleic acid.

[0026] As used herein, “antisense compound” means an oligomeric compound or oligodimer capable of achieving at least one antisense activity.

[0027] As used in this article, "bicyclic nucleoside" or "BNA" refers to a nucleoside that contains a bicyclic sugar moiety.

[0028] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In some embodiments, the first ring of the bicyclic sugar moiety is a furanyl moiety. In some embodiments, the furanyl moiety is a ribosyl moiety. In some embodiments, the bicyclic sugar moiety does not contain a furanyl moiety.

[0029] As used herein, “cerebrospinal fluid” or “CSF” refers to the fluid that fills the space surrounding the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” refers to a fluid that has been prepared or manufactured to have some of the properties of cerebrospinal fluid.

[0030] As used herein, “cEt” refers to a 4' to 2' bridge replacing the 2'OH- group of the ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2', and wherein the methyl group of the bridge is in the S configuration. “cEt sugar moiety” is a bicyclic sugar moiety in which a 4' to 2' bridge replaces the 2'OH- group of the ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2', and wherein the methyl group of the bridge is in the S configuration. “cEt” also refers to a bound ethyl group.

[0031] As used in this article, "cEt nucleoside" refers to a nucleoside that contains the cEt sugar moiety.

[0032] As used herein, a "chiral-rich cluster" refers to a group of molecules with the same molecular formula, wherein the number or percentage of molecules within the cluster containing a specific stereochemical configuration at a particular chiral center is greater than the expected number or percentage of molecules within the cluster containing the same specific stereochemical configuration at the same specific chiral center when the specific chiral center is stereorandom. A chiral-rich cluster of molecules having multiple chiral centers per molecule may contain one or more stereorandom chiral centers. In some embodiments, the molecule is a modified oligonucleotide. In some embodiments, the molecule is a compound comprising a modified oligonucleotide.

[0033] As used herein, “complementary” for an oligonucleotide means that, when the nucleotide sequence of the oligonucleotide is aligned in a relative direction with that of another nucleic acid, at least 70% of the nucleotides of the oligonucleotide or one or more portions thereof are hydrogen-bonded to each other with the nucleotides of the other nucleic acid or one or more portions thereof. Complementary nucleotides are nucleotides that are capable of forming hydrogen bonds with each other. Complementary nucleotide pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or target nucleic acids do not necessarily have nucleotide complementarity at every nucleoside. Instead, some mismatches are permissible. As used herein, “completely complementary” or “100% complementary” for an oligonucleotide or a portion thereof means that the oligonucleotide or a portion thereof is complementary to each nucleotide of the shorter of the two oligonucleotides, or, if the oligonucleotides are of the same length, complementary at every nucleoside.

[0034] As used in this article, in the context of oligonucleotides, "continuous" means that nucleosides, nucleobases, sugar moieties, or internucleotide bonds are adjacent to each other. For example, "continuous nucleobases" means nucleobases that are adjacent to each other in the sequence.

[0035] As used herein, “hybridization” refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. Although not limited to a specific mechanism, the most common hybridization mechanisms involve hydrogen bonding between complementary nucleobases, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds.

[0036] As used herein, “nucleoside linkage” refers to a covalent linkage between consecutive nucleosides in an oligonucleotide. As used herein, “modified nucleoside linkage” refers to any nucleoside linkage other than a phosphodiester nucleoside linkage. “Thiophosphate nucleoside linkage” is a modified nucleoside linkage in which one of the non-bridging oxygen atoms in the phosphodiester nucleoside linkage is replaced by a sulfur atom.

[0037] As used in this article, “mismatch” or “non-complementary” means that when the first oligonucleotide and the second oligonucleotide are aligned, the nucleobases of the first oligonucleotide are not complementary to the corresponding nucleobases of the second oligonucleotide or the target nucleic acid.

[0038] As used in this article, "motif" refers to the pattern of linkages between unmodified and / or modified sugar moieties, nucleobases, and / or nucleosides in an oligonucleotide.

[0039] As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety containing a modification (e.g., a substituent) that does not form a bridge between two atoms of the sugar to form a second ring.

[0040] As used herein, “nucleobase” means an unmodified or modified nucleobase. As used herein, an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. “5-methylcytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases. As used herein, “nucleobase sequence” refers to the sequence of consecutive nucleobases in a target nucleic acid or oligonucleotide, regardless of any sugar or nucleoside linkage modifications.

[0041] As used herein, "nucleoside" means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are either independently unmodified or modified. As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. "Linked nucleoside" is a nucleoside linked in a continuous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0042] As used herein, "oligomeric compound" means oligonucleotide and optionally one or more additional features, such as conjugation groups or terminal groups. An oligomeric compound may be paired with a second oligomeric compound complementary to the first oligomeric compound or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligodimer" refers to a duplex formed from two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound in an oligodimer may be referred to as a "dimer oligomeric compound."

[0043] As used herein, “oligonucleotide” means a chain of linked nucleosides connected by nucleotide-to-nucleotide bonds, wherein each nucleoside and nucleotide-to-nucleotide bond may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8–50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide in which at least one nucleoside or nucleotide-to-nucleotide bond is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not contain any nucleoside or nucleotide-to-nucleotide modifications.

[0044] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.

[0045] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for administration to a subject. Certain such carriers enable pharmaceutical compositions to be formulated, for example, into tablets, pills, sugar-coated pills, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In some embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solutions, or sterile artificial cerebrospinal fluid.

[0046] As used herein, "pharmaceutically acceptable salt" means a compound that is physiologically and pharmaceutically acceptable. Pharmacologically acceptable salts retain the desired biological activity of the parent compound without conferring undesirable toxicological effects.

[0047] Unless otherwise specified, as used herein, "RNA" means RNA transcript and includes both precursor mRNA and mature mRNA.

[0048] As used herein, "stereochiral center" in the context of a group of molecules with the same molecular formula refers to a chiral center with a random stereochemical configuration. For example, in a group of molecules containing stereochiral centers, the number of molecules with (S) configuration stereochiral centers may, but is not necessarily, the same as the number of molecules with (R) configuration stereochiral centers. The stereochemical configuration of a chiral center is considered random when the synthetic method is not designed to control the stereochemical configuration. In some embodiments, the stereochiral center is a stereochiral phosphate ester nucleoside linker.

[0049] As used in this article, "subject" refers to a human or a non-human animal.

[0050] As used herein, “glycan” means an unmodified or modified sugar moiety. As used herein, “unmodified sugar moiety” means the 2'-OH(H)β-D ribosyl moiety found in RNA (“unmodified RNA sugar moiety”) or the 2'-H(H)β-D deoxyribosyl moiety found in DNA (“unmodified DNA sugar moiety”). An unmodified sugar moiety has one hydrogen atom at each of the 1', 3', and 4' positions, an oxygen atom at the 3' position, and two hydrogen atoms at the 5' position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanyl sugar moiety or a sugar substitute.

[0051] As used herein, "sugar substitute" refers to a modified sugar moiety, other than the furanyl group, that has a nucleobase linked to another group (e.g., an internucleotide linker, conjugation group, or terminal group) within an oligonucleotide. Modified nucleosides containing sugar substitutes can be incorporated into one or more positions within an oligonucleotide, and such oligonucleotides can hybridize with complementary oligomers or target nucleic acids.

[0052] As used herein, “in vivo assay” means the assay described in Example 2 and its reasonable variations.

[0053] As used herein, “symptom” means any physical feature or test result that indicates the presence or extent of a disease or condition. In some implementations, the symptoms are obvious to the subject or the medical professional examining or testing the subject.

[0054] As used in this article, "target nucleic acid" refers to a nucleic acid that is designed to be affected by an antisense compound.

[0055] As used in this article, "target region" refers to a portion of the target nucleic acid in which oligomeric compounds are designed to be hybridized.

[0056] As used in this article, "terminal group" refers to a chemical group or atomic group covalently linked to the end of an oligonucleotide.

[0057] As used in this article, "therapeutic effective dose" refers to the amount of a pharmaceutical agent that provides therapeutic benefit to the subject. For example, a therapeutic effective dose improves the symptoms of a disease.

[0058] Some implementation schemes

[0059] This disclosure provides the following non-restrictive numbered implementation schemes:

[0060] Implementation Scheme 1. An oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 16, 17, 18, 19 or 20 linked nucleosides and the nucleobase sequence comprising at least 15 or at least 16 consecutive nucleosides of any of the nucleobase sequences SEQ ID NO:20-50, wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified nucleosides.

[0061] Implementation Scheme 2. An oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 17, 18, 19 or 20 linked nucleosides and the nucleobase sequence comprising at least 15, at least 16 or at least 17 consecutive nucleosides of any one of the nucleobase sequences SEQ ID NO: 20-27, 29-30 or 32-50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside linker.

[0062] Implementation Scheme 3. An oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 18, 19, or 20 linked nucleosides and the nucleobase sequence comprising at least 15, at least 16, at least 17, or at least 18 consecutive nucleosides of any one of the nucleobase sequences SEQ ID NO: 20-27, 30, or 33-50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside linkage.

[0063] Implementation Scheme 4. An oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 19 or 20 linked nucleosides and the nucleobase sequence comprising at least 15, at least 16, or at least 17, at least 18, or at least 19 consecutive nucleosides from any one of the nucleobase sequences SEQ ID NO: 20, 22, 24-27, 30, 33-50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside linker.

[0064] Implementation Scheme 5. An oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 20 linked nucleosides and the nucleobase sequence comprising at least 15, at least 16, or at least 17, at least 18, at least 19, or at least 20 consecutive nucleosides from any one of the nucleobase sequences SEQ ID NO: 20, 22, 25, 27, 35, 39-46, or 49, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside linker.

[0065] Implementation Scheme 6. The oligomeric compound of any one of Implementation Schemes 1-5, wherein, when measured over the entire nucleobase sequence of the modified oligonucleotide, the nucleobase sequence of the modified oligonucleotide is at least 80%, 85%, 87.5%, 88.2%, 89%, 89.4%, 90%, 93.7%, 94%, 94.7%, 95%, or 100% complementary to the nucleobase sequence SEQ ID NO:1.

[0066] Embodiment 7. An oligomeric compound according to any one of Embodiments 1-6, wherein the modified oligonucleotide has an internucleoside linkage motif (5' to 3') selected from the following: sos osssssssssssss, ssosssssssssssoss, ssosssssosssssoss, ssosssosssosssoss, soossssssssssooss, sooosssssssssooss, sooossssssssoooss, sssssssoooss sssss, ssossssssssssssss, sssssossssssssssss, ssssssossssssssss, sssssssso ssssssss, sssssssssssossssss, sssssssssssssossss, sssssssssssssssoss, sossss ssssssssoss, sosssssssssosssss, sosssssssosssssss, sosssssosssssssss, so sssosssssssssss, sssssosssssssssoss, ssssssosssssssoss, sssssssssosssssoss, sssssssssssosssoss, sssssssssssssososs, soossssssssssssss, sssoossssssssssss, ssssssoossssssssss, sssssssoossssssss, ssssssssssoossssss, ssssssssssss oossss, ssssssssssssssooss, sssssssoooossssss, ssoooosssssssssss, sssso ooosssssssss, sssssssssoooosssss, sssssssssssoooosss, ssssssssssssooooss, ssssssooooossssss, ssssssoooooosssss, sooosssssssoooss, ssssssoooooo osssss, sssssssssssssssoss, sssssssssssssosss, ssssssssssssssooss, ssssssssss sssososs, ssssssssssssosssss, ssssssssssssososss, sssssssssssossosss, sssssssssssssss、s ...ossssssssssssssssssssss、sosssssssssssssssssssssss、sossssssssssssssssssssss、sosssssssssssssssssssssss、soosssssssssssssssssssssss� sso、ssssssssssssssssssoo、s ... sssss、sosssssssssssssssss、sossssssssssssssssss、sosssssssssssssssssss、sossssssssssssssssssss、sosssssssssssssssssss、sossssssssssssssssss、soosssssssssssssssssss、 ... ssssso、ossssssssssssssssss、ssssssssssssssosso、s ... s、sosssssssssssssssss、sossssssssssssssss、sossssssssssssssss、sssssssssssssssssssss sooooss、sssssssssssssssssss、ssssssssssssssss、sssssssssssssssss、ssssssssssssssssss、ssssssssssssssssssssss、sssssssssssss ooooosssssss、sssssssssssssssssss、 ...s、ossssssssssoss, ssosssssosssssoss, ssosssosssossoss, ssossossossososs, ssosososososossss ,ssoooossssssssss,soossssssssssooss,sooosssssssssooss,sooossssssssoooss,soooossssssooo ss, ssssssssssooooss, sssssssssoooosss, ssssssooossssss, ssssssoooosssss, sssssooooosssss , sssssoooooossss, ssssoooosssssss, ssssooooooossss, sssosssosssssss, ssossssssssssss, ss ossossosssss, ssossossosososs, ssosososososososs, ssoooosssssssss, so osssssssssooss, soooossssssssooss, soooosssssssoooss and soooossssssoooss; where 's' represents the nucleotide linkage between thiophosphates and 'o' represents the nucleotide linkage between phosphodiester nucleotides.

[0067] Implementation Scheme 8. An oligomeric compound as described in any one of Implementation Schemes 1-6, wherein the modified oligonucleotide has a nucleoside linkage motif selected from the following: sssssssssssssssxs and sssssssssssssssx; wherein 's' represents a thiophosphate nucleoside linkage, 'o' represents a phosphodiester nucleoside linkage and 'x' represents a methoxypropylphosphonate nucleoside linkage.

[0068] Implementation Scheme 9. The oligomeric compound as described in any one of Implementation Schemes 1-6, wherein the modified oligonucleotide has a nucleoside linkage motif selected from the following: zzzzzzzzzzzzzzzzz, sssssssssszzzzzz, ssssszzzzzzzzsssss, zzooooooooooooozz, zzzzooooooooooooozz, zzzzzzzzooooooooozz, and ssoooooooooooooss; wherein 's' represents a thiophosphate nucleoside linkage, 'o' represents a phosphodiester nucleoside linkage, and "z" represents a methanesulfonylaminophosphate nucleoside linkage.

[0069] Embodiment 10. The oligomeric compound of any one of embodiments 1-9, wherein the modified oligonucleotide has a sugar motif (5' to 3') selected from the following: eeeeeeeeeeee eeeeeeee, eeeeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeeeee, eeeeeeeeeeeeeeeeeeee, nnnnnnnnnnnnnnnnnnnn, nnn nnnnnnnnnnnnnnnnnn, nnnnnnnnnnnnnnnnnnnnn, nnnnnnneneennnnn, nnnnnnnenenneen, nennnnnneneenenneen, nnnnnnnnnnnnnnnnnne, nnnnnnnnnnnnnnnnnnnd, nnnnnnnnnnnnnnnnny, nnnnnnnnnnnnnnnnnndd, nnnnnnnnnnnnnnnnnnned, nnnnnnnnnn nnnnnde, nnnnnnnnnnnnnnnnee, eeeeeeeeeeeeeeedd, eeeeeeeeeeeeeeeeed, eeeeeeeeeeeeeeeeeeed, eeeeeeeeeeeeeeeeeeed, eeekeekeekeeek, keeeeeeeeeeeek, keeeeeeeeeeeek, keeeeeeeeeeeek, keeeeeeeeeeeek eeeek、eeeekeekeekeekek、eeekeekeekeekeekee、eeeeeeekeekeeekee e、eeeeeeekeekeeeeee、eeeeekeeeeekeeeeee、keekeeekeeeeeeeeee、ee eeeeeeekeekeeek、keekeekeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee eeek、keeeeeeeeeeeek、keeeeeeeeeeeeeek、keeeeeeeeeeeeeek、eekeekeekeekeekek, eekeekeekeekeekee, eeeeekeekeekeekee, eeeeekeek eekeeeee, eeeeekeeeeeeeeee, keekeekeekeeeeeee, eeeeeeekeekeekeek, keekeekeeeeeeeeee, eeeeeeeeekeekeek, keekeeeeeeeeeeee, eeeeeee eeeeekeek, keekeekeekeekeek, keekeekeekeekeek, keeeekeeeekeeeek, keeeeeeekeeeeeek, keeeeeeeeeeeeek, kekeekeekeekeeke, eekeekeeke ekeeke,eeeeekeekeekeeke,eeeeekeekeekeeee,eeeeekeeeeekeeee,keekeekeekeeeeee,eeeeeekeekeekeek,keekeekeeeeeeeeeee,eeeeeeeeekeeeekeek,keekeeeeeeeeeeeeee,eeeeeeeeeeeeeeeekeek,eeeeeeeeeeeeeeeeeeed,eeee eeeeeeeeeeeeeeeey,ennnnnnnnnnnnnnnnnnnn andennnnnnnnnnnnnnnnnne; where 'e' represents the 2'-MOE sugar moiety, 'n' represents the 2'-NMA sugar moiety, 'k' represents the cEt sugar moiety, 'd' represents the 2'-β-D-deoxyribosyl sugar moiety, and 'y' represents the 2'-OMe sugar moiety.

[0070] Implementation Scheme 11. An oligomeric compound as described in any one of Implementation Schemes 1-9, wherein the modified oligonucleotide has a glycomolecular motif (5' to 3') selected from the following: nnnnnnnnnnnnnnnenn and nnnnnnnnnnnnnnnnen, where 'e' represents the 2'-MOE glycomolecular motif and 'n' represents the 2'-NMA glycomolecular motif.

