Circular RNA molecule, protein coded by circular RNA molecule and application of circular RNA molecule

Abstract

The invention discloses a circular RNA molecule circZBTB46-2, a protein coded by the circular RNA molecule circZBTB46-2 and application of the circular RNA molecule circZBTB46-2, and relates to the technical field of biology. The circZBTB46-2 is derived from a second exon of a ZBTB46 gene on a human chromosome q13.33, and the nucleotide sequence of the circZBTB46-2 is as shown in SEQ ID NO. 1. The circZBTB46-2 can encode a protein containing 462 amino acids, the protein is named as circZBTB46-462aa, and the amino acid sequence of the circZBTB46-462aa is as shown in SEQ ID NO. 4. The circZBTB46-2 is used for promoting the expression of the HASC senescence marker gene. The protein circZBTB46-462aa can be used for promoting cell aging. According to the present invention, it is found for the first time that the circular RNA molecule circZBTB46-2 can promote cell aging by coding circZBTB46-462aa, and can inhibit VSMC aging and relieve the progress of atherosclerosis by down-regulating the expression of the protein circZBTB46-462aa, such that the new direction is provided for the treatment of cardiovascular diseases.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a circular RNA molecule, a protein encoded by the molecule, and applications thereof. Background Art

[0002] Vascular smooth muscle cells (VSMCs) are the primary components of the vascular media. They regulate vascular tone through contraction and relaxation and participate in vascular wall remodeling and repair. A key characteristic of VSMCs is their phenotypic plasticity, allowing them to dynamically transition between a differentiated (contractile) and dedifferentiated (synthetic) state. This process is regulated by multiple pathophysiological factors, such as inflammation, oxidative stress, and mechanical stress. However, with aging, VSMC function gradually becomes dysfunctional, manifested by abnormal proliferation and migration, decreased contractile function, and increased extracellular matrix (ECM) deposition, ultimately leading to increased vascular stiffness and the development of cardiovascular diseases such as atherosclerosis.

[0003] The mechanisms of VSMC aging are complex, involving the interplay of endogenous factors (such as telomere shortening, DNA damage accumulation, and epigenetic alterations) and exogenous stimuli (such as oxidative stress, inflammatory factors, and hyperglycemia). Studies have shown that reactive oxygen species (ROS) levels are significantly elevated in aging VSMCs, inducing cell cycle arrest by activating the p53 / p21 and p16INK4a / Rb pathways. Furthermore, the release of the senescence-associated secretory phenotype (SASP) further exacerbates the inflammatory response in the vascular microenvironment, promoting vascular calcification and fibrosis. These pathological changes are closely associated with diseases such as hypertension, coronary heart disease, and aortic aneurysm, highlighting the clinical significance of elucidating the regulatory mechanisms of VSMC aging.

[0004] In recent years, circular RNA (circRNA), a novel class of noncoding RNA, has attracted considerable attention for its role in gene expression regulation due to its unique closed loop structure and high stability. CircRNAs can participate in processes such as cell proliferation, apoptosis, and aging by acting as microRNA (miRNA) sponges, binding to RNA-binding proteins (RBPs), or directly translating functional peptides. In the cardiovascular system, circRNAs have been shown to regulate endothelial cell function, cardiac hypertrophy, and phenotypic transitions in vascular endothelial cells (VSMCs). Recent studies have found that circRNAs can inhibit abnormal VSMC proliferation and migration through their encoded proteins and mitigate the progression of atherosclerosis.

[0005] Therefore, developing a new circular RNA molecule and the protein encoded by it to regulate VSMC aging and alleviate the progression of atherosclerosis is an urgent problem to be solved by the present invention. Summary of the Invention

[0006] The present invention provides a circular RNA molecule, a protein encoded by the molecule, and applications thereof, aiming to solve the problems existing in the above-mentioned background technology.

[0007] In order to achieve the above technical objectives, the present invention mainly adopts the following technical solutions:

[0008] In a first aspect, the present invention discloses a circular RNA molecule circZBTB46-2, which is derived from the second exon of the ZBTB46 gene on human chromosome 20q13.33, and its nucleotide sequence is shown in SEQ ID NO.1.

[0009] In a second aspect, the present invention discloses a method for amplifying the circular RNA molecule circZBTB46-2 as described in the first aspect, wherein the circZBTB46-2 is amplified in cDNA by divergent primers, and the sequence of the upstream primer circZBTB46-2-HF of the divergent primers is: AGCCGAGACTCAAAGTCTGT, as shown in SEQ ID NO.2; the sequence of the downstream primer circZBTB46-2-HR is: CCGGTAGTGGGACGTGATTT, as shown in SEQ ID NO.3.