[0071] Implementation Scheme 12. An oligomeric compound as described in any one of Schemes 1-9, wherein the modified oligonucleotide has a glycosyl motif (5' to 3')qqnqqqqqnqnnqnqqnn, wherein each 'n' represents a 2'-NMA sugar moiety, and each 'q' is independently selected from 2'-O-(N,N-dimethyl)acetamide sugar moiety, 2'-O-(N-ethyl)acetamide sugar moiety, 2'-O-(N-propyl)acetamide sugar moiety, 2'-O-(N-cyclopropyl)acetamide sugar moiety, and 2'-O-(N-cyclopropylmethyl)acetamide sugar moiety.

[0072] Implementation Scheme 13. An oligomeric compound as described in any one of Implementation Schemes 1-9, wherein the modified oligonucleotide comprises at least one modified sugar moiety.

[0073] Implementation Scheme 14. The oligomeric compound as described in Implementation Scheme 13, wherein the modified oligonucleotide comprises at least one bicyclic sugar moiety.

[0074] Implementation Scheme 15. The oligomer compound as described in Implementation Scheme 14, wherein the bicyclic sugar moiety has a 4'-2' bridge, wherein the 4'-2' bridge is selected from -CH2-O- and -CH(CH3)-O.

[0075] Implementation Scheme 16. The oligomeric compound of Implementation Scheme 13, wherein the modified oligonucleotide comprises at least one non-bicyclic modified sugar moiety.

[0076] Implementation Scheme 17. The oligomeric compound as described in Implementation Scheme 16, wherein the non-bicyclic modified sugar moiety is any one of the 2'-MOE sugar moiety, the 2'-NMA sugar moiety, the 2'-OMe sugar moiety, or the 2'-F sugar moiety.

[0077] Implementation Scheme 18. An oligomeric compound as described in Implementation Scheme 13, wherein the modified oligonucleotide comprises at least one sugar substitute.

[0078] Implementation Scheme 19. The oligomeric compound as described in Implementation Scheme 18, wherein the sugar substitute is any one of morpholino, modified morpholino, PNA, THP, and F-HNA.

[0079] Implementation Scheme 20. An oligomeric compound as described in any one of Implementation Schemes 1-6 and 10-19, wherein the modified oligonucleotide comprises at least one modified nucleoside linker.

[0080] Implementation Scheme 21. The oligomeric compound as described in Implementation Scheme 20, wherein the internucleotide linking of each nucleoside of the modified oligonucleotide is a modified nucleoside linking.

[0081] Implementation Scheme 22. The oligomeric compound as described in Implementation Scheme 20 or Implementation Scheme 21, wherein the modified nucleoside interlinking is a thiophosphate nucleoside interlinking.

[0082] Implementation Scheme 23. An oligomeric compound as described in any one of Implementation Schemes 1-20 or 22, wherein the modified oligonucleotide comprises at least one phosphodiester nucleoside linker.

[0083] Implementation Scheme 24. An oligomeric compound as described in Implementation Scheme 20, 22 or 23, wherein each nucleoside link is independently selected from phosphate diester nucleoside links and thiophosphate nucleoside links.

[0084] Implementation Scheme 25. An oligomeric compound as described in any one of Implementation Schemes 13-19, wherein the modified oligonucleotide has a nucleoside-linking motif (5' to 3') selected from the following: sosossssssssssssss, soosssssssssssssss, sossssssssssssss, sosssssssssssss, sssoosssssssssss, sssssssssoossssss, sssssssssoossssss, and ssssssssssssss; wherein 's' represents a thiophosphate nucleoside link and 'o' represents a phosphodiester nucleoside link.

[0085] Implementation Scheme 26. An oligomeric compound as described in any one of Implementation Schemes 1-25, wherein the modified oligonucleotide comprises a modified nucleobase.

[0086] Implementation Scheme 27. The oligomeric compound as described in Implementation Scheme 26, wherein the modified nucleobase is 5-methylcytosine.

[0087] Implementation Scheme 28. An oligomeric compound as described in any one of Implementation Schemes 1-27, wherein the modified oligonucleotide consists of 16, 17, 18, 19 or 20 linked nucleosides.

[0088] Implementation Scheme 29. An oligomeric compound as described in any one of Implementation Schemes 1-28, wherein the modified oligonucleotide comprises one or two non-complementary nucleobases.

[0089] Implementation Scheme 30. An oligomeric compound as described in any one of Implementation Schemes 1-29, wherein the modified oligonucleotide comprises one or two cleavable moieties.

[0090] Implementation Scheme 31. The oligomeric compound as described in Implementation Scheme 30, wherein the cleavable portion is a phosphodiester nucleoside linker.

[0091] Implementation Scheme 32. An oligomeric compound as described in any one of Implementation Schemes 1-31, wherein the oligomeric compound comprises the modified oligonucleotide.

[0092] Implementation Scheme 33. The oligomer compound as described in any one of Implementation Schemes 1-32, wherein the oligomer compound is a single-chain oligomer compound.

[0093] Implementation Scheme 34. An oligomeric compound comprising a modified oligonucleotide according to the following chemiluminescence: m C es A eo m C es T eo T es T es m C es A es T es A es A es T es G es m C es T es G es G es m C e (SEQ ID NO:21), where:

[0094] A = adenine nucleobase,

[0095] m C = 5-methylcytosine nucleobase,

[0096] G = guanine nucleobase

[0097] T = thymine nucleobase,

[0098] e = 2'-MOE sugar moiety,

[0099] s = thiophosphate nucleoside linkage, and

[0100] o = phosphate diester nucleoside linkage.

[0101] Implementation Scheme 35. An oligomeric compound comprising a modified oligonucleotide according to the following chemiluminescence: T eo T es m C es A es m C es Tes T es T es m C es A es T es A es A es T es G es m C es T es G es G eo m C e (SEQ ID NO:22), where:

[0102] A = adenine nucleobase,

[0103] m C = 5-methylcytosine nucleobase,

[0104] G = guanine nucleobase

[0105] T = thymine nucleobase,

[0106] e = 2'-MOE sugar moiety,

[0107] s = thiophosphate nucleoside linkage, and

[0108] o = phosphate diester nucleoside linkage.

[0109] Implementation Scheme 36. An oligomeric compound comprising a modified oligonucleotide according to the following chemiluminescence: T eo T ns m C ns A ns m C ns T ns T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G no m C e (SEQ ID NO:22), where:

[0110] A = adenine nucleobase,

[0111] m C = 5-methylcytosine nucleobase,

[0112] G = guanine nucleobase

[0113] T = thymine nucleobase,

[0114] e = 2'-MOE sugar moiety,

[0115] n = 2'-NMA sugar portion,

[0116] s = thiophosphate nucleoside linkage, and

[0117] o = phosphate diester nucleoside linkage.

[0118] Implementation Scheme 37. An oligomeric compound comprising a modified oligonucleotide according to the following chemiluminescence: m C ns A no m C ns T no T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G ns m C n (SEQ ID NO:21), where:

[0119] A = adenine nucleobase,

[0120] m C = 5-methylcytosine nucleobase,

[0121] G = guanine nucleobase

[0122] T = thymine nucleobase,

[0123] n = 2'-NMA sugar portion,

[0124] s = thiophosphate nucleoside linkage, and

[0125] o = phosphate diester nucleoside linkage.

[0126] Implementation Scheme 38. A modified oligonucleotide based on the following chemical structure:

[0127]

[0128] (SEQ ID NO:21), or its salt.

[0129] Implementation Scheme 39. The modified oligonucleotide as described in Implementation Scheme 38, which is a sodium or potassium salt.

[0130] Implementation Scheme 40. A modified oligonucleotide based on the following chemical structure:

[0131] (SEQ ID NO:21).

[0132] Implementation Scheme 41. A modified oligonucleotide based on the following chemical structure:

[0133]

[0134] (SEQ ID NO:22), or its salt.

[0135] Implementation Scheme 42. The modified oligonucleotide as described in Implementation Scheme 41, which is a sodium or potassium salt.

[0136] Implementation Scheme 43. A modified oligonucleotide based on the following chemical structure:

[0137] (SEQ ID NO:22).

[0138] Implementation Scheme 44. A modified oligonucleotide based on the following chemical structure:

[0139]

[0140] (SEQ ID NO:22), or its salt.

[0141] Implementation Scheme 45. The modified oligonucleotide as described in Implementation Scheme 44, which is a sodium or potassium salt.

[0142] Implementation Scheme 46. A modified oligonucleotide corresponding to the following chemical structure:

[0143] (SEQ ID NO:22).

[0144] Implementation Scheme 47. A modified oligonucleotide based on the following chemical structure:

[0145]

[0146] (SEQ ID NO:21), or its salt.

[0147] Implementation Scheme 48. The modified oligonucleotide as described in Implementation Scheme 47, which is a sodium or potassium salt.

[0148] Implementation Scheme 49. A modified oligonucleotide based on the following chemical structure:

[0149]

[0150] (SEQ ID NO:21).

[0151] Implementation Scheme 50. A pharmaceutical composition comprising an oligomeric compound as described in any one of Implementation Schemes 1-36 or a modified oligonucleotide as described in any one of Implementation Schemes 38-49 and a pharmaceutically acceptable diluent or carrier.

[0152] Implementation Scheme 51. The pharmaceutical composition of Implementation Scheme 50, wherein the pharmaceutical composition comprises a pharmaceutically acceptable diluent, and wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or PBS.

[0153] Implementation Scheme 52. The pharmaceutical composition of Implementation Scheme 51, wherein the pharmaceutical composition is substantially composed of the modified oligonucleotide and artificial CSF (aCSF).

[0154] Implementation Scheme 53. The pharmaceutical composition as described in Implementation Scheme 51, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS.

[0155] Implementation Scheme 54. A chiral enrichment cluster of modified oligonucleotides as described in any one of Implementation Schemes 38-49, wherein the enrichment comprises at least one modified oligonucleotide with a specific phosphate ester nucleoside bond having a specific stereochemical configuration.

[0156] Implementation Scheme 55. A chiral enrichment cluster as described in Implementation Scheme 54, wherein the enrichment cluster comprises at least one modified oligonucleotide having a specific thiophosphate nucleoside linkage in the (Sp) configuration.

[0157] Implementation Scheme 56. The chiral enrichment cluster as described in Implementation Scheme 54, wherein the enrichment comprises at least one modified oligonucleotide with a specific thiophosphate nucleoside bond having an (Rp) configuration.

[0158] Implementation Scheme 57. A chiral enriched cluster as described in Implementation Scheme 54, wherein the cluster is enriched in modified oligonucleotides having a specific, independently selected stereochemical configuration at each thiophosphate nucleoside linker.

[0159] Implementation Scheme 58. The chiral enriched clusters as described in Implementation Scheme 57, wherein the clusters are enriched in modified oligonucleotides having a (Sp) configuration at each thiophosphate nucleoside linker or modified oligonucleotides having a (Rp) configuration at each thiophosphate nucleoside linker.

[0160] Implementation Scheme 59. A chiral enriched cluster as described in Implementation Scheme 57, wherein the cluster is enriched in modified oligonucleotides having an (Rp) configuration at a specific thiophosphate nucleoside linker and an (Sp) configuration at each of the remaining thiophosphate nucleoside linkers.

[0161] Implementation Scheme 60. The chiral enriched cluster as described in Implementation Scheme 57, wherein the cluster is enriched in modified oligonucleotides having at least three consecutive phosphate thioester nucleoside linkages in the 5' to 3' orientation with Sp, Sp, and Rp configurations.

[0162] Implementation Scheme 61. A group of modified oligonucleotides as described in any one of Implementation Schemes 38-49, wherein all phosphate thioester nucleoside linkages of the modified oligonucleotides are stereorandom.

[0163] Implementation Scheme 62. A method of treating a disease associated with SMN1 or SMN2, the method comprising administering a therapeutically effective amount of the pharmaceutical composition of any one of Implementation Schemes 50-53 to a subject suffering from a disease associated with SMN1 or SMN2 or at risk of developing the disease; and thereby treating the disease associated with SMN1 or SMN2.

[0164] Implementation Scheme 63. The method as described in Implementation Scheme 62, wherein the disease associated with SMN1 or SMN2 is a neurodegenerative disease.

[0165] Implementation Scheme 64. The method as described in Implementation Scheme 63, wherein the neurodegenerative disease is spinal muscular atrophy (SMA).

[0166] Implementation Scheme 65. The method of Implementation Scheme 64, wherein the SMA is any one of Type I SMA, Type II SMA, Type III SMA or Type IV SMA.

[0167] Implementation Scheme 66. The method described in Implementation Scheme 64 or Implementation Scheme 65, wherein at least one symptom of SMA is improved.

[0168] Implementation Scheme 67. The method as described in Implementation Scheme 66, wherein the symptom is any of the following: decreased muscle strength; inability to sit, stand and / or walk or a reduced ability thereof; decreased neuromuscular activity; decreased electrical activity in one or more muscles; decreased respiration; inability to eat, drink and / or breathe without assistance or a reduced ability thereof; weight loss or decreased weight gain; and / or decreased survival.

[0169] Implementation Scheme 68. The method of any one of Implementation Schemes 62-67, wherein the pharmaceutical composition is administered to the central nervous system or systemically.

[0170] Implementation Scheme 69. The method as described in Implementation Scheme 68, wherein the pharmaceutical composition is administered to the central nervous system and systemically.

[0171] Implementation Scheme 70. The method of any one of Implementation Schemes 62-67, wherein the pharmaceutical composition is administered via intrathecal, systemic, subcutaneous, or intramuscular means.

[0172] Implementation Scheme 71. A method for increasing SMN2 RNA including exon 7, the method comprising contacting a cell, tissue or organ with an oligomeric compound of any one of Implementation Schemes 1-37, a modified oligonucleotide of any one of Implementation Schemes 38-49, or a pharmaceutical composition of any one of Implementation Schemes 50-53.

[0173] certain oligonucleotides

[0174] In some embodiments, this document provides oligomeric compounds comprising oligonucleotides composed of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides, relative to unmodified RNA or DNA, contain at least one modification. That is, modified oligonucleotides contain at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified inter-nucleoside bond.

[0175] Some modified nucleosides

[0176] Modified nucleosides may consist of a modified sugar moiety, a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0177] Some sugar portions

[0178] In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In some embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In some embodiments, the modified sugar moiety is a sugar substitute. Such sugar substitutes may contain one or more substitutions corresponding to other types of modified sugar moiety.

[0179] In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanyl ring having one or more substituents, none of which bridge the two atoms of the furanyl ring to form a bicyclic structure. Such non-bridging substituents can be located at any position on the furanyl ring, including but not limited to substituents at the 2', 4', and / or 5' positions. In some embodiments, one or more non-bridging substituents of the non-bicyclic modified sugar moiety are branched. Examples of suitable 2'-substituents for the non-bicyclic modified sugar moiety include, but are not limited to: 2'-F, 2'-OCH3 (“OMe” or “O-methyl”), and 2'-O(CH2)2OCH3 (“MOE” or “O-methoxyethyl”), as well as 2'-ON-alkylacetamides, such as 2'-ON-methylacetamide (“NMA”), 2'-ON-dimethylacetamide, 2'-ON-ethylacetamide, or 2'-ON-propylacetamide. For example, see US 6,147,200, Prakash et al., 2003, Org. Lett., 5, 403-6. The following indicates “2'-ON-methylacetamide nucleoside” or “2'-NMA nucleoside”:

[0180]

[0181] In some embodiments, the 2'-substituent is selected from: halogen, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy groups, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R) m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-Alkenyl, O-alkynyl, S-alkynyl, N(R m )-Alkyne, O-alkylenyl-O-alkyl, alkynyl, alkylaryl, aralkyl, O-alkylaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m (R) n ) or OCH2C(=O)-N(R m (R) n ), where each R m and Rn Independently H, amino protecting group, or substituted or unsubstituted C1-C 10 Alkyl groups, and the 2'-substituents described in Cook et al., US 6,531,584; Cook et al., US 5,859,221; and Cook et al., US 6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from: hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to: 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In some embodiments, the non-bicyclic modified sugar moiety comprises more than one non-bridged sugar substituent, such as a 2'-F-5'-methyl sugar moiety and the modified sugar moiety and modified nucleoside described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0182] In some embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety including a non-bridged 2'-substituent selected from the following: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R) m (R) n ), O(CH2), ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2 and N-substituted acetamides (OCH2C(=O)-N(R) m (R) n )), where each R m and R n Independently H, amino protecting group, or substituted or unsubstituted C1-C 10 Alkyl groups, such as OCH2C(=O)-N(H)CH3 (“NMA”).

[0183] In some embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety including a non-bridged 2'-substituent selected from the following: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2 and OCH2C(=O)-N(H)CH3 (“NMA”).

[0184] In some embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety including a non-bridged 2'-substituent selected from the following: F, OCH3, OCH2CH2OCH3, and OCH2C(=O)-N(H)CH3.

[0185] Some modified sugar moieties contain substituents that bridge two atoms of the furanyl ring to form a second ring, thereby producing a bicyclic sugar moieties. In some such embodiments, the bicyclic sugar moieties contain a bridge between the 4' and 2' furanyl ring atoms. Examples of such 4' to 2' bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (referred to as “restricted ethyl” or “cEt”), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' (“restricted MOE” or “cMOE”) and their analogues (see, for example, Seth et al., US7,399,845; Bhat et al., US7,569,686; Swayze et al., US7,741,457 and Swayze et al., US7,741,457). 8,022,193), 4'-C(CH3)(CH3)-O-2' and its analogues (see, for example, Seth et al., US8,278,283), 4'-CH2-N(OCH3)-2' and its analogues (see, for example, Prakash et al., US8,278,425), 4'-CH2-ON(CH3)-2' (see, for example, Allenson et al., US7,696,345 and Allenson et al., US8,124,745), 4'-CH2-C(H)(CH3)-2' (see, for example, Zhou et al., J.Org.Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and its analogues (see, for example, Seth et al., US8,278,426), 4'-C(R a R b)-N(R)-O-2'、4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2', wherein each R, R a and R b Independently H, protecting group or C1-C 12 Alkyl (see, for example, Imanishi et al., US7,427,672).

[0186] In some embodiments, such 4' to 2' bridges independently comprise 1 to 4 independently selected groups linked from: -[C(R a (R) b )] n -、-[C(R a (R) b )] n -O-、-C(R a )=C(R b )-、-C(R a ) = N-、-C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-、-S(=O) x -and-N(R a )-;

[0187] in:

[0188] x is 0, 1, or 2;

[0189] n is 1, 2, 3 or 4;

[0190] Each R a and R b are independently H, a protecting group, a hydroxyl group, a C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20Aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C5-C7 alicyclic group, substituted C5-C7 alicyclic group, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or sulfoxyl (S(=O)-J1); and

[0191] Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic group, substituted heterocyclic group, C1-C 12 Aminoalkyl, substituted C1-C 12 Aminoalkyl or protecting group.

[0192] Other bicyclic sugar moieties are known in the art; see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 836. 2-8379; Wengel et al., US7,053,207; Imanishi et al., US6,268,490; Imanishi et al., US6,770,748; Imanishi et al., USRE44,779; Wengel et al., US6,794,499; Wengel et al., US6,670,461; Wengel et al., US7,034,133; Wengel et al., US8,080,644; Wengel et al., US8,034,909; Wengel et al., US8,153,365; Wengel et al., US7,572,582; and Ramasamy et al., US6,525,191; Torsten et al., WO 2004 / 106356; Wengel et al., WO 1999 / 014226; Seth et al., WO 2007 / 134181; Seth et al., US7,547,684; Seth et al., US7,666,854; Seth et al., US8,088,746; Seth et al., US7,750,131; Seth et al., US8,030,467; Seth et al., US8,268,980; Seth et al., US8,546,556; Seth et al., US8,530,640; Migawa et al., US9,012,421; Seth et al., US8,501,805; and Allenson et al., US Patent Publication No. US2008 / 0039618 and Migawa et al., US Patent Publication No. US2015 / 0191727.

[0193] In some embodiments, the bicyclic sugar moiety and the nucleotide having such a bicyclic sugar moiety are further defined by isomer configuration. For example, LNA nucleotides (described herein) may be in the α-L configuration or the β-D configuration.

[0194]

[0195] α-L-methyleneoxy(4'-CH2-O-2') or α-L-LNA bicyclic nucleotides have been incorporated into oligonucleotides, exhibiting antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this document, the general description of bicyclic nucleotides includes two isomer configurations. Unless otherwise specified, when the position of a particular bicyclic nucleotide (e.g., LNA or cEt) is identified in the embodiments exemplified herein, it is in the β-D configuration.

[0196] In some embodiments, the modified sugar moiety comprises one or more non-bridged sugar substituents and one or more bridged sugar substituents (e.g., 5'-substituted and 4'-2'-bridged sugars).

[0197] In some embodiments, the modified sugar moiety is a sugar substitute. In some such embodiments, the oxygen atom of the sugar moiety is replaced by, for example, a sulfur, carbon, or nitrogen atom. In some such embodiments, the modified sugar moiety also contains bridging and / or non-bridging substituents as described herein. For example, some sugar substitutes contain a 4'-sulfur atom and substitutions at the 2' position (see, for example, Bhat et al., US7,875,733 and Bhat et al., US7,939,677) and / or the 5' position.

[0198] In some embodiments, the sugar substitute comprises a ring having more than five atoms. For example, in some embodiments, the sugar substitute comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acids (“HNA”), anitol nucleic acids (“ANA”), mannitol nucleic acids (“MNA”) (see, for example, Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), and fluoroHNA.

[0199]

[0200] (“F-HNA”, see, for example, Swayze et al., US8,088,904; Swayze et al., US8,440,803; Swayze et al., US8,796,437; and Swayze et al., US9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran) and nucleosides containing other modified THP compounds having the following formula:

[0201]

[0202] Independently, for each of the modified THP nucleotides:

[0203] Bx represents the nucleobase portion;

[0204] T3 and T4 are each independently an internucleotide linking group that links the modified THP nucleoside to the rest of the oligonucleotide, or one of T3 and T4 is an internucleotide linking group that links the modified THP nucleoside to the rest of the oligonucleotide, and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group.

[0205] q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, or substituted C2-C6 ynyl; and

[0206] R1 and R2 are each independently selected from: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 and CN, wherein X is O, S or NJ1, and J1, J2 and J3 are each independently H or C1-C6 alkyl.

[0207] In some embodiments, a modified THP nucleoside is provided, wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is not H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In some embodiments, a modified THP nucleoside is provided, wherein one of R1 and R2 is F. In some embodiments, R1 is F and R2 is H; in some embodiments, R1 is methoxy and R2 is H; and in some embodiments, R1 is methoxyethoxy and R2 is H.

[0208] In some embodiments, the sugar substitute comprises a ring having more than five atoms and more than one heteroatom. For example, nucleosides comprising a morpholinyl sugar moiety and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US5,698,685; Summerton et al., US5,166,315; Summerton et al., US5,185,444; and Summerton et al., US5,034,506). As used herein, the term "morpholinyl" means a sugar substitute having the following structure:

[0209]

[0210] In some embodiments, the morpholino group can be modified, for example, by adding or changing various substituents relative to the morpholino group structure described above. Such sugar substitutes are referred to herein as "modified morpholino groups".

[0211] In some embodiments, the sugar substitute comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar substitutes include, but are not limited to, peptide nucleic acids (“PNA”), acyclic butyl nucleic acids (see, for example, Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876.

[0212] Many other bicyclic and tricyclic sugars and sugar substitute ring systems are known in techniques that can be used to modify nucleosides.

[0213] certain modified nucleobases

[0214] In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing unmodified nucleobases. In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing modified nucleobases. In some embodiments, the modified oligonucleotide comprises one or more nucleosides that do not contain nucleobases, referred to as a base-free nucleoside.

[0215] In some embodiments, the modified nucleobase is selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6-substituted purines. In some embodiments, the modified nucleobase is selected from: 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymidine and 2-thiocytosine, 5-propynyl(-C≡C-CH3)uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymidine, 5-ribosyluracil (pseudouracil), 4-thiouracil; 8-halogen, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, 8-azapyridine Other 8-substituted purines; 5-halogens, especially 5-bromo, 5-trifluoromethyl, 5-halouracil and 5-halocytosine; 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deadenine, 7-deadenine, 3-deadenine, 3-deadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl4-N-benzoylcytosine, 5-methyl4-N-benzoyluracil, universal bases, hydrophobic bases, hybrid bases, size-enlarged bases and fluorinated bases. Other modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenthiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases may also include nucleobases in which the purine or pyrimidine base is replaced by another heterocyclic ring, such as 7-deadenine, 7-deadenine, 2-aminopyridine, and 2-pyridone.Other nucleobases include those disclosed in: Merigan et al., US3,687,808; The Concise Encyclopedia Of Polymer Science and Engineering, Kroschwitz, JI ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B. eds., CRC Press, 1993, 273-288; and Chapters 6 and 15, Antisense Drug Technology, Crooke ST ed., CRC Press, 2008, 163-166 and 442-443.

[0216] The disclosures teaching the preparation of certain modified nucleobases described above, as well as other modified nucleobases, include, but are not limited to: Manoharan et al., US2003 / 0158403; Manoharan et al., US2003 / 0175906; Dinh et al., US4,845,205; Spielvogel et al., US5,130,302; Rogers et al., US5,134,066; Bischofberger et al., US5 ,175,273; Urdea et al., US5,367,066; Benner et al., US5,432,272; Matteucci et al., US5,434,257; Gmeiner et al., US5,457,187; Cook et al., US5,459,255; Froehler et al., US5,484,908; Matteucci et al., US5,502,177; Hawkins et al., US5,525 711; Haralambidis et al., US5,552,540; Cook et al., US5,587,469; Froehler et al., US5,594,121; Switzer et al., US5,596,091; Cook et al., US5,614,617; Froehler et al., US5,645,985; Cook et al., US5,681,941; Cook et al., US5,811,534; Cook et al. The authors are: Mr., US5,750,692; Cook et al., US5,948,903; Cook et al., US5,587,470; Cook et al., US5,457,191; Matteucci et al., US5,763,588; Froehler et al., US5,830,653; Cook et al., US5,808,027; Cook et al., 6,166,199; and Matteucci et al., US6,005,096.

[0217] Certain modified nucleoside interlinking

[0218] In some embodiments, the nucleosides of the modified oligonucleotides can be linked together using any nucleoside linker. Two main categories of linker groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing linker groups include, but are not limited to: phosphodiesters containing a phosphodiester bond (P(O2)=O) (also known as unmodified or naturally occurring linkers); phosphotriesters; methylphosphonates; methoxypropylphosphonates (“MOP”); aminophosphates; methanesulfonylaminophosphates; thiophosphates (P(O2)=S) and dithiophosphates (HS-P=S). Representative phosphorus-free linker groups include, but are not limited to: methylenemethylimino (-CH2-N(CH3)-O-CH2-); thiodiesters; thiocarbonylcarbamates (-OC(=O)(NH)-S-); siloxanes (-O-SiH2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Compared to naturally occurring phosphate ester linkages, modified nucleoside linkages can be used to alter (and typically increase) the nuclease resistance of oligonucleotides. In some embodiments, nucleoside linkages with chiral atoms can be prepared as racemic mixtures or separate enantiomers. Methods for preparing phosphorus-containing and phosphorus-free nucleoside linkages are well known to those skilled in the art.

[0219] Representative internucleotide linkages with chiral centers include, but are not limited to, alkylphosphonates and thiophosphates. Modified oligonucleotides containing internucleotide linkages with chiral centers can be prepared into groups comprising modified oligonucleotides comprising stereorandom internucleotide linkages, or groups comprising modified oligonucleotides comprising thiophosphate internucleotide linkages exhibiting a specific stereochemical configuration. In some embodiments, the group of modified oligonucleotides comprises all of which are stereorandom thiophosphate internucleotide linkages. Such modified oligonucleotides can be generated using synthetic methods that allow the stereochemical configuration of each thiophosphate internucleotide linkage to be randomly selected. Nevertheless, as those skilled in the art will fully appreciate, each individual thiophosphate of each individual oligonucleotide molecule has a defined stereochemical configuration. In some embodiments, the group of modified oligonucleotides is enriched with modified oligonucleotides comprising one or more specific thiophosphate internucleotide linkages exhibiting a specific, independently selected stereochemical configuration. In some embodiments, specific configurational phosphate-thioester nucleoside linkages are present in at least 65% of the molecules in the population. In some embodiments, specific configurational phosphate-thioester nucleoside linkages are present in at least 70% of the molecules in the population. In some embodiments, specific configurational phosphate-thioester nucleoside linkages are present in at least 80% of the molecules in the population. In some embodiments, specific configurational phosphate-thioester nucleoside linkages are present in at least 90% of the molecules in the population. In some embodiments, specific configurational phosphate-thioester nucleoside linkages are present in at least 99% of the molecules in the population. Such chiral-rich clusters of modified oligonucleotides can be generated using synthetic methods known in the art, such as those described in Oka et al., JACS, 2003, 125, 8307; Wan et al., Nuc. Acid. Res., 2014, 42, 13456; and WO 2017 / 015555. In some embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides having at least one indicated phosphate thioester in the (Sp) configuration. In some embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides having at least one phosphate thioester in the (Rp) configuration. In some embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) phosphate thioesters each comprise one or more of the following formulas, wherein "B" indicates a nucleobase:

[0220]

[0221] Unless otherwise indicated, the chiral nucleoside linkages of the modified oligonucleotides described herein may be stereorandom or have a specific stereochemical configuration.

[0222] In some embodiments, the modified oligonucleotide contains an internucleotide motif (5' to 3')sooosssssssssssssss. In some embodiments, the specific stereochemical configuration of the modified oligonucleotide is (5' to 3')Sp-ooo-Sp-Sp-Sp-Rp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp or Sp-ooo-Sp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp; wherein each 'Sp' represents an S-configuration phosphate ester nucleoside link; Rp represents an R-configuration phosphate ester nucleoside link; and 'o' represents a phosphodiester nucleoside link.

[0223] Neutral nucleoside linkages include, but are not limited to, triphosphates, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), methyl acetal (3'-O-CH2-O-5'), methoxypropyl, and thiomethyl acetal (3'-S-CH2-O-5'). Other neutral nucleoside linkages include nonionic linkages comprising siloxanes (dialkylsiloxanes), carboxylic esters, carboxamides, sulfides, sulfonates, and amides (see, for example, Carbohydrate Modifications in Antisense Research; eds. YSSanghvi and PDCook, ACSSymposium Series 580; Chapters 3 and 4, 40–65). Other neutral nucleoside linkages include nonionic linkages comprising a mixture of N, O, S, and CH2 components.

[0224] In some embodiments, the modified nucleoside-to-nucleotide linkage is any of those described in WO 2021 / 030778, which is incorporated herein by reference.

[0225] certain motifs

[0226] In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified sugar moiety. In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified nucleotide. In some embodiments, the modified oligonucleotide comprises one or more modified internucleotide bonds. In such embodiments, the modification, unmodification, and different modifications of the sugar moiety, nucleotide, and / or internucleotide bonds of the modified oligonucleotide define a pattern or motif. In some embodiments, the patterns of the sugar moiety, nucleotide, and internucleotide bonds are each independent of each other. Therefore, the modified oligonucleotide is described by its sugar motif, nucleotide motif, and / or internucleotide bond motif (as used herein, the nucleotide motif describes modifications to the nucleotides independent of the sequence of the nucleotides).

[0227] certain glycosylations

[0228] In some embodiments, the oligonucleotide comprises one or more types of modified sugars and / or unmodified sugar motifs arranged in a defined pattern or glycomotif along the oligonucleotide or a portion thereof. In some cases, such glycomotifs include, but are not limited to, any sugar modifications discussed herein.

[0229] In some embodiments, the modified oligonucleotide has a gapmer motif defined by two outer regions or "flanks" and a central or inner region or "gap". The three regions of the gapmer motif (5'-flank, gap, and 3'-flank) form a continuous sequence of nucleosides, wherein at least some sugar moieties of the nucleosides in each flank differ from at least some sugar moieties of the nucleosides in the gap. Specifically, at least some sugar moieties of the nucleoside closest to the gap in each flank (the 3'-thickest nucleoside of the 5'-flank and the 5'-thickest nucleoside of the 3'-flank) differ from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the flank and the gap (i.e., the flank / gap junction). In some embodiments, the sugar moieties within the gap are identical to each other. In some embodiments, the gap includes one or more nucleosides whose sugar moieties differ from the sugar moieties of one or more other nucleosides in the gap. In some embodiments, the sugar motifs of the two flanks are identical to each other (symmetric gapmer). In some implementations, the 5'-flank glycosylation differs from the 3'-flank glycosylation (asymmetric spacer).

[0230] In some embodiments, the flanks of the spacer contain 1-6 nucleosides. In some embodiments, each nucleoside in each flank of the spacer contains a modified sugar moiety. In some embodiments, at least one, at least two, at least three, at least four, at least five, or at least six nucleosides in each flank of the spacer contain a modified sugar moiety.

[0231] In some embodiments, the spacer gap contains 7-12 nucleosides. In some embodiments, each nucleoside in the spacer gap contains a 2'-deoxyribosyl sugar moiety. In some embodiments, at least one nucleoside in the spacer gap contains a modified sugar moiety and each of the remaining nucleosides contains a 2'-deoxyribosyl sugar moiety.

[0232] In this paper, the lengths (number of nucleotides) of the three regions of the spacer can be provided using the notation [number of nucleotides in the 5'-flank] - [number of nucleotides in the interstitial space] - [number of nucleotides in the 3'-flank]. Thus, the 5-10-5 spacer consists of 5 linked nucleotides in each flank and 10 linked nucleotides in the interstitial space. In cases where such nomenclature is followed by a specific modification, the modification is a modification in each sugar moiety of each flank and the interstitial nucleotide contains a 2'-deoxyribosyl sugar moiety. Therefore, the 5-10-5 MOE spacer consists of 5 linked 2'-MOE nucleotides in the 5'-flank, 10 linked 2'-deoxyribosyl nucleotides in the interstitial space, and 5 linked 2'-MOE nucleotides in the 3'-flank.

[0233] In some embodiments, each nucleoside or portion thereof of the modified oligonucleotide comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, a sugar substitute, or a 2'-deoxyribosyl sugar moiety. In some embodiments, the 2'-substituted sugar moiety is selected from the 2'-MOE sugar moiety, the 2'-NMA sugar moiety, the 2'-OMe sugar moiety, and the 2'-F sugar moiety. In some embodiments, the bicyclic sugar moiety is selected from the cEt sugar moiety and the LNA sugar moiety. In some embodiments, the sugar substitute is selected from morpholino, modified morpholino, PNA, THP, and F-HNA.

[0234] In some embodiments, the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleosides containing modified sugar moieties. In some embodiments, the modified sugar moieties are independently selected from 2'-substituted sugar moieties, bicyclic sugar moieties, or sugar substitutes. In some embodiments, the 2'-substituted sugar moieties are selected from 2'-MOE sugar moieties, 2'-NMA sugar moieties, 2'-OMe sugar moieties, and 2'-F sugar moieties. In some embodiments, the bicyclic sugar moieties are selected from cEt sugar moieties and LNA sugar moieties. In some embodiments, the sugar substitutes are selected from morpholino, modified morpholino, THP, and F-HNA.