[0010] In a third aspect, the present invention discloses a protein encoded by the circular RNA molecule circZBTB46-2 described in the first aspect. The protein is named circZBTB46-462aa, and its amino acid sequence is shown in SEQ ID NO.4.

[0011] In a fourth aspect, the present invention discloses the use of a preparation for detecting the expression level of circZBTB46-462aa in the preparation of a cell aging diagnostic reagent.

[0012] In a preferred embodiment of the present invention, the detection preparation is carried out by detecting the HASMC cells of the subject.

[0013] The expression of circZBTB46-462aa was significantly upregulated compared with the healthy control group, which was used to determine whether the subjects were aging.

[0014] Furthermore, the expression of circZBTB46-462aa in the HASMC cells increased, which could upregulate the aging-related genes p53,

[0015] Expression of p21, IL-18, and IL-1β.

[0016] In a fifth aspect, the present invention discloses a reagent for detecting cell senescence, wherein the reagent can detect the protein

[0017] The expression level of circZBTB46-462aa.

[0018] In a sixth aspect, the present invention discloses a kit for detecting cell senescence, comprising at least the reagent as described in the fifth aspect.

[0019] In a seventh aspect, the present invention discloses a use of the protein as described in the third aspect as a biomarker or target in the preparation of diagnostic and / or therapeutic anti-aging drugs.

[0020] In an eighth aspect, the present invention discloses an anti-aging drug, comprising at least a reagent capable of detecting the protein and its expression level as described in the third aspect, and a pharmaceutically suitable carrier.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] This study discovered for the first time that the RNA molecule circZBTB46-2 can promote cell senescence by encoding circZBTB46-462aa, and can inhibit VSMC senescence and alleviate the progression of atherosclerosis by downregulating the expression of protein circZBTB46-462aa, providing a new direction for the treatment of cardiovascular diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the characteristics and localization distribution map of circZBTB46-2;

[0024] Figure 2 The protein map encoded by circZBTB46-2;

[0025] Figure 3 This is a graph showing that circZBTB46-2 promotes the expression of HASMC senescence marker genes;

[0026] Figure 4 This is the experimental result showing that circZBTB46-2 promotes cell senescence through the encoded protein circZBTB46-462aa. DETAILED DESCRIPTION

[0027] In order to enable those skilled in the art to better understand the present invention, the following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of this application.

[0028] Example 1

[0029] 1.1 Cell culture

[0030] After receiving the cells (human vascular smooth muscle cells, purchased from Starfish Biotechnology Co., Ltd.), check whether the culture flask is intact, observe the cell status under a microscope, disinfect the surface of the culture flask with 75% alcohol, place it flat in the incubator and let it stand for 1-2 hours, and wait for the cells to recover to the basic growth state before proceeding with subsequent operations. Observe the number of cells under a microscope. If the density is lower than 80%, replace it with 4mL of preheated complete medium and continue culturing. When the cell density reaches more than 90%, cell passage can be performed, preheat complete medium, trypsin and PBS, wash the cells twice with PBS, discard PBS and add trypsin, observe the cell morphology under a microscope, when about 80% of the cells shrink and become round, discard trypsin and add complete medium to terminate digestion, aspirate the medium and blow the bottom of the culture flask to blow all cells as much as possible, fully disperse and mix the cell suspension, aliquot into new cell T25 culture flasks, make the volume to 4mL respectively, shake the cells and place them in the cell culture incubator to continue culturing.

[0031] 1.2 Cell treatment

[0032] 1.2.1 Transfected cells

[0033] 1) When the cells reach the passage density, they are seeded into T25 culture flasks or six-well plates. Transfection is performed when the cell density reaches about 70%.

[0034] 2) Calculate the required volumes of plasmid or si-RNA and transfection reagent based on experimental conditions and dissolve each in basal culture medium (Human Aortic Smooth Muscle Cell Culture Medium - Basal, Cat No: PCM-H-039, Zhongqiao Xinzhou Biotechnology Co., Ltd.), designated as Solution A and Solution B. Mix thoroughly by pipetting and let stand for 5 minutes. Mix Solution A and Solution B again by pipetting and let stand for 15 minutes.

[0035] 3) During the static period, wash the cells to be transfected twice with PBS and add basal culture medium (mixture of A and B is 1 / 4 of the total volume) in advance.

[0036] 4) After standing, add the mixture to the corresponding culture flask or plate, shake well, and place in the incubator for transfection.

[0037] 5) 5 hours after transfection, if no other treatment is performed, discard the basal medium and replace it with complete medium. Collect RNA for 24 hours and protein for 48 hours. If cell stimulation is continued, replace the medium with basal medium and add stimulation at the same time. Collect RNA for 24 hours and protein for 48 hours.