[0235] In some embodiments, each nucleoside of the modified oligonucleotide comprises a modified sugar moiety (“fully modified oligonucleotide”). In some embodiments, each nucleoside of the fully modified oligonucleotide comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar substitute. In some embodiments, the 2'-substituted sugar moiety is selected from the 2'-MOE sugar moiety, the 2'-NMA sugar moiety, the 2'-OMe sugar moiety, and the 2'-F sugar moiety. In some embodiments, the bicyclic sugar moiety is selected from the cEt sugar moiety and the LNA sugar moiety. In some embodiments, the sugar substitute is selected from morpholino, modified morpholino, THP, and F-HNA. In some embodiments, each nucleoside of the fully modified oligonucleotide comprises the same modified sugar moiety (“homogeneously modified glycomolecular motif”). In some embodiments, the homogeneously modified glycomolecular motif is 7 to 20 nucleosides in length. In some embodiments, each nucleoside of the homogeneously modified glycomolecular motif comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar substitute. In some embodiments, the 2'-substituted sugar moiety is selected from the 2'-MOE sugar moiety, the 2'-NMA sugar moiety, the 2'-OMe sugar moiety, and the 2'-F sugar moiety. In some embodiments, the bicyclic sugar moiety is selected from the cEt sugar moiety and the LNA sugar moiety. In some embodiments, the sugar substitute is selected from morpholino, modified morpholino, THP, and F-HNA. In some embodiments, the modified oligonucleotide having at least one fully modified glycomolecular motif may also comprise at least one, at least two, at least three, or at least four 2'-deoxyribonucleosides.

[0236] certain nucleobase sequences

[0237] In some embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or a portion thereof. In some embodiments, each nucleobase is modified. In some embodiments, no nucleobases are modified. In some embodiments, each purine or each pyrimidine is modified. In some embodiments, each adenine is modified. In some embodiments, each guanine is modified. In some embodiments, each thymine is modified. In some embodiments, each uracil is modified. In some embodiments, each cytosine is modified. In some embodiments, some or all of the pyrimidine nucleobases in the modified oligonucleotide are 5-methylcytosine. In some embodiments, all cytosine nucleobases are 5-methylcytosine, and all other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0238] In some embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In some such embodiments, the block is located at the 3' end of the oligonucleotide. In some embodiments, the block is located within three nucleosides at the 3' end of the oligonucleotide. In some embodiments, the block is located at the 5' end of the oligonucleotide. In some embodiments, the block is located within three nucleosides at the 5' end of the oligonucleotide.

[0239] In some embodiments, the oligonucleotide having a spacer motif comprises a nucleoside including a modified nucleotide. In some of these embodiments, a nucleoside including a modified nucleotide is located in the central interstitial space of the oligonucleotide having a spacer motif. In some of these embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar motif. In some embodiments, the modified nucleotide is selected from 2-thiopyrimidine and 5-propynylpyrimidine.

[0240] Certain nucleoside interlinking motifs

[0241] In some embodiments, the oligonucleotide comprises modified and / or unmodified internucleotide links arranged in a defined pattern or motif along the oligonucleotide or a portion thereof. In some embodiments, each internucleotide linking group is a phosphodiester internucleotide link. In some embodiments, each internucleotide link of the modified oligonucleotide is a phosphate thioester internucleotide link. In some embodiments, each internucleotide link of the modified oligonucleotide is independently selected from phosphate thioester internucleotide links and phosphodiester internucleotide links. In some embodiments, each phosphate thioester internucleotide link is independently selected from stereorandom phosphate thioester, (Sp) phosphate thioester, and (Rp) phosphate thioester. In some embodiments, the glycosylation motif of the modified oligonucleotide is a spacer and all internucleotide links within the spacer are modified. In some such embodiments, some or all of the internucleotide links in the flanks are unmodified phosphodiester internucleotide links. In some embodiments, the terminal internucleotide links are modified. In some embodiments, the modified oligonucleotide has a glycosylation motif as a spacer, and the internucleotide linking motif contains at least one phosphodiester internucleotide link in at least one flanking flank, wherein the at least one phosphodiester internucleotide link is not a terminal internucleotide link, and the remaining internucleotide links are thiophosphate internucleotide links. In some such embodiments, all thiophosphate internucleotide links are stereorandom. In some embodiments, all thiophosphate internucleotide links in the flanking flanks are (Sp) thiophosphate, and the gap contains at least one Sp,Sp,Rp motif. In some embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides containing such internucleotide linking motifs. In some embodiments, one or more internucleotide links are methanesulfonyl phosphate internucleotide links. In some embodiments, each internucleotide link is independently selected from phosphodiester internucleotide links, thiophosphate internucleotide links, and methanesulfonyl phosphate internucleotide links. In some embodiments, each internucleotide link is independently selected from thiophosphate internucleotide links and methanesulfonyl phosphate internucleotide links. In some embodiments, one or more internucleotide links are methoxypropyl phosphonate internucleotide links. In some embodiments, each internucleotide link is independently selected from phosphodiester internucleotide links, thiophosphate internucleotide links, and methoxypropyl phosphonate internucleotide links. In some embodiments, each internucleotide link is independently selected from thiophosphate internucleotide links and methoxypropyl phosphonate internucleotide links.

[0242] In some embodiments, the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 phosphodiester nucleoside bonds. In some embodiments, the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 thiophosphate nucleoside bonds. In some embodiments, the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, or at least 5 phosphodiester nucleoside bonds, and the remaining nucleoside bonds are thiophosphate nucleoside bonds.

[0243] certain length

[0244] It is possible to increase or decrease the length of oligonucleotides without eliminating their activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA, 1992, 89, 7305-7309, 1992), the ability of a series of oligonucleotides with lengths of 13–25 nucleotides to induce target nucleic acid cleavage in an oocyte injection model was tested. Oligonucleotides with a length of 25 nucleotides and 8 or 11 mismatched bases near their ends were able to guide specific cleavage of the target nucleic acid, albeit to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleotides, including those with 1 or 3 mismatches.

[0245] In some embodiments, the oligonucleotide (including modified oligonucleotides) may have any of a variety of length ranges. In some embodiments, the oligonucleotide consists of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In some such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ≤ Y. For example, in some embodiments, the oligonucleotides are 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 To 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 2 8, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26,20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 2 Composed of 3 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

[0246] In some embodiments, the oligonucleotide consists of 16 linked nucleosides. In some embodiments, the oligonucleotide consists of 17 linked nucleosides. In some embodiments, the oligonucleotide consists of 18 linked nucleosides. In some embodiments, the oligonucleotide consists of 19 linked nucleosides. In some embodiments, the oligonucleotide consists of 20 linked nucleosides.

[0247] Some modified oligonucleotides

[0248] In some embodiments, the modifications described above (sugars, nucleotides, internucleotide linkages) are incorporated into the modified oligonucleotide. In some embodiments, the modified oligonucleotide is characterized by its modified motif and overall length. In some embodiments, these parameters are independent of each other. Therefore, unless otherwise indicated, each internucleotide linkage of an oligonucleotide having a spacer glycosyl motif may be modified or unmodified and may or may not follow a sugar-modified spacer modification pattern. For example, internucleotide linkages in the flanking regions of a sugar spacer may be the same or different from each other, and may be the same or different from the internucleotide linkages in the interstitial regions of the glycosyl motif. Similarly, such sugar-spacer oligonucleotides may contain one or more modified nucleotides independent of the sugar-modified spacer pattern. Unless otherwise indicated, all modifications are independent of the nucleotide sequence.

[0249] certain groups of modified oligonucleotides

[0250] A population of modified oligonucleotides (where all modified oligonucleotides in the population have the same molecular formula) can be a stereorandom population or a chiral-rich population. In a stereorandom population, all chiral centers of all modified oligonucleotides are stereorandom. In a chiral-rich population, at least one specific chiral center of the modified oligonucleotides in the population is not stereorandom. In some embodiments, the modified oligonucleotides of the chiral-rich population are enriched in a β-D-ribosyl sugar moiety, and all thiophosphate nucleoside linkages are stereorandom. In some embodiments, the modified oligonucleotides of the chiral-rich population are enriched in a β-D-ribosyl sugar moiety and linked to at least one specific thiophosphate nucleoside exhibiting a specific stereochemical configuration.

[0251] Nucleobase sequence

[0252] In some embodiments, the oligonucleotide (unmodified or modified) is further described by its nucleobase sequence. In some embodiments, the nucleobase sequence of the oligonucleotide is complementary to a second oligonucleotide or an identified reference nucleic acid (e.g., a target nucleic acid). In some such embodiments, a portion of the nucleobase sequence of the oligonucleotide is complementary to a second oligonucleotide or an identified reference nucleic acid (e.g., a target nucleic acid). In some embodiments, a portion or the entire length of the nucleobase sequence of the oligonucleotide is complementary to a second oligonucleotide or nucleic acid (e.g., a target nucleic acid) by at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the nucleobase sequence.

[0253] Some oligomers

[0254] In some embodiments, this document provides oligomeric compounds comprising an oligonucleotide (modified or unmodified) and optionally one or more conjugation groups and / or terminal groups. A conjugation group consists of one or more conjugated portions and a conjugation linker connecting the conjugated portions to the oligonucleotide. The conjugation group may be attached to either end or both ends and / or any internal position of the oligonucleotide. In some embodiments, the conjugation group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In some embodiments, the conjugation group attached to either end or both ends of the oligonucleotide is a terminal group. In some such embodiments, the conjugation group or terminal group is attached to the 3' end and / or 5' end of the oligonucleotide. In some such embodiments, the conjugation group (or terminal group) is attached to the 3' end of the oligonucleotide. In some embodiments, the conjugation group is attached near the 3' end of the oligonucleotide. In some embodiments, the conjugation group (or terminal group) is attached to the 5' end of the oligonucleotide. In some embodiments, the conjugation group is attached near the 5' end of the oligonucleotide.

[0255] Examples of terminal groups include, but are not limited to, conjugated groups, capped groups, phosphate moieties, protecting groups, baseless nucleosides, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides.

[0256] certain conjugated groups

[0257] In some embodiments, the oligonucleotide is covalently linked to one or more conjugation groups. In some embodiments, the conjugation groups modify one or more properties of the linked oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In some embodiments, the conjugation groups impart novel properties to the linked oligonucleotide, such as a fluorophore or reporter group capable of detecting the oligonucleotide.Certain conjugated groups and conjugated moieties have been previously described, such as: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556); bile acids (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060); and thioethers, such as hexyl-S-triphenylmethylthiol (Manoharan et al., Ann. NYA). cad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770); sulfur cholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538); aliphatic chains, such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54); phospholipids, such as di-hexadecyl-racemic-glycerol or 1,2-di-O-hexadecyl-racemic-glycerol-3-H-phosphonate triethyl-ammonium (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783); polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973) or adamantane acetate palmitoyl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237); octadecylamine or hexano-carbonyl-hydroxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937); tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740) or GalNAc clusters (e.g., WO2014 / 179620).

[0258] Joining part

[0259] The conjugated portion includes, but is not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin portions, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, bile acid portions, folates, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinones, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0260] In some embodiments, the conjugated portion comprises an active pharmaceutical ingredient, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprafen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenoxuric acid, leucovorin, benzothiazide, chlorothiazide, diazoxide, indomethacin, barbiturate, cephalosporin, sulfonamides, antidiabetic drugs, antibacterial agents, or antibiotics.

[0261] splicing joint

[0262] The conjugated portion is linked to the oligonucleotide via a conjugation linker. In some oligomers, the conjugation linker is a single chemical bond (i.e., the conjugated portion is directly linked to the oligonucleotide via a single bond). In some oligomers, the conjugated portion is linked to the oligonucleotide via a more complex conjugation linker comprising one or more conjugation linker portions, which are subunits constituting the conjugation linker. In some embodiments, the conjugation linker comprises an oligomer of a chain structure (e.g., a hydrocarbon chain) or a repeating unit (e.g., an ethylene glycol, nucleoside, or amino acid unit).

[0263] In some embodiments, the coupling connector comprises one or more groups selected from the group consisting of alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino. In some such embodiments, the coupling connector comprises groups selected from the group consisting of alkyl, amino, oxo, amide, and ether groups. In some embodiments, the coupling connector comprises groups selected from alkyl and amide groups. In some embodiments, the coupling connector comprises groups selected from alkyl and ether groups. In some embodiments, the coupling connector comprises at least one phosphorus moiety. In some embodiments, the coupling connector comprises at least one phosphate ester moiety. In some embodiments, the coupling connector includes at least one neutral linker group.

[0264] In some embodiments, the conjugation linker, including the conjugation linker described above, is a bifunctional linker, such as those known in the art for attaching a conjugating group to a parent compound, such as the oligonucleotides provided herein. Generally, a bifunctional linker comprises at least two functional groups. One functional group is selected to bind to a specific site on the parent compound, and another functional group is selected to bind the conjugating group. Examples of functional groups used in a bifunctional linker include, but are not limited to, electrophiles for reacting with nucleophiles and nucleophiles for reacting with electrophilic groups. In some embodiments, the bifunctional linker comprises one or more groups selected from the group consisting of amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0265] Examples of coupling links include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxanoic acid (ADO), 4-(N-cis-butenyliminomethyl)cyclohexane-1-carboxylic acid succinimide ester (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other coupling links include, but are not limited to, substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl groups, either substituted or unsubstituted, C2-C 10 Alkynyl, wherein a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0266] In some embodiments, the conjugated linker comprises 1-10 linker-nucleosides. In some embodiments, the conjugated linker comprises 2-5 linker-nucleosides. In some embodiments, the conjugated linker comprises exactly 3 linker-nucleosides. In some embodiments, the conjugated linker comprises a TCA motif. In some embodiments, such linker-nucleosides are modified nucleosides. In some embodiments, such linker-nucleosides comprise a modified sugar moiety. In some embodiments, the linker-nucleosides are unmodified. In some embodiments, the linker-nucleosides comprise a heterocyclic base selected from optionally protected heterocyclic bases: purine, substituted purine, pyrimidine, or substituted pyrimidine. In some embodiments, the cleavable moiety is a nucleoside selected from: uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is generally desirable to cleave the oligomer after it reaches the target tissue. Therefore, linker nucleosides are typically linked to each other via cleavable bonds and to the remainder of the oligomer. In some embodiments, such cleavable bonds are phosphodiester bonds.

[0267] In this document, linker-nucleosides are not considered part of an oligonucleotide. Therefore, in embodiments where the oligomer comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or having a specified percentage of complementarity with a reference nucleic acid, and / or where the oligomer also comprises a conjugate group including a linker with a linker-nucleoside, those linker-nucleosides are not counted in the length of the oligonucleotide and are not used to determine the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomer may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides consecutive to the nucleosides of the modified oligonucleotide. The total number of consecutive linked nucleosides in such oligomers is more than 30. Alternatively, an oligomer may comprise a modified oligonucleotide consisting of 8-30 nucleosides and without a conjugate group. The total number of consecutive linked nucleosides in such oligomers is no more than 30. Unless otherwise indicated, the linker comprises no more than 10 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 5 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 3 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 2 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 1 linker-nucleoside.

[0268] In some embodiments, it is desirable to cleave the conjugated group from the oligonucleotide. For example, in certain cases, oligomeric compounds containing a specific conjugated moiety may be better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable to cleave the conjugated group to release the unconjugated or parent oligonucleotide. Therefore, some conjugated linkers may contain one or more cleavable moieties. In some embodiments, the cleavable moiety is a cleavable bond. In some embodiments, the cleavable moiety is a group of atoms containing at least one cleavable bond. In some embodiments, the cleavable moiety contains a group of atoms having one, two, three, four, or more than four cleavable bonds. In some embodiments, the cleavable moiety is selectively cleaved in a cellular or subcellular compartment such as a lysosome. In some embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0269] In some embodiments, the cleavable bond is selected from: amides, esters, ethers, one or two esters of a phosphodiester, phosphates, carbamates, or disulfides. In some embodiments, the cleavable bond is one or two esters of a phosphodiester. In some embodiments, the cleavable moiety comprises a phosphate ester or a phosphodiester. In some embodiments, the cleavable moiety is a phosphate ester bond between an oligonucleotide and a conjugated moiety or conjugated group.

[0270] In some embodiments, the cleavable portion comprises or is composed of one or more linker-nucleosides. In some such embodiments, the one or more linker-nucleosides are linked to each other by cleavable bonds and / or to the remainder of the oligomeric compound. In some embodiments, such cleavable bonds are unmodified phosphodiester bonds. In some embodiments, the cleavable portion is a 2'-deoxyribonucleoside linked to the 3' or 5' terminal nucleoside of the oligonucleotide by phosphate ester nucleoside interlinking and covalently linked to the conjugated linker or the remainder of the conjugated portion by phosphate ester or thiophosphate ester nucleoside interlinking. In some such embodiments, the cleavable portion is 2'-deoxyadenosine.

[0271] certain terminal groups

[0272] In some embodiments, the oligomeric compound comprises one or more terminal groups. In some such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate ester. Stabilized 5'-phosphate esters include, but are not limited to, 5'-phosphonates, including, but not limited to, 5'-vinylphosphonates. In some embodiments, the terminal groups comprise one or more base-free nucleosides and / or inverse nucleosides. In some embodiments, the terminal groups comprise one or more 2'-linked nucleosides. In some such embodiments, the 2'-linked nucleosides are base-free nucleosides.

[0273] Oligomeric distreptides

[0274] In some embodiments, the oligomers described herein comprise oligonucleotides whose nucleobase sequences are complementary to the sequence of the target nucleic acid. In some embodiments, the oligomers are paired with a second oligomer to form an oligoduplex. Such oligoduplexes comprise a portion of a first oligomer complementary to the target nucleic acid and a portion of a second oligomer complementary to the first oligomer. In some embodiments, the first oligomer of the oligoduplex comprises or consists of: (1) a modified or unmodified oligonucleotide and optionally a conjugating group and (2) a second modified or unmodified oligonucleotide and optionally a conjugating group. Either or both oligomers of the oligoduplex may comprise a conjugating group. The oligonucleotide of each oligomer of the oligoduplex may comprise a non-complementary dangling nucleoside.

[0275] antisense activity

[0276] In some embodiments, the oligomeric compound and oligoduplex are capable of hybridizing with the target nucleic acid to produce at least one antisense activity; such oligomeric compounds and oligoduplexes are antisense compounds. In some embodiments, the antisense compound has antisense activity when it reduces, modulates, or increases the amount or activity of the target nucleic acid by 25% or more in a standard cellular assay. In some embodiments, the antisense compound selectively affects one or more target nucleic acids. Such antisense compounds comprise the following nucleotide sequence, which hybridizes with one or more target nucleic acids to produce one or more desired antisense activities, and does not hybridize with one or more non-target nucleic acids, or does not hybridize with one or more non-target nucleic acids in a manner that produces significant undesired antisense activity.

[0277] In some antisense activities, hybridization of the antisense compound with the target nucleic acid leads to the recruitment of a protein that cleaves the target nucleic acid. For example, some antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in this RNA:DNA duplex does not need to be unmodified DNA. In some embodiments, antisense compounds are provided herein that are sufficiently "DNA-like" to elicit RNase H activity. In some embodiments, one or more non-DNA-like nucleotides in the spacer space are permissible.

[0278] In some antisense activities, an antisense compound, or a portion thereof, is loaded into the RNA-induced silencing complex (RISC), ultimately leading to the cleavage of the target nucleic acid. For example, some antisense compounds induce target nucleic acid cleavage via Argonaute. The antisense compound loaded into the RISC is an RNAi compound. RNAi compounds can be double-stranded (siRNA) or single-stranded (ssRNA).

[0279] In some embodiments, hybridization of the antisense compound with the target nucleic acid does not result in the recruitment of proteins that cleave the target nucleic acid. In some embodiments, hybridization of the antisense compound with the target nucleic acid results in alterations in the splicing of the target nucleic acid. In some embodiments, hybridization of the antisense compound with the target nucleic acid results in inhibition of binding interactions between the target nucleic acid and proteins or other nucleic acids. In some embodiments, hybridization of the antisense compound with the target nucleic acid results in alterations in the translation of the target nucleic acid. In some embodiments, hybridization of the antisense compound with the target nucleic acid results in exon inclusion. In some embodiments, hybridization of the antisense compound with the target nucleic acid results in an increase in the amount or activity of the target nucleic acid. In some embodiments, hybridization of an antisense compound complementary to the target nucleic acid results in alterations in splicing, thereby leading to exon inclusion in the mRNA.

[0280] Antisense activity can be observed directly or indirectly. In some embodiments, observing or detecting antisense activity involves observing or detecting changes in the amount of target nucleic acid or protein encoded by said target nucleic acid, changes in the ratio of splice variants of nucleic acid or protein, and / or phenotypic changes in cells or subjects.

[0281] certain target nucleic acids

[0282] In some embodiments, the oligomeric compound comprises or is composed of an oligonucleotide complementary to the target nucleic acid. In some embodiments, the target nucleic acid is an endogenous RNA molecule. In some embodiments, the target nucleic acid encodes a protein. In some such embodiments, the target nucleic acid is selected from mature mRNA and precursor mRNA, including introns, exons, and untranslated regions. In some embodiments, the target nucleic acid is mature mRNA. In some embodiments, the target nucleic acid is precursor mRNA. In some embodiments, the target region is entirely within an intron. In some embodiments, the target region spans an intron / exon junction. In some embodiments, at least 50% of the target region is within an intron.

[0283] Complementary / Mismatched with Target Nucleic Acid

[0284] It is possible to introduce mismatched bases without eliminating activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of oligonucleotides with 100% complementarity to bcl-2 mRNA and with three mismatches to bcl-xL mRNA to reduce the expression of bcl-2 and bcl-xL in vivo and in vitro. Furthermore, these oligonucleotides showed potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested the ability of a series of tandem 14-nucleobase oligonucleotides and 28- and 42-nucleobase oligonucleotide sequences containing two or three tandem oligonucleotides to inhibit the translation of human DHFR in a rabbit reticulocyte assay. The three 14-nucleobase oligonucleotides were each able to inhibit translation individually, albeit at a more moderate level compared to the 28- or 42-nucleobase oligonucleotides.

[0285] In some embodiments, the oligonucleotide is complementary to the target nucleic acid along its entire length. In some embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In some embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid along its entire length and a portion is 100% or completely complementary to the target nucleic acid. In some embodiments, the length of the completely complementary portion is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides.

[0286] In some embodiments, the oligonucleotide contains one or more mismatched nucleobases relative to the target nucleic acid. In some embodiments, the mismatch occurs at the 1, 2, 3, ..., ... positions starting from the 5' end of the oligonucleotide.

[0287] 20th position.

[0288] SMN2

[0289] In some embodiments, the oligomeric compound comprises or is composed of a modified oligonucleotide complementary to or a portion thereof of a target nucleic acid encoding SMN2. In some embodiments, SMN2 has the sequence shown in SEQ ID NO:1 (GENBANK accession number NT_006713.14, truncated from nucleotides 19939708 to 19967777).

[0290] In some embodiments, contacting cells with an oligomeric compound complementary to SEQ ID NO:1 regulates the splicing of SMN2 RNA in the cells. In some embodiments, contacting cells with an oligomeric compound complementary to SEQ ID NO:1 increases the amount of SMN2 RNA including exon 7. In some embodiments, contacting cells with an oligomeric compound complementary to SEQ ID NO:1 increases the expression of full-length SMN2 protein. In some embodiments, the oligomeric compound consists of modified oligonucleotides.

[0291] In some embodiments, contacting a subject's cells with an oligomeric compound complementary to SEQ ID NO:1 improves one or more symptoms of a neurodegenerative disease. In some embodiments, the neurodegenerative disease is SMA, including type I SMA, type II SMA, type III SMA, and type IV SMA. In some embodiments, the symptoms are any of the following: decreased muscle strength; inability to sit, stand, and / or walk, or a reduced ability thereof; decreased neuromuscular activity; decreased electrical activity in one or more muscles; decreased respiration; inability to eat, drink, and / or breathe without assistance, or a reduced ability thereof; weight loss or decreased weight gain; and / or decreased survival.

[0292] In some embodiments, when administered according to a standard in vivo assay, the oligomeric compound complementary to SEQ ID NO:1 is capable of increasing SMN2 RNA, including exon 7, by at least 1, 2, or 3 times in vivo. In some embodiments, when administered according to a standard in vivo assay, the oligomeric compound complementary to SEQ ID NO:1 is capable of increasing full-length SMN2 protein by at least 1, 2, or 3 times in vivo.

[0293] Certain target nucleic acids in certain tissues

[0294] In some embodiments, the oligomeric compound comprises or is composed of an oligonucleotide complementary to or derived from the target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In some embodiments, the pharmacologically relevant tissue is the cells and tissues that constitute the central nervous system (CNS). Such tissues include brain tissue, such as the spinal cord, cortex, and coronary brain tissue.

[0295] Certain pharmaceutical compositions

[0296] In some embodiments, this document describes pharmaceutical compositions comprising one or more oligomeric compounds. In some embodiments, the one or more oligomeric compounds are each composed of modified oligonucleotides. In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In some embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more oligomeric compounds or thereof. In some embodiments, the sterile saline solution is pharmaceutical grade saline. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and sterile water or thereof. In some embodiments, the sterile water is pharmaceutical grade water. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and phosphate-buffered saline (PBS) or thereof. In some embodiments, the sterile PBS is pharmaceutical grade PBS. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”) or thereof. In some embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0297] In some embodiments, the pharmaceutical composition comprises modified oligonucleotides and artificial cerebrospinal fluid. In some embodiments, the pharmaceutical composition consists of modified oligonucleotides and artificial cerebrospinal fluid. In some embodiments, the pharmaceutical composition consists essentially of modified oligonucleotides and artificial cerebrospinal fluid. In some embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0298] In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In some embodiments, the excipients are selected from water, salt solution, ethanol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silica, viscous paraffin, hydroxymethyl cellulose, and polyvinylpyrrolidone.

[0299] In some embodiments, oligomeric compounds may be mixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. The composition and method of formulation of pharmaceutical compositions depend on many criteria, including but not limited to the route of administration, disease severity, or dose to be administered.

[0300] In some embodiments, pharmaceutical compositions comprising oligomeric compounds encompass any pharmaceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In some embodiments, pharmaceutical compositions comprising oligomeric compounds including one or more oligonucleotides are capable of providing (directly or indirectly) a bioactive metabolite or its residues when administered to a subject (including humans). Therefore, for example, this disclosure also relates to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments, a prodrug comprises one or more conjugate groups linked to an oligonucleotide, wherein the conjugate groups are cleaved in vivo by an endogenous nuclease. In some embodiments, a prodrug comprises one or more conjugate groups linked to an oligonucleotide, wherein the conjugate groups are cleaved in vivo by an endogenous nuclease.

[0301] Lipid moieties have been used in nucleic acid therapy in various methods. In some such methods, nucleic acids (e.g., oligomeric compounds) are introduced into pre-formed liposomes or lipid complexes made from a mixture of cationic and neutral lipids. In some methods, DNA complexes with monocationic or polycationic lipids are formed in the absence of neutral lipids. In some embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to specific cells or tissues. In some embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to adipose tissue. In some embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to muscle tissue.

[0302] In some embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems can be used to prepare certain pharmaceutical compositions, including those comprising hydrophobic compounds. In some embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0303] In some embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents comprising the oligomeric compounds provided herein to a specific tissue or cell type. For example, in some embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

[0304] In some embodiments, the pharmaceutical composition comprises a cosolvent system. Some of these cosolvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In some embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which comprises 3% w / v benzyl alcohol and 8% w / v nonpolar surfactant polysorbate 80. TM And an absolute ethanol solution of 65% w / v polyethylene glycol 300. The proportions of such co-solvent systems can vary significantly without substantially altering their solubility and toxicity characteristics. Furthermore, the identity of the co-solvent components can be varied: for example, other surfactants can be used instead of polysorbate 80. TM The fractional size of polyethylene glycol can vary; other biocompatible polymers can replace polyethylene glycol, such as polyvinylpyrrolidone; and other sugars or polysaccharides can replace dextrose.

[0305] In some embodiments, the pharmaceutical composition is prepared for oral administration. In some embodiments, the pharmaceutical composition is prepared for buccal administration. In some embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), etc.). In some such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hanks's solution, Ringer's solution, or saline buffer. In some embodiments, other components are included (e.g., components that aid dissolution or act as preservatives). In some embodiments, an injectable suspension is prepared using a suitable liquid carrier, suspending agent, etc. Some injectable pharmaceutical compositions are presented in unit dosage form, such as in ampoules or multi-dose containers. Some injectable pharmaceutical compositions are suspensions, solutions, or emulsions in oily or aqueous media and may contain formulations such as suspending agents, stabilizers, and / or dispersants. Certain solvents suitable for injectable pharmaceutical compositions include, but are not limited to: lipophilic solvents and fatty oils, such as sesame oil; synthetic fatty acid esters, such as ethyl oleate or triglycerides; and liposomes.

[0306] Under certain conditions, some of the compounds disclosed herein act as acids. While such compounds can be drawn or described in protonated (free acid) or ionized and associated with cations (salt) forms, aqueous solutions of these compounds exist in equilibrium in these forms. For example, the phosphate ester bonds of oligonucleotides in aqueous solutions exist in equilibrium as free acid, anion, and salt. Unless otherwise indicated, the compounds described herein are intended to include all such forms. Furthermore, some oligonucleotides have several such bonds, each in equilibrium. Thus, oligonucleotides in solution exist in a series of forms at multiple sites, all in equilibrium. The term "oligonucleotide" is intended to include all such forms. The drawn structures must depict a single form. However, unless otherwise indicated, such drawings are also intended to include corresponding forms. In this document, the term "or its salt" following the structure depicting the free acid of a compound explicitly includes all such forms, which may be fully or partially protonated / deprotonated / associated with cations. In some cases, one or more specific cations are identified.

[0307] In some embodiments, the modified oligonucleotide or oligomer is in an aqueous solution containing sodium. In some embodiments, the modified oligonucleotide or oligomer is in an aqueous solution containing potassium. In some embodiments, the modified oligonucleotide or oligomer is in PBS. In some embodiments, the modified oligonucleotide or oligomer is in water. In some such embodiments, the pH of the solution is adjusted to the desired pH using NaOH and / or HCl.

[0308] This document describes certain specific dosages. Dosages may be expressed in units of dosage. For clarity, the dosage (or unit of dosage) (mg) of a modified oligonucleotide or oligomer indicates the mass of the modified oligonucleotide or oligomer in its free acid form. As described above, in aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purposes of dosage calculation, it is assumed that the modified oligonucleotide or oligomer is present in a solvent-free, sodium acetate-free, anhydrous, free acid form. For example, in the case of a modified oligonucleotide or oligomer in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomer may be partially or completely deprotonated and associated with Na+ ions. However, the mass of the protons is still included in the weight of the dosage, while the mass of the Na+ ions is not included in the weight of the dosage. Therefore, for example, the dose or dose unit of 10 mg of compounds 1263789, 1287717, 1287745, and 1358996 is equal to the number of fully protonated molecules weighing 10 mg. This is equivalent to: 10.53 mg of solvent-free, sodium acetate-free, anhydrous sodium ionized compound 1263789; 10.53 mg of solvent-free, sodium acetate-free, anhydrous sodium ionized compound 1287717; 10.52 mg of solvent-free, sodium acetate-free, anhydrous sodium ionized compound 1287745; and 10.51 mg of solvent-free, sodium acetate-free, anhydrous sodium ionized compound 1358996. When the oligomer contains a conjugated group, the mass of the conjugated group is included when calculating the dose of such oligomers. If the conjugated group is also acidic, it is also assumed that the conjugated group is fully protonated for the purpose of dose calculation.

[0309] Certain compositions

[0310] Compound number: 1263789

[0311] In some embodiments, compound number 1263789 is characterized as a modified oligonucleotide having the sequence (5' to 3') CACTTTCATAATGCTGGC (SEQ ID NO: 21), wherein each nucleoside contains a 2'-MOE sugar moiety, wherein the inter-nucleoside linkage between nucleosides 2 to 3 and 4 to 5 is a phosphodiester nucleoside linkage, and the inter-nucleoside linkage between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17 and 17 to 18 is a thiophosphate nucleoside linkage, and wherein each cytosine is 5-methylcytosine.

[0312] In some embodiments, compound number 1263789 is represented by the following chemical notation (5' to 3'): m C es A eo m C es T eo T es T es m C es A es T es A es A es T es G es m C es T es G es G es m C e (SEQ ID NO:21),

[0313] in,

[0314] A = adenine nucleobase,

[0315] m C = 5-methylcytosine nucleobase,

[0316] G = guanine nucleobase

[0317] T = thymine nucleobase,

[0318] e = 2'-MOE sugar moiety,

[0319] s = thiophosphate nucleoside linkage, and

[0320] o = phosphate diester nucleoside linkage.

[0321] In some embodiments, compound number 1263789 is represented by the following chemical structure:

[0322]

[0323] (SEQ ID NO:21).

[0324] Structure 1. Compound number 1263789

[0325] In some embodiments, the sodium salt of compound number 1263789 is represented by the following chemical structure:

[0326]

[0327] (SEQ ID NO:21).

[0328] Structure 2. Sodium salt of compound number 1263789

[0329] Compound number: 1287717

[0330] In some embodiments, compound number 1287717 is characterized as a modified oligonucleotide having the sequence (5' to 3') TTCACTTTCATAATGCTGGC (SEQ ID NO: 22), wherein each nucleoside contains a 2'-MOE sugar moiety, wherein the inter-nucleoside linkages between nucleosides 1 to 2 and 19 to 20 are phosphodiester nucleoside linkages, and the inter-nucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18 and 18 to 19 are thiophosphate nucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0331] In some embodiments, compound number 1287717 is represented by the following chemical notation (5' to 3'):

[0332] T eo T es m C es A es m C es T es T es T es m C es A es T es A es A es T es G es m C es T es G es G eo m C e (SEQ ID NO:22)

[0333] in,

[0334] A = adenine nucleobase,

[0335] m C = 5-methylcytosine nucleobase,

[0336] G = guanine nucleobase

[0337] T = thymine nucleobase,

[0338] e = 2'-MOE sugar moiety,

[0339] s = thiophosphate nucleoside linkage, and

[0340] o = phosphate diester nucleoside linkage.

[0341] In some embodiments, compound number 1287717 is represented by the following chemical structure:

[0342]

[0343] (SEQ ID NO:22).

[0344] Structure 3. Compound number 1287717

[0345] In some embodiments, the sodium salt of compound number 1287717 is represented by the following chemical structure:

[0346]

[0347] (SEQ ID NO:22).

[0348] Structure 4. Sodium salt of compound number 1287717

[0349] Compound number: 1287745

[0350] In some embodiments, compound number 1287745 is characterized as a modified oligonucleotide having the sequence (5' to 3') TTCACTTTCATAATGCTGGC (SEQ ID NO: 22), wherein each of nucleosides 1 and 20 contains a 2'-MOE sugar moiety, each of nucleosides 2-19 contains a 2'-NMA sugar moiety, wherein the inter-nucleoside linkages between nucleosides 1 to 2 and 19 to 20 are phosphodiester inter-nucleoside linkages, and the inter-nucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18 and 18 to 19 are thiophosphate inter-nucleoside linkages, and wherein each cytosine is 5-methylcytosine.