[0038] 1.2.2D-Gal-induced cell senescence model

[0039] When the cell density reached about 70%, the culture medium was changed to basal medium (Zhongqiao Xinzhou Biotechnology Co., Ltd., human aortic smooth muscle cell culture medium-basic, Cat No: PCM-H-039) and cultured for 24 hours. The control group did not receive any treatment, and the experimental group was stimulated with D-Gal (MCE Company) (30 mg / mL). After 48 hours, the cells were collected for subsequent experiments.

[0040] 1.3 Extraction of genomic DNA from cells

[0041] 1) Prepare cell resuspension. Frozen cell samples must be thawed before starting. First, centrifuge the cell suspension to obtain a precipitate. After discarding the supernatant, add an appropriate amount of PBS buffer and gently mix. Centrifuge again to complete the washing step. Finally, resuspend the cell pellet with 200μL PBS buffer (stored at 4°C) that has been pre-treated at low temperature. If the cells grow adherently, digest them with trypsin and centrifuge to obtain a precipitate. After discarding the supernatant, add an appropriate amount of PBS buffer and gently mix. Centrifuge again to complete the washing step. Finally, resuspend the cell pellet with 200μL PBS buffer (stored at 4°C) that has been pre-treated at low temperature;

[0042] 2) Add 25 μL of OB Protease Solution and vortex to mix;

[0043] 3) If the RNA concentration of the cultured cells is too high, there will be residual RNA in the extracted solution. Generally, the excess RNA will not affect the PCR operation, but it can be removed by adding 4 μL of RNase A to the solution, mixing thoroughly, and leaving it at room temperature for 2-5 minutes.

[0044] 4) Add 220 μL of Buffer BL to the reaction mixture and immediately vortex for 30 seconds to mix thoroughly. Then transfer the mixture to a 70°C water bath and incubate for 10 minutes. (Note: This step may cause the formation of a white flocculent precipitate in the solution, which is normal and will not adversely affect the subsequent DNA purification process.)

[0045] 5) Add an equal volume (220 μL) of pre-cooled anhydrous ethanol and immediately mix vigorously using a vortex shaker for 20-30 minutes.

[0046] s, to ensure the formation of a homogeneous solution system. If there is precipitation, use the gun tip to blow away the precipitation;

[0047] 6) Accurately fit the DNA adsorption column into a 2 mL cannula. Transfer the resulting solution into the DNA binding column and immediately centrifuge at 8,000 × g for 60 seconds (pay attention to the centrifuge balance). Discard the filtrate and original cannula containing impurities.

[0048] 7) Reassemble the binding column into a new sterile 2 mL cannula and slowly add 500 μL of HBC Buffer along the column wall (it is recommended that the buffer be brought to room temperature in advance). Centrifuge at 8,000 × g for 60 seconds and discard the filtrate containing impurities and the original cannula.

[0049] 8) Reassemble the binding column into a new sterile 2 mL cannula and slowly inject 700 μL of pre-warmed (25°C) DNA wash buffer along the column wall to avoid directly washing the adsorption matrix. Centrifuge at 8,000 × g for 60 s and discard the filtrate containing impurities.

[0050] 9) Repeat step 8 and wash again with DNA wash buffer;

[0051] 10) After assembling the DNA binding column with the 2 mL cannula, centrifuge at 12,000 × g for 2 minutes without loading to achieve

[0052] Column matrix dehydration treatment;

[0053] 11) Assemble the sterilized new 1.5 mL centrifuge tube with the DNA binding column and inject the

[0054] 50-200 μL of elution buffer preheated at 70°C, followed by a 3-min desorption incubation at room temperature;

[0055] 12) Centrifuge at 10,000 × g for 1 min at standard ambient temperature to achieve efficient elution of DNA molecules.

[0056] 13) Repeat steps 11-12;

[0057] 14) Store the eluted DNA at -20°C.

[0058] 1.4 Extraction of total cell RNA

[0059] 1) Adherent cells can be lysed directly in the culture dish. Discard the culture medium and add 1 mL of RNA-Solv Reagent. Use a pipette to pipette over the bottom of the culture dish, transfer to an enzyme-free EP tube, and incubate on ice for 5 minutes.

[0060] 2) Add 200 μL of chloroform to the EP tube, vortex at high speed for 20 seconds to mix thoroughly, and let it stand at room temperature for 2-3 minutes;

[0061] 3) Centrifuge at 12,000 × g for 15 min at 4°C to separate the aqueous and organic phases, and transfer the upper aqueous phase to a new enzyme-free EP tube.