[0351] In some embodiments, compound number 1287745 is represented by the following chemical notation (5' to 3'):

[0352] T eo T ns m Cns A ns m C ns T ns T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G no m C e (SEQ ID NO:22)

[0353] in,

[0354] A = adenine nucleobase,

[0355] m C = 5-methylcytosine nucleobase,

[0356] G = guanine nucleobase

[0357] T = thymine nucleobase,

[0358] e = 2'-MOE sugar moiety,

[0359] n = 2'-NMA sugar portion,

[0360] s = thiophosphate nucleoside linkage, and

[0361] o = phosphate diester nucleoside linkage.

[0362] In some embodiments, compound number 1287745 is represented by the following chemical structure:

[0363]

[0364] (SEQ ID NO:22).

[0365] Structure 5. Compound number 1287745

[0366] In some embodiments, the sodium salt of compound number 1287745 is represented by the following chemical structure:

[0367]

[0368] (SEQ ID NO:22).

[0369] Structure 6. Sodium salt of compound number 1287745

[0370] Compound number: 1358996

[0371] In some embodiments, compound number 1358996 is characterized as a modified oligonucleotide having the sequence (5' to 3') CACTTTCATAATGCTGGC (SEQ ID NO: 21), wherein each nucleoside contains a 2'-NMA sugar moiety, wherein the inter-nucleoside linkage between nucleosides 2 to 3 and 4 to 5 is a phosphodiester inter-nucleoside linkage, and the inter-nucleoside linkage between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17 and 17 to 18 is a thiophosphate inter-nucleoside linkage, and wherein each cytosine is 5-methylcytosine.

[0372] In some embodiments, compound number 1358996 is represented by the following chemical notation (5' to 3'):

[0373] m C ns A no m C ns T no T ns T ns m C ns A ns T ns A ns A ns T ns G ns m C ns T ns G ns G ns m C n (SEQ IDNO:21)

[0374] in,

[0375] A = adenine nucleobase,

[0376] m C = 5-methylcytosine nucleobase,

[0377] G = guanine nucleobase

[0378] T = thymine nucleobase,

[0379] n = 2'-NMA sugar portion,

[0380] s = thiophosphate nucleoside linkage, and

[0381] o = phosphate diester nucleoside linkage.

[0382] In some embodiments, compound number 1358996 is represented by the following chemical structure:

[0383]

[0384] (SEQ ID NO:21).

[0385] Structure 7. Compound number 1358996

[0386] In some embodiments, the sodium salt of compound number 1358996 is represented by the following chemical structure:

[0387]

[0388] (SEQ ID NO:21).

[0389] Structure 8. Sodium salt of compound number 1358996

[0390] Certain comparative compositions

[0391] In some implementations, drugs approved for the treatment of SMA (Common name nusinersen; compound number 396443) is a comparative compound (see, for example, Chiroboga et al., Neurology, 86(10):890-897, 2016; Finkel et al., Lancet, 338(10063):3017-3026, 2016; Finkel et al., N. Engl. J. Med., 377(18):1723-1732, 2017; Mercuri et al., N. Engl. J. Med., 378(7):625-635, 2018; Montes et al., Muscle Nerve. 60(4):409-414, 2019; Darras et al., Neurology, 92(21):e2492-e2506, 2019). Previously described in WO2010120820 (which is incorporated herein by reference) and having the sequence (5' to 3')TCACTTTCATAATGCTGG (SEQ ID NO:23), wherein each nucleoside contains a 2'-MOE sugar moiety, the inter-nucleoside linkage is a phosphate thioester inter-nucleoside linkage, and each cytosine is a 5-methylcytosine.

[0392] In some embodiments, other previously described compounds, including compound numbers 387954, 396442, 443305 and 819735, are comparative compounds, although they are not approved for human treatment.

[0393] Compound number 387954 was previously described in WO 2014 / 179620, which is incorporated herein by reference. Compound number 387954 has the sequence (5' to 3')ATTCACTTTCATAATGCTGG (SEQ ID NO:20), wherein each nucleoside contains a 2'-MOE sugar moiety, the inter-nucleoside linkage is a phosphate thioester inter-nucleoside linkage, and each cytosine is a 5-methylcytosine.

[0394] Compound number 396442 was previously described in WO 2010 / 120820, which is incorporated herein by reference. Compound number 396442 has the sequence (5' to 3') CACTTTCATAATGCTGGC (SEQ ID NO:21), wherein each nucleoside contains a 2'-MOE sugar moiety, the inter-nucleoside linkage is a phosphate thioester inter-nucleoside linkage, and each cytosine is a 5-methylcytosine.

[0395] Compound number 443305 was previously described in WO 2018 / 014041, which is incorporated herein by reference. Compound number 443305 has the sequence (5' to 3')TCACTTTCATAATGCTGG (SEQ ID NO:23), wherein each nucleoside contains a 2'-NMA sugar moiety, the inter-nucleoside linkage is a phosphate thioester inter-nucleoside linkage, and each cytosine is a 5-methylcytosine.

[0396] Compound number 819735 was previously described in WO 2018 / 014041, which is incorporated herein by reference. Compound number 819735 has the sequence (5' to 3') CACTTTCATAATGCTGGC (SEQ ID NO:21), wherein each nucleoside contains a 2'-NMA sugar moiety, the inter-nucleoside linkage is a phosphate thioester inter-nucleoside linkage, and each cytosine is a 5-methylcytosine.

[0397] Table 1 Some comparative compositions

[0398]

[0399] In some embodiments, the compounds described herein are superior to those described in WO 2007 / 002390, WO2010 / 120820, WO 2015 / 161170 and WO 2018 / 014041 because they exhibit one or more improved properties, such as potency, efficacy and tolerability.

[0400] For example, compounds 1263789, 1287745, and 1358996 each exhibited improved in vivo potency compared to compound 396443. As shown in Example 5, compounds 1263789, 1287745, and 1358996 achieved ED at 13.3, 8.8, and 7.4 in the spinal cord, respectively. 50 In contrast, compound number 396443 achieved an ED of 22.0 in the spinal cord. 50 Therefore, each of compound numbers 1263789, 1287745, and 1358996 is more effective than compound number 396443 in this assay.

[0401] For example, compounds 1263789, 1287717, 1287745, and 1358996 each exhibited improved 3-hour FOB scores compared to compounds 396443, 387954, and 443305. As shown in Example 6, at 700 μg, compounds 1263789, 1287717, 1287745, and 1358996 achieved 3-hour FOB scores of 0, 3.25, 1, and 0, respectively. In contrast, at half the dose (350 μg), compound 396443 achieved a 3-hour FOB score of 4.0; and at the same dose (700 μg), compounds 387954 and 443305 achieved 3-hour FOB scores of 4.0 and 4.75, respectively. Therefore, each of compound number 1263789, compound number 1287717, compound number 1287745 and compound number 1358996 was more tolerant than compound number 396443, compound number 387954 and compound number 443305 in this assay.

[0402] For example, compounds 1263789, 1287717, 1287745, and 1358996 each exhibited improved long-term tolerability compared to compounds 396442 and 819735. As shown in Example 7, compounds 1263789, 1287717, 1287745, and 1358996 showed no adverse effects, no Purkinje cell loss, and less than twice the control level of cortical GFAP mRNA. In contrast, 396442 and 819735 each exhibited adverse events, Purkinje cell loss, and more than twice the control level of cortical GFAP mRNA in certain treated animals. Therefore, each of compound number 1263789, compound number 1287717, compound number 1287745 and compound number 1358996 was more tolerant than compound number 396442 and compound number 819735 in this assay.

[0403] Non-restrictive disclosure and inclusion by reference

[0404] The literature and patent disclosures listed herein are incorporated herein by reference in their entirety. Although certain compounds, compositions, and methods described herein have been specifically described with respect to certain embodiments, the following examples are for illustrative purposes only and are not intended to limit the scope of the compounds described herein. Each of the references, GenBank accession numbers, etc., cited in this application is incorporated herein by reference in its entirety.

[0405] Although the sequence listing accompanying this application identifies each sequence as “RNA” or “DNA” as needed, in practice, those sequences can be modified with any combination of chemical modifications. Those skilled in the art will readily appreciate that such nomenclature, such as “RNA” or “DNA”, describing modified oligonucleotides, is arbitrary in some cases. For example, an oligonucleotide containing a nucleoside comprising a 2'-OH sugar moiety and a thymine base may be described as DNA having a modified sugar moiety (2'-OH replacing a 2'-H in DNA) or as RNA having a modified base (thymine (methylated uracil) replacing uracil in RNA). Therefore, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to cover nucleic acids containing any combination of native or modified RNA and / or DNA, including but not limited to such nucleic acids having modified nucleobases. Further, but not limited to, the term "ATCGATCG" encompasses any oligomer with such a nucleobase sequence, whether modified or unmodified, including but not limited to: such compounds containing RNA bases, such as those with the sequence "AUCGAUCG"; those containing some DNA bases and some RNA bases, such as "AUCGATCG"; and oligomers with other modified nucleobases, such as "AT". m CGAUCG", where m C represents a cytosine base containing a methyl group at the 5-position.

[0406] Some of the compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers and thus produce enantiomers, diastereomers, and other stereoisomers, which can be defined by absolute stereochemistry as (R) or (S), α or β (e.g., for glycomutomers) or (D) or (L) (e.g., for amino acids), etc. The compounds depicted or described herein as having certain stereoisomers include only those indicated. Unless otherwise specified, the compounds depicted or described herein as having indeterminate stereochemistry include all such possible isomers, including their stereorandom and optically pure forms. Similarly, unless otherwise indicated, all cis and trans isomers and tautomers of the compounds described herein are also included. The oligomers described herein include chiral pure or chiral-enriched mixtures and racemic mixtures. For example, oligomers having multiple thiophosphate nucleoside linkages include such compounds where the chirality of the thiophosphate nucleoside linkages is controlled or atactic. Unless otherwise indicated, the compounds described herein are intended to include the corresponding salt forms.

[0407] The compounds described herein include variants in which one or more atoms are replaced by non-radioactive or radioactive isotopes of the indicated element. For example, compounds containing hydrogen atoms are covered herein. 1 All possible deuterium substitutions of the H hydrogen atom. Isotopic substitutions covered in the compounds described herein include, but are not limited to: 2 H or 3 H instead 1 H; 13 C or 14 C instead 12 C; 15 N instead 14 N; 17 O or 18 O instead 16 O; and 33 S. 34 S. 35 S or 36 S instead 32 S. In some embodiments, non-radioactive isotope substitution can endow oligomeric compounds with novel properties beneficial for use as therapeutic or research tools. In some embodiments, radioactive isotope substitution can adapt the compound for research or diagnostic purposes, such as imaging.

[0408] Example

[0409] The following examples illustrate certain embodiments of this disclosure, but are not limiting. Furthermore, while providing specific embodiments, the inventors have considered the general application of those specific embodiments.

[0410] Example 1: Design of modified oligonucleotides complementary to human SMN2 nucleic acid

[0411] As indicated in the table below, designed and synthesized modified oligonucleotides complementary to human SMN2 nucleic acid.

[0412] The modified oligonucleotides in the table below are 16, 17, 18, 19, or 20 nucleotides in length, as specified. The modified oligonucleotides contain a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a cEt sugar moiety, a 2'-OMe sugar moiety, and / or a 2'-β-D-deoxyribosyl sugar moiety, as specified. The internucleotide linkages within each nucleotide of the entire modified oligonucleotide are either phosphate-thioester or phosphodiester linkages, as specified. The cytosine is either unmethylated cytosine or 5-methylcytosine, as specified.

[0413] Unless otherwise specified, each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (GENBANK accession number NT_006713.14, truncated from nucleoside 19939708 to 19967777). Non-complementary nucleotides are indicated in the nucleobase sequence column. Underline, bold, and italic fonts Specify. The table below lists the active sites of each modified oligonucleotide targeting the SMN2 transcript, including exon 7. "Start site" indicates the most complementary 5'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide. "Termination site" indicates the most complementary 3'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide.

[0414] Table 2

[0415] The modified oligonucleotides in Table 2 below are 16, 17, 18, 19, or 20 nucleotides in length. Each nucleotide contains a 2'-MOE sugar motif. The glycosylation motif for each modified oligonucleotide is provided in the glycosylation motif column, where each 'e' represents the 2'-MOE sugar motif. The internucleotide linkage is either a phosphate thioester linkage or a phosphodiester linkage. The internucleotide linkage motif for each modified oligonucleotide is provided in the internucleotide linkage motif column, where each 's' represents a phosphate thioester linkage and each 'o' represents a phosphodiester linkage. Each cytosine is 5-methylcytosine.

[0416] Unless otherwise specified, each modified oligonucleotide listed in Table 2 below is 100% complementary to SEQ ID NO:1 (GENBANK accession number NT_006713.14, truncated from nucleoside 19939708 to 19967777). Non-complementary nucleotides are listed in the nucleobase sequence column. Underline, bold, and italic fonts Specify. The “start site” indicates the most complementary 5'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide. The “stop site” indicates the most complementary 3'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide.

[0417] Table 2 Oligonucleotides with 2'-MOE modifications and PS or mixed PS / PO nucleotide linkages.

[0418]

[0419]

[0420]

[0421]

[0422]

[0423]

[0424]

[0425]

[0426]

[0427] Table 3

[0428] The modified oligonucleotides in Table 3 below are 16, 17, 18, 19, or 20 nucleotides in length. Each nucleotide contains a 2'-NMA sugar motif. The glycosylation motif for each modified oligonucleotide is provided in the glycosylation motif column, where each 'n' represents the 2'-NMA sugar motif. The internucleotide linkage is either a phosphate thioester linkage or a phosphodiester linkage. The internucleotide linkage motif for each modified oligonucleotide is provided in the internucleotide linkage motif column, where each 's' represents a phosphate thioester linkage and each 'o' represents a phosphodiester linkage. Each cytosine is 5-methylcytosine.

[0429] Each modified oligonucleotide listed in Table 3 below is 100% complementary to SEQ ID NO:1 (GENBANK Registry No. NT_006713.14, truncated from nucleosides 19939708 to 19967777). “Start site” indicates the most complementary 5'-nucleoside in the target nucleic acid sequence to the modified oligonucleotide. “Termination site” indicates the most complementary 3'-nucleoside in the target nucleic acid sequence to the modified oligonucleotide.

[0430] Table 3 Oligonucleotides with 2'-NMA modification and PS or mixed PS / PO nucleotide linkages.

[0431]

[0432]

[0433]

[0434] Table 4

[0435] The modified oligonucleotides in Table 4 below are 18 or 19 nucleotides in length. Each nucleotide contains either a 2'-MOE sugar motif or a 2'-NMA sugar motif. The glycosylation motif for each modified oligonucleotide is provided in the glycosylation motif column, where each 'e' represents the 2'-MOE sugar motif and each 'n' represents the 2'-NMA sugar motif. The internucleotide linkage is a phosphate thioester linkage. The internucleotide linkage motif for each modified oligonucleotide is provided in the internucleotide linkage motif column, where each 's' represents a phosphate thioester linkage. Each cytosine is 5-methylcytosine.

[0436] Unless otherwise specified, each modified oligonucleotide listed in Table 4 below is 100% complementary to SEQ ID NO:1 (GENBANK accession number NT_006713.14, truncated from nucleoside 19939708 to 19967777). Non-complementary nucleotides are listed in the nucleobase sequence column. Underline, bold, and italic fonts Specify. The “start site” indicates the most complementary 5'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide. The “stop site” indicates the most complementary 3'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide.

[0437] Table 4. Oligonucleotides with PS nucleotide-linked hybrid 2'-MOE / 2'-NMA modifications

[0438]

[0439] Table 5

[0440] The modified oligonucleotides in Table 5 below are 16, 17, or 18 nucleotides in length. Each nucleotide contains either a 2'-MOE sugar motif or a cEt sugar motif. The glycosylation motif for each modified oligonucleotide is provided in the glycosylation motif column, where each 'e' represents the 2'-MOE sugar motif and each 'k' represents the cEt sugar motif. Each nucleotide linkage is a phosphate thioester linkage. The linkage motif for each modified oligonucleotide is provided in the linkage motif column, where each 's' represents a phosphate thioester linkage. Each cytosine is 5-methylcytosine.

[0441] Each modified oligonucleotide listed in Table 5 below is 100% complementary to SEQ ID NO:1 (GENBANK Registry No. NT_006713.14, truncated from nucleosides 19939708 to 19967777). “Start site” indicates the most complementary 5'-nucleoside in the target nucleic acid sequence to the modified oligonucleotide. “Termination site” indicates the most complementary 3'-nucleoside in the target nucleic acid sequence to the modified oligonucleotide.

[0442] Table 5 Oligonucleotides with mixed 2'-MOE / cEt modifications and PS nucleotide interlinking.

[0443]

[0444]

[0445]

[0446] Table 6

[0447] The modified oligonucleotides in Table 6 below are 19 or 20 nucleotides in length. Each nucleotide contains a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, a 2'-OMe sugar moiety, or a 2'-β-D-deoxyribosyl sugar moiety. The glycosyl motif for each modified oligonucleotide is provided in the glycosyl motif column, where each 'e' represents the 2'-MOE sugar moiety, each 'n' represents the 2'-NMA sugar moiety, each 'y' represents the 2'-OMe sugar moiety, and each 'd' represents the 2'-β-D-deoxyribosyl sugar moiety. The internucleotide linkages are either phosphate thioester nucleoside linkages or phosphodiester nucleoside linkages. The internucleotide linking motif provided for each modified oligonucleotide in the internucleotide linking motif column is (5' to 3'): sssssssssssssssssso; where each 's' represents a phosphate thioester internucleotide linking and each 'o' represents a phosphate diester internucleotide linking. Cytosine is either unmethylated cytosine or 5-methylcytosine, where each lowercase 'c' in the nucleobase sequence column represents unmethylated cytosine and each uppercase 'C' in the nucleobase sequence column represents 5-methylcytosine.

[0448] Unless otherwise specified, each nucleobase in the modified oligonucleotides listed in Table 6 below is complementary to SEQ ID NO:1 (GENBANK accession number NT_006713.14, truncated from nucleoside 19939708 to 19967777). Non-complementary nucleobases are indicated in the nucleobase sequence column. Underline, bold, and italic fonts Specify. The “start site” indicates the most complementary 5'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide. The “stop site” indicates the most complementary 3'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide.

[0449] Table 6 Modified oligonucleotides with mixed PS / PO nucleotide linkages

[0450]

[0451]

[0452] Table 7

[0453] The modified oligonucleotides in Table 7 below are 19 or 20 nucleotides in length. Each nucleotide contains a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, or a 2'-β-D-deoxyribosyl sugar moiety. The glycosyl motif for each modified oligonucleotide is provided in the glycosyl motif column, where each 'e' represents the 2'-MOE sugar moiety, each 'n' represents the 2'-NMA sugar moiety, and each 'd' represents the 2'-β-D-deoxyribosyl sugar moiety. The internucleotide linkage is either a phosphate thioester linkage or a phosphodiester linkage. The internucleotide linkage motif for each modified oligonucleotide provided in the internucleotide linkage motif column is (5' to 3'): sssssssssssssssssoo; where each 's' represents a phosphate thioester linkage and each 'o' represents a phosphodiester linkage. Each cytosine is 5-methylcytosine.

[0454] Unless otherwise specified, each nucleobase in the modified oligonucleotides listed in Table 6 below is complementary to SEQ ID NO:1 (GENBANK accession number NT_006713.14, truncated from nucleoside 19939708 to 19967777). Non-complementary nucleobases are indicated in the nucleobase sequence column. Underline, bold, and italic fonts Specify. The “start site” indicates the most complementary 5'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide. The “stop site” indicates the most complementary 3'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide.

[0455] Table 7 Modified oligonucleotides with mixed PS / PO nucleotide linkages

[0456]

[0457]

[0458]

[0459] Table 8

[0460] The modified oligonucleotides in Table 8 below are each 19 nucleotides in length. Each nucleotide contains a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, or a 2'-β-D-deoxyribosyl sugar moiety. The glycosyl motif for each modified oligonucleotide is provided in the glycosyl motif column, where each 'e' represents the 2'-MOE sugar moiety, each 'n' represents the 2'-NMA sugar moiety, and each 'd' represents the 2'-β-D-deoxyribosyl sugar moiety. The internucleotide linkage is either a phosphate thioester linkage or a phosphodiester linkage. The internucleotide linkage motif for each modified oligonucleotide provided in the internucleotide linkage motif column is (5' to 3'): ssssssssssssososso; where each 's' represents a phosphate thioester linkage and each 'o' represents a phosphodiester linkage. Each cytosine is 5-methylcytosine.

[0461] Unless otherwise specified, each nucleobase in the modified oligonucleotides listed in Table 8 below is complementary to SEQ ID NO:1 (GENBANK accession number NT_006713.14, truncated from nucleoside 19939708 to 19967777). Non-complementary nucleobases are indicated in the nucleobase sequence column. Underline, bold, and italic fonts Specify. The “start site” indicates the most complementary 5'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide. The “stop site” indicates the most complementary 3'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide.

[0462] Table 8 Modified oligonucleotides with mixed PS / PO nucleotide interlinking

[0463]

[0464] Table 9

[0465] The modified oligonucleotides in Table 9 below are each 19 nucleotides in length. Each nucleotide contains a 2'-MOE sugar moiety, a 2'-NMA sugar moiety, or a 2'-β-D-deoxyribosyl sugar moiety. The glycosyl motif for each modified oligonucleotide is provided in the glycosyl motif column, where each 'e' represents the 2'-MOE sugar moiety, each 'n' represents the 2'-NMA sugar moiety, and each 'd' represents the 2'-β-D-deoxyribosyl sugar moiety. The internucleotide linkage is either a phosphate thioester linkage or a phosphodiester linkage. The internucleotide linkage motif for each modified oligonucleotide provided in the internucleotide linkage motif column is (5' to 3'): ssssssssssssssosso; where each 's' represents a phosphate thioester linkage and each 'o' represents a phosphodiester linkage. Each cytosine is 5-methylcytosine.

[0466] Unless otherwise specified, each nucleobase in the modified oligonucleotides listed in Table 9 below is complementary to SEQ ID NO:1 (GENBANK accession number NT_006713.14, truncated from nucleoside 19939708 to 19967777). Non-complementary nucleobases are indicated in the nucleobase sequence column. Underline, bold, and italic fonts Specify. The “start site” indicates the most complementary 5'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide. The “stop site” indicates the most complementary 3'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide.

[0467] Table 9 Modified oligonucleotides with mixed PS / PO nucleotide linkages

[0468]

[0469] Table 10

[0470] The modified oligonucleotides in Table 10 below are each 19 nucleotides in length. Each nucleotide contains either a 2'-MOE sugar motif or a 2'-NMA sugar motif. The glycosylation motif for each modified oligonucleotide is provided in the glycosylation motif column, where each 'e' represents the 2'-MOE sugar motif and each 'n' represents the 2'-NMA sugar motif. The internucleotide linkage is either a phosphate thioester linkage or a phosphodiester linkage. The internucleotide linkage motif for each modified oligonucleotide provided in the internucleotide linkage motif column is (5' to 3'): osssssssssssssssss; where each 's' represents a phosphate thioester linkage and each 'o' represents a phosphodiester linkage. Each cytosine is 5-methylcytosine.

[0471] Unless otherwise specified, each nucleobase in the modified oligonucleotides listed in Table 10 below is complementary to SEQ ID NO:1 (GENBANK accession number NT_006713.14, truncated from nucleoside 19939708 to 19967777). Non-complementary nucleobases are indicated in the nucleobase sequence column. Underline, bold, and italic fonts Specify. The “start site” indicates the most complementary 5'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide. The “stop site” indicates the most complementary 3'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide.

[0472] Table 10 Modified oligonucleotides with mixed PS / PO nucleotide linkages

[0473]

[0474] Table 11

[0475] The modified oligonucleotides in Table 11 below are each 20 nucleotides in length. Each nucleotide contains either a 2'-MOE sugar motif or a 2'-NMA sugar motif. The glycosylation motif for each modified oligonucleotide is provided in the glycosylation motif column, where each 'e' represents the 2'-MOE sugar motif and each 'n' represents the 2'-NMA sugar motif. The internucleotide linkage is either a phosphate thioester linkage or a phosphodiester linkage. The internucleotide linkage motif for each modified oligonucleotide provided in the internucleotide linkage motif column is (5' to 3'): ossssssssssssssssso; where each 's' represents a phosphate thioester linkage and each 'o' represents a phosphodiester linkage. Each cytosine is 5-methylcytosine.

[0476] Each modified oligonucleotide listed in Table 11 below is 100% complementary to SEQ ID NO:1 (GENBANK Registry No. NT_006713.14, truncated from nucleosides 19939708 to 19967777). “Start site” indicates the most complementary 5'-nucleoside in the target nucleic acid sequence to the modified oligonucleotide. “Termination site” indicates the most complementary 3'-nucleoside in the target nucleic acid sequence to the modified oligonucleotide.

[0477] Table 11 Modified oligonucleotides with mixed PS / PO nucleotide linkages

[0478]

[0479] Example 2: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (35 μg)

[0480] The activity of the selected modified oligonucleotides described above was tested in human SMN2 transgenic mice. The Taiwanese strain of SMAIII mice was obtained from the Jackson Laboratory (Bar Harbor, Maine), USA. These mice lacked mouse SMN and were either homoconjugated with human SMN2 (mSMN- / -; hSMN2+ / +; FVB.Cg-Tg(SMN2)2HungSMN1tm1Hung / J, stock number 005058; Bar Harbor, Maine) or heteroconjugated with mouse SMN and obtained by breeding HOM / HOM (stock number 00005058) with FVB / NJ (stock number 001800) to obtain human SMN2 (mSMN+ / -; hSMN2+ / -; FVB.Cg-Tg(SMN2)2HungSMN1tm1Hung / J).

[0481] deal with

[0482] Transgenic mice were divided into groups of four, either homozygous or heterozygous. Each mouse received a single ICV bolus of 35 μg of the modified oligonucleotide. Comparative compounds 387954, 396442, and 396443 were also tested in this assay. One group of four mice received PBS as a negative control.

[0483] RNA analysis

[0484] Two weeks after treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. Using the primer and probe set hSMN2vd#4_LTS00216_MGB (forward sequence: GCTGATGTTTGGGAAGTATG TTA (SEQ ID NO:11); reverse sequence: CACCTTCCTTCTTTTTGATTT TGTC, named SEQ ID NO:12 in this paper; probe sequence: TACATGAGTG GCTATCATACT (SEQ ID NO:13)), exon 7 was identified. + The amount of SMN2 RNA was determined using the primer and probe set hSMN2_Sumner68_PPS50481 (forward sequence: CATGGTACATGAGTGGCTATCATACTG (SEQ ID NO:14); reverse sequence: TGGTGTCATTTAGTGCTGCTCTATG (SEQ ID NO:15); probe sequence CCAGCATTTCCATATAATAGC (SEQ ID NO:16)). This was used to determine the amount of RNA not including exon 7. - The amount of SMN2 RNA was measured using the primer and probe set hSMN2_LTS00935 (forward sequence: CAGGAGGATTCCGTGCTGT T (SEQ ID NO:17); reverse sequence: CAGTGCTGTATCATCCCAAATGTC (SEQ ID NO:18); probe sequence: ACAGGCCAGAGCGAT (SEQ ID NO:19)).

[0485] The results are presented as fold changes in RNA levels normalized to total SMN2 levels relative to the PBS control. Each figure in Tables 12-18 represents a different experiment.

[0486] Table 12

[0487] Effects of modified oligonucleotides on human SMN2 RNA splicing in homozygous transgenic mice

[0488]

[0489]

[0490] Table 13

[0491] Effects of modified oligonucleotides on human SMN2 RNA splicing in homozygous transgenic mice

[0492]

[0493]

[0494] Table 14

[0495] Effects of modified oligonucleotides on human SMN2 RNA splicing in homozygous transgenic mice

[0496]

[0497] Table 15

[0498] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0499]

[0500] Table 16

[0501] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0502]

[0503]

[0504] Table 17

[0505] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0506]

[0507] Table 18

[0508] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0509]

[0510] Example 3: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (15 μg)

[0511] Essentially as described above in Example 2, the activity of the selected modified oligonucleotides described above in human SMN2 transgenic mice was tested. Comparative compounds 396443 and 819735 were also tested in this assay. Transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of 15 μg of the modified oligonucleotide. One group of four mice received PBS as a negative control. Two weeks after treatment, the mice were sacrificed, and RNA was extracted from the cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are presented as fold changes in RNA levels normalized to total SMN2 levels relative to the PBS control. Each of the results in Tables 19-23 represents a different experiment.

[0512] Table 19

[0513] Effects of modified oligonucleotides on human SMN2 RNA splicing in homozygous transgenic mice

[0514]

[0515] Table 20

[0516] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0517]

[0518] Table 21

[0519] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0520]

[0521] Table 22

[0522] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0523]

[0524] Table 23

[0525] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0526]

[0527] Example 4: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (70 μg)

[0528] Essentially as described above in Example 2, the activity of the modified oligonucleotide in human SMN2 transgenic mice was tested. Transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of 70 μg of the modified oligonucleotide. Four mice in one group received PBS as a negative control. Two weeks after treatment, the mice were sacrificed, and RNA was extracted from the cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are presented as the fold change in RNA levels normalized to total SMN2 levels relative to the PBS control.

[0529] Table 24

[0530] Effects of modified oligonucleotides on human SMN2 RNA splicing in homozygous transgenic mice

[0531]

[0532] Example 5: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, multiple doses

[0533] Essentially as described above in Example 2, the activity of the selected modified oligonucleotides described above in human SMN2 transgenic mice was tested. Comparative compound number 396443 was also tested in this assay. Transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of the modified oligonucleotide at multiple doses as indicated in the table below. One group of four mice received PBS as a negative control. Two weeks after treatment, the mice were sacrificed, and RNA was extracted from the coronal brain and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are presented as fold changes in RNA levels normalized to total SMN2 levels relative to the PBS control. Exon inclusion (exon 7) was calculated using a nonlinear regression 4-parameter dose-response curve [Y = bottom + (top - bottom) / (1 + (10^logEC50 / X)^Hill slope)]. + ) of ED 50 .

[0534] Table 25

[0535] Effects of modified oligonucleotides on human SMN2 RNA splicing in homozygous transgenic mice

[0536]

[0537] Example 6: Tolerance of modified oligonucleotides complementary to SMN2 in wild-type mice, 3-hour study

[0538] Tolerability of the modified oligonucleotides described above was assessed in wild-type female C57 / Bl6 mice. Each wild-type female C57 / Bl6 mouse received a single ICV dose of 700 μg of the modified oligonucleotide listed in the table below. Comparative compound 396443 was also tested at a dose of 350 μg in this assay. Comparative compounds 387954, 396442, 443305, and 819735 were also tested at a dose of 700 μg in this assay. Each treatment group consisted of four mice. A group of four mice received PBS as a negative control for each experiment (identified in separate tables below). Mice were evaluated according to seven different criteria three hours post-injection. The criteria were (1) the mouse was intelligent, alert, and responsive; (2) the mouse stood or arched its back in the absence of stimulation; (3) the mouse showed no movement in the absence of stimulation; (4) the mouse showed forward movement after being lifted; (5) the mouse showed no movement after being lifted; (6) the mouse responded to tail pinching; and (7) it breathed evenly. For each of the seven criteria, the mouse was given a sub-score of 0 if it met the criterion and a sub-score of 1 (functional observation test combination score or FOB) if it did not meet the criterion. After evaluating all seven criteria, the scores were summed and averaged within each treatment group. The results are presented in the table below. Each criterion in Tables 26-49 represents a different experiment.

[0539] Table 26 Tolerance scores in mice at a dose of 350 μg

[0540]

[0541] Table 27 Tolerance scores in mice at a dose of 700 μg

[0542]

[0543] Table 28 Tolerance scores in mice at a dose of 700 μg

[0544]

[0545]

[0546] Table 29 Tolerance scores in mice at a dose of 700 μg

[0547]

[0548]

[0549] Table 30 Tolerance scores in mice at a dose of 700 μg

[0550]

[0551] Table 31 Tolerance scores in mice at a dose of 700 μg

[0552]

[0553]

[0554] Table 32 Tolerance scores in mice at a dose of 700 μg

[0555]

[0556] Table 33 Tolerance scores in mice at a dose of 700 μg

[0557]

[0558]

[0559] Table 34 Tolerance scores in mice at a dose of 700 μg

[0560]

[0561] Table 35 Tolerance scores in mice at a dose of 700 μg

[0562]

[0563]

[0564] Table 36 Tolerance scores in mice at a dose of 700 μg

[0565]

[0566]

[0567] Table 37 Tolerance scores in mice at a dose of 700 μg

[0568] Compound number 3-hour FOB PBS 0.00 1263826 0.00

[0569] Table 38 Tolerance scores in mice at a dose of 700 μg

[0570] Compound number 3-hour FOB PBS 0.00 387954 4.00 1287048 0.00 1287049 0.00 1287050 2.00 1287051 3.25 1287052 3.50 1287053 2.75 1287054 2.00 1287055 3.25 1287056 4.00 1287057 3.00 1287058 4.00 1287059 4.00 1287060 4.00 1287061 4.00 1287062 3.50

[0571] Table 39 Tolerance scores in mice at a dose of 700 μg

[0572] Compound number 3-hour FOB PBS 0.00 1287106 3.50 1287107 4.00 1287108 3.75 1287109 3.25 1287110 3.00 1287111 4.75 1287112 4.00 1287113 3.50 1287114 3.25 1287115 3.50 1287116 4.00 1287117 4.25 1287118 3.00 1287119 3.50 1287120 3.75 1287121 2.75

[0573] Table 40 Tolerance scores in mice at a dose of 700 μg

[0574] Compound number 3-hour FOB PBS 0.00 1287063 0.00 1287064 0.00 1287065 1.00 1287066 3.75 1287067 1.00 1287068 2.50 1287069 2.25 1287071 1.00 1287072 3.00 1287073 3.75 1287074 1.75 1287075 3.50 1287076 2.00

[0575] Table 41 Tolerance scores in mice at a dose of 700 μg

[0576] Compound number 3-hour FOB PBS 0.00 1287070 2.00 1287701 2.50 1287702 3.75 1287703 3.75 1287705 4.00 1287706 4.00 1287707 4.00 1287709 4.75 1287710 4.00 1287711 4.75 1287712 4.00 1287713 4.00 1287714 3.50 1287715 4.00 1287716 4.00 1287717 3.25

[0577] Table 42 Tolerance scores in mice at a dose of 700 μg

[0578]

[0579]

[0580] Table 43 Tolerance scores in mice at a dose of 700 μg

[0581] Compound number 3-hour FOB PBS 0.00 1287122 0.00 1287123 0.00 1287124 3.50 1287125 3.00 1287126 3.00 1287127 0.00 1287128 0.00 1287129 4.00 1287130 2.75 1287131 2.50 1287132 2.75 1287133 3.25 1287704 3.50 1287708 3.50

[0582] Table 44 Tolerance scores in mice at a dose of 700 μg

[0583]

[0584]

[0585] Table 45 Tolerance scores in mice at a dose of 700 μg

[0586] Compound number 3-hour FOB PBS 0.00 1318757 4.00 1318758 4.25 1318759 3.75 1318760 3.75 1318761 4.00 1318762 4.00 1318763 4.00 1318764 3.75 1318766 3.75 1318768 4.00 1318769 4.00

[0587] Table 46 Tolerance scores in mice at a dose of 700 μg

[0588]

[0589]

[0590] Table 47 Tolerance scores in mice at a dose of 700 μg

[0591] Compound number 3-hour FOB PBS 0.00 1332247 1.75 1332248 0.25 1332249 0.00 1332250 3.75 1332251 0.00 1332252 3.00 1332263 2.00 1332265 1.50 1332266 1.00 1332267 3.75 1332268 2.75 1332269 1.25 1332270 2.25 1332271 2.50 1333508 0.00

[0592] Table 48 Tolerance scores in mice at a dose of 700 μg

[0593]

[0594] Table 49 Tolerance scores in mice at a dose of 700 μg

[0595] Compound number 3-hour FOB PBS 0.00 1358996 0.00 1364777 2.00 1364778 3.00 1364779 3.50 1364780 3.50 1364781 5.25 1364782 2.50 1364783 3.50 1364784 3.50

[0596] Example 7: Tolerance of modified oligonucleotides complementary to human SMN2 in rats, long-term evaluation

[0597] In a separate study conducted under identical conditions, the selected modified oligonucleotides described above were tested in Sprague Dawley rats to assess long-term tolerability. Comparative compounds 396442 and 819735 were also tested in this assay. Sprague Dawley rats received either a single intrathecal (IT) delivery dose of 3 mg of the oligonucleotide or PBS. Starting one week after treatment, each animal was weighed and adverse events were evaluated weekly by a trained observer. Adverse events were defined as atypical neurological dysfunctions in PBS-treated control animals, including but not limited to: abnormal limb opening, gait abnormalities, tremors, respiratory abnormalities, paralysis, and spasticity. An adverse event was defined as one week after the first recorded functional impairment following administration. No event was considered negative if no adverse event was achieved. The onset of adverse events was generally associated with growth impairments as defined by a lack of weight gain / maintenance, similar to that in PBS-treated animals. Similar tolerability assessments are described in Oestergaard et al., Nucleic Acids Res., Nov 2013, 41(21), 9634-9650 and Southwell et al., Mol Ther., Dec 2014, 22(12), 2093-2106.

[0598] At the end of the study, rats were euthanized and tissues were collected. Histopathological examination was performed on cerebellar sections using calbindin staining. As indicated in the table below, Purkinje cell loss was observed in calbindin-stained cerebellar sections. The cerebellum and spinal cord were also evaluated using antibodies specific to modified oligonucleotides. Animals showing no oligonucleotide uptake were excluded from histopathological analysis. Histology was not completed for animals euthanized prematurely due to adverse events. In addition, cortical GFAP, a marker of astrogliosis (Abdelhak et al., Scientific Reports, 2018, 8, 14798), was measured using RT-PCR, and a mean increase of >2-fold is described below.

[0599] Table 50 Long-term tolerability in rats at 3 mg dose

[0600]

[0601] Example 8: Tolerance and pharmacokinetics of modified oligonucleotides in non-human primates, single or repeated administration

[0602] Cynomolgus monkeys were treated with modified oligonucleotides to determine local and systemic tolerability and pharmacokinetics of the modified oligonucleotides. Each group received the modified oligonucleotides either via artificial CSF or as a single intrathecal bolus injection (IT), or, for the repeated-dose group, as an IT bolus injection on day 1 of the study, followed by IT bolus injections at subsequent time points. Tissues were collected one week after the last injection.

[0603] In single-dose studies, monkeys were administered a single dose of the modified oligonucleotide and tolerability was assessed. Representative doses for single-dose studies in adult cynomolgus monkeys included 1 mg, 3 mg, 7 mg, and 35 mg.

[0604] In repeated-dose studies, monkeys were given an IT bolus dose on day 1 of the study, followed by weekly (e.g., days 8, 15, and 22 of a four-week study) or monthly (e.g., days 29, 57, and 84 of a 13-week study). Representative doses for repeated-dose studies in adult cynomolgus monkeys included 1 mg, 3 mg, 7 mg, and 35 mg.

[0605] Tolerance assessment is based on clinical observation, body weight, food consumption, physical and neurological examination (including sensorimotor reflexes, brain reflexes, and spinal reflexes), coagulation, hematology, clinical chemistry (blood and cerebrospinal fluid (CSF)), cell count, and anatomical pathology. A complete necropsy is performed, and any macroscopic abnormalities are recorded. Organs are weighed and examined microscopically. Blood is collected for supplementary analysis. Additionally, blood, CSF, and tissue (at the time of necropsy) are collected for toxicological evaluation.

[0606] Tolerance to modified oligonucleotides in brain and spinal cord tissues was analyzed by measuring Aif1 and Gfap levels in cynomolgus monkeys treated with modified oligonucleotides or as controls. Brain and spinal cord samples were collected and flash-frozen in liquid nitrogen (-60°C to -90°C) for storage. Samples were collected from frozen tissues at sampling time using a 2 mm biopsy punch for RNA analysis. Punching was performed in multiple brain and spinal cord regions.

[0607] Example 9: Phase Ia human clinical trials using compound numbers 1263789, 1287717, 1287745, or 1358996

[0608] The safety, tolerability, pharmacokinetics, pharmacodynamics, and efficacy of modified oligonucleotides complementary to human SMN2 were evaluated in a clinical trial setting. Single and / or multiple doses of the modified oligonucleotides were evaluated in patients with confirmed SMA (e.g., type I, type II, type III, or type IV SMA).

[0609] Patient safety was closely monitored during the study. Safety and tolerability assessments included: physical examination and standard neurological evaluation (including basal body), vital signs (HR, BP, positional changes, weight), ECG, adverse events (AEs) and concomitant medications, Columbia Suicide Severity Rating Scale (C-SSRS), CSF safety laboratory tests (cell count, protein, glucose), plasma laboratory tests (clinical chemistry, hematology), and urinalysis.

[0610] Choose age-appropriate and type-specific efficacy assessments, including, for example: the Hammersmith Motor Function Scale-Expanded (HFMSE), a reliable and validated tool for assessing motor function in children with SMA; and the Children's Quality of Life Questionnaire (PedsQL). TM Measurements included the 4.0 General Applicable Core Scale; the Children's Quality of Life Questionnaire 3.0 Neuromuscular Module; Compound Muscle Action Potential (CMAP); Motor Unit Number Estimation (MUNE); Upper Limb Module (ULM); and the 6-Minute Walk Test (6MWT) (Darras et al., Neurology, 2019, 92:e2492-e2506).

[0611] Example 10: Design of modified oligonucleotides complementary to human SMN2 nucleic acid

[0612] As indicated in the table below, designed and synthesized modified oligonucleotides complementary to human SMN2 nucleic acid.

[0613] Each modified oligonucleotide listed in the following tables is 100% complementary to SEQ ID NO:1 (GENBANK accession number NT_006713.14, truncated from nucleosides 19939708 to 19967777). “Start site” indicates the most complementary 5'-nucleoside in the target nucleic acid sequence to the modified oligonucleotide. “Termination site” indicates the most complementary 3'-nucleoside in the target nucleic acid sequence to the modified oligonucleotide.

[0614] The modified oligonucleotides in the table below are 18 nucleotides in length. Each nucleotide contains either a 2'-MOE sugar motif or a 2'-NMA sugar motif. The glycosyl motif for each modified oligonucleotide is provided in the glycosyl motif column, where each 'e' represents the 2'-MOE sugar motif and each 'n' represents the 2'-NMA sugar motif. Each nucleotide link is a phosphate thioester nucleotide link, a phosphodiester nucleotide link, a methoxypropylphosphonate nucleotide link, or a methanesulfonyl phosphate (MsP) nucleotide link. The nucleotide link motif for each modified oligonucleotide is provided in the nucleotide link motif column, where each 's' represents a phosphate thioester nucleotide link, each 'o' represents a phosphodiester nucleotide link, each 'x' represents a methoxypropylphosphonate nucleotide link, and each 'z' represents a methanesulfonyl phosphate (MsP) nucleotide link. Each cytosine is 5-methylcytosine. The modified oligonucleotide 449320 has been previously described in WO2015 / 161170A2.

[0615] Table 51

[0616] MOEs with mixed PO / PS, PO / MsP, homogeneous MsP, or PS / MOP nucleotide linkages

[0617] and NMA-modified oligonucleotides

[0618]

[0619] The modified oligonucleotides listed in the table below all consist of the following sequence (5' to 3'): TCACTTTCATAATGCTGG (SEQ ID NO:23). Each modified oligonucleotide listed in the following tables is 100% complementary to SEQ ID NO:1 (described above). "Start site" indicates the most complementary 5'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide. "Termination site" indicates the most complementary 3'-nucleotide in the target nucleic acid sequence to the modified oligonucleotide.

[0620] The modified oligonucleotides in the table below are 18 nucleotides in length. Each nucleotide contains either a 2'-MOE sugar moiety or a 2'-NMA sugar moiety. The glycosyl motif for each modified oligonucleotide is provided in the glycosyl motif column, where each 'e' represents the 2'-MOE sugar moiety and each 'n' represents the 2'-NMA sugar moiety. Each nucleotide link is a phosphate thioester nucleotide link, a phosphodiester nucleotide link, or a methanesulfonyl phosphate (MsP) nucleotide link. The nucleotide link motif for each modified oligonucleotide is provided in the nucleotide link motif column, where each 's' represents a phosphate thioester nucleotide link, each 'o' represents a phosphodiester nucleotide link, and each 'z' represents a methanesulfonyl phosphate (MsP) nucleotide link. Each cytosine is 5-methylcytosine. The modified oligonucleotides in the table below are conjugated with a 6-palmitamide hexyl phosphate conjugate group linked to the 5'-OH of the oligonucleotide. The structure of the conjugate group is as follows:

[0621]

[0622] Table 52

[0623] 6-Palmamide hexyl phosphate conjugated oligonucleotides with MOE and NMA modifications and mixed PO / PS, PO / MsP, or homogeneous MsP nucleotide linkages.

[0624]

[0625] The modified oligonucleotides in the table below all consist of the following sequence (5' to 3'): TCACTTTCATAATGCTGG (SEQ ID NO:23), with a start site of 27062 on SEQ ID No:1 (described above) and a stop site of 27079, wherein the “start site” indicates the most 5'-nucleotide complementary to the modified oligonucleotide in the target nucleic acid sequence, and the “stop site” indicates the most 3'-nucleotide complementary to the modified oligonucleotide in the target nucleic acid sequence.

[0626] The modified oligonucleotides in the table below are 18 nucleotides in length. The sugar and nucleotide inter-linking motifs for each modified oligonucleotide are provided in the sequence and chemonotation columns, where each subscript 'n' represents the 2'-NMA sugar moiety, each subscript '[DMA]' represents the 2'-O-(N,N-dimethyl)acetamide moiety, each subscript '[NEA]' represents the 2'-O-(N-ethyl)acetamide moiety, each subscript '[NPA]' represents the 2'-O-(N-propyl)acetamide moiety, each subscript '[NcPA]' represents the 2'-O-(N-cyclopropyl)acetamide moiety, each subscript '[McPA]' represents the 2'-O-(N-cyclopropylmethyl)acetamide moiety, and each subscript 's' represents the phosphate thioate nucleotide inter-linking. Each cytosine is 5-methylcytosine, wherein at the cytosine residue ( m C) The subscript 'm' before it indicates 5-methylcytosine. The structure of each sugar shown in the table below is:

[0627]

[0628] Table 53. Oligonucleotides modified with NMA and NMA analogues and possessing uniform PS nucleotide-to-nucleotide linkages.

[0629]

[0630] Example 11: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (35 μg)

[0631] Essentially as described above in Example 2, the activity of the selected modified oligonucleotides described above in human SMN2 transgenic mice was tested.

[0632] deal with

[0633] Transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of the modified oligonucleotide at the doses indicated in the table below. Four mice in each group received PBS as a negative control. Two weeks after treatment, the mice were sacrificed, and RNA was extracted from the coronal brain and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are presented as fold changes in RNA levels normalized to total SMN2 levels relative to the PBS control. Exon inclusion (exon 7) was calculated using a nonlinear regression 4-parameter dose-response curve [Y = bottom + (top - bottom) / (1 + (10^logEC50 / X)^Hill slope)]. + ) of ED 50 .

[0634] RNA analysis

[0635] Two weeks after treatment, the mice were sacrificed, and RNA was extracted from the cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. The primer and probe set hSMN2vd#4_LTS00216_MGB was used to identify exon 7 (exon 7...). + The amount of SMN2 RNA was determined using the primer and probe set hSMN2_Sumner68_PPS50481, excluding exon 7 (exon 7). - The amount of SMN2 RNA was measured using the primer and probe set hSMN2_LTS00935. Results are presented as fold change in RNA level relative to the PBS control, normalized to total SMN2 level.

[0636] Table 54

[0637] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0638]

[0639] Table 55

[0640] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0641]

[0642] Indicates fewer than four samples are available

[0643] Example 12: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, single dose (15 μg)

[0644] Essentially as described above in Example 2, the activity of the selected modified oligonucleotides described above in human SMN2 transgenic mice was tested.

[0645] deal with

[0646] Transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of the modified oligonucleotide at the doses indicated in the table below. Four mice in each group received PBS as a negative control. Two weeks after treatment, the mice were sacrificed, and RNA was extracted from the coronal brain and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are presented as fold changes in RNA levels normalized to total SMN2 levels relative to the PBS control. Exon inclusion (exon 7) was calculated using a nonlinear regression 4-parameter dose-response curve [Y = bottom + (top - bottom) / (1 + (10^logEC50 / X)^Hill slope)]. + ) of ED 50 .

[0647] RNA analysis

[0648] Two weeks after treatment, the mice were sacrificed, and RNA was extracted from the cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. The primer and probe set hSMN2vd#4_LTS00216_MGB was used to identify exon 7 (exon 7...). + The amount of SMN2 RNA was determined using the primer and probe set hSMN2_Sumner68_PPS50481, excluding exon 7 (exon 7). - The amount of SMN2 RNA was measured using the primer and probe set hSMN2_LTS00935. Results are presented as fold change in RNA level relative to the PBS control, normalized to total SMN2 level.

[0649] Table 56

[0650] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0651]

[0652]

[0653] Example 13: Activity of modified oligonucleotides complementary to human SMN2 in transgenic mice, multiple doses

[0654] Essentially as described above in Example 2, the activity of the selected modified oligonucleotides described above in human SMN2 transgenic mice was tested.

[0655] deal with

[0656] Transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of the modified oligonucleotide at multiple doses as indicated in the table below. Four mice in each group received PBS as a negative control. Two weeks after treatment, the mice were sacrificed, and RNA was extracted from the coronal brain and spinal cord for real-time qPCR analysis of SMN2 RNA. Results are presented as fold changes in RNA levels normalized to total SMN2 levels relative to the PBS control. Exon inclusion (exon 7) was calculated using a nonlinear regression 4-parameter dose-response curve [Y = bottom + (top - bottom) / (1 + (10^logEC50 / X)^Hill slope)]. + ) of ED 50 .

[0657] RNA analysis

[0658] Two weeks after treatment, the mice were sacrificed, and RNA was extracted from the cortical brain tissue and spinal cord for real-time qPCR analysis of SMN2 RNA. The primer and probe set hSMN2vd#4_LTS00216_MGB was used to identify exon 7 (exon 7...). + The amount of SMN2 RNA was determined using the primer and probe set hSMN2_Sumner68_PPS50481, excluding exon 7 (exon 7). - The amount of SMN2 RNA was measured using the primer and probe set hSMN2_LTS00935. Results are presented as fold change in RNA level relative to the PBS control, normalized to total SMN2 level.

[0659] Table 57

[0660] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0661]

[0662] Table 58

[0663] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0664]

[0665]

[0666] Indicates fewer than four samples are available

[0667] Table 59

[0668] Effects of modified oligonucleotides on human SMN2 RNA splicing in heterozygous transgenic mice

[0669]

[0670] Example 15: Tolerance of modified oligonucleotides complementary to SMN2 in wild-type mice

[0671] Tolerance to the modified oligonucleotides described above was assessed in wild-type female C57 / Bl6 mice. Each wild-type female C57 / Bl6 mouse received a single ICV dose of 700 μg of the modified oligonucleotide listed in the table below. Each treatment group consisted of 4 mice. A group of 4 mice received PBS as a negative control for each experiment (identified in separate tables below). Three hours after injection, the mice were evaluated according to seven different criteria. The criteria were (1) the mouse was intelligent, alert, and responsive; (2) the mouse stood or arched its back without stimulation; (3) the mouse showed any movement without stimulation; (4) the mouse showed forward movement after being lifted; (5) the mouse showed any movement after being lifted; (6) the mouse responded to tail pinching; and (7) the mouse breathed evenly. For each of the seven criteria, the mouse was given a sub-score of 0 if it met the criterion and a sub-score of 1 (functional observation test combination score or FOB) if it did not meet the criterion. After evaluating all seven criteria, the scores for each mouse were summed and averaged within each treatment group. The results are presented in the table below.

[0672] Table 60 Tolerance scores in mice at a dose of 700 μg

[0673] Compound number 3-hour FOB PBS 0.00 1287723 2.00 1287724 1.00 1287727 2.00

Claims

1. An oligomeric compound comprising a modified oligonucleotide consisting of 16, 17, 18, 19 or 20 linked nucleosides and a nucleobase sequence comprising at least 15 or at least 16 consecutive nucleobases of any one of the nucleobase sequences SEQ ID NOs: 20-50, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

Images