[0062] 4) Add 300 μL of anhydrous ethanol, vortex mix, and centrifuge briefly;

[0063] 5) After assembling the RNA binding column with the matching cannula system, load the mixed solution prepared in step 4 in batches (each loading volume is controlled within 700 μL). Centrifuge at 10,000 × g for 1 minute at standard ambient temperature, and remove the centrifuged filtrate.

[0064] 6) Repeat step 5 until all the mixture is bound to the RNA binding column;

[0065] 7) After assembling the RNA purification column with the sterile cannula, load 500 μL of RNA primary wash buffer into the column matrix. Perform primary purification under standard centrifugation parameters (10,000 × g for 30 seconds), and finally separate and remove the waste filtrate.

[0066] 8) Repeat step 7 for a second wash;

[0067] 9) Reassemble the RNA purification column with the cannula system, load 500 μL of RNA secondary purification buffer into the core area of ​​the column, perform gradient centrifugation under standard centrifugation conditions (10,000 × g for 1 min), and then complete the experiment.

[0068] Directional separation and removal of waste liquid;

[0069] 10) Repeat step 9 and wash twice;

[0070] 11) Place the RNA binding column back into the cannula and centrifuge at 10,000 × g for 2 minutes.

[0071] 12) Place the RNA into a new 1.5 mL enzyme-free EP tube, add 20-50 μL of Nuclease-free Water to the binding column, centrifuge at 10,000 × g for 2 min to elute the RNA, add the Nuclease-free Water from the first elution back to the binding column for a second elution, and store the product at -80°C.

[0072] 1.5 RNA reverse transcription

[0073] 1) First, determine the concentration of the extracted RNA and calculate the volume of template RNA required based on 1000 ng;

[0074] 2) The first step is to remove genomic DNA. Prepare a mixture in an enzyme-free EP tube and add the calculated volume of template.

[0075] Add 3 μL of RNA and 5×g DNA wiper mix to 15 μL with RNase-free ddH2O. Use a pipette to gently pipette to mix the solution thoroughly. Incubate at 42°C for 2 min.

[0076] 3) In the second step, prepare the reverse transcription reaction system and directly add 5 μL 4×HiScriptIV qRT Super Mix to the first step reaction system.

[0077] 4) Finally, perform the reverse transcription reaction at 37°C for 5 minutes and 85°C for 5 seconds. For template DNA with complex spatial conformations or high GC-rich regions, it is recommended to adjust the thermal cycler temperature parameters to the 42-55°C range to significantly improve the yield of amplified product by enhancing primer binding efficiency.

[0078] 5) The product can be used directly in real-time quantitative PCR assays or stored at -20°C and used within six months. For long-term storage, it is recommended to store the product in aliquots at -80°C. Avoid repeated freezing and thawing of the cDNA.

[0079] 1.6 Real-time fluorescence quantitative PCR

[0080] 1) Prepare the amplification system in a high-pressure sterile EP tube.

[0081] 2×Taq Pro Universal SYBR qPCR Master Mix 10μL

[0082] Upstream primer (10 μmol / L) 1 μL

[0083] Downstream primer (10 μmol / L) 1 μL

[0084] Wherein, each pair of upstream primers and downstream primers used for gene amplification are selected from the following:

[0085]

[0086]

[0087] In the above list, the 18S forward and reverse primers are primarily used to amplify the 18S ribosomal RNA (rRNA) gene of eukaryotes. The 18S gene encodes 18S rRNA and is part of the rRNA gene family. Due to its high copy number and stable expression, the 18S gene serves as an internal control in qPCR.

[0088] ZBTB46 forward and reverse primers are used to amplify the ZBTB46 gene. ZBTB46 (Zinc Finger and BTB Domain-Containing Protein 46) encodes a transcription factor belonging to the zinc finger protein family. It possesses both a BTB domain (mediating protein interactions) and a zinc finger domain (binding DNA). In this experiment, ZBTB46 served as the parent gene of circZBTB46-2. Knockdown or overexpression of circZBTB46-2 was used to examine whether ZBTB46 expression was affected. It also served as a linear RNA control in circular RNA stability experiments.

[0089] circZBTB46-2 primers were used to amplify the specific backsplicing site region of the host gene ZBTB46 (Zinc Finger and BTB Domain Containing 46), which forms a circular RNA (circRNA). The circZBTB46-2 primers were designed as divergent primers, with the upstream and downstream primers flanking the backsplicing site, ensuring amplification of only the junction region of the circular RNA and avoiding cross-reaction with the linear ZBTB46 mRNA. circZBTB46-2 is a circular RNA (circRNA) generated by backsplicing of exon 2 of the ZBTB46 gene. CircZBTB46-2 expression was assessed by knockdown or overexpression. The siRNA interference efficiency and plasmid construction were confirmed. CircZBTB46-2 was tested using RNase R and actinomycin D assays to verify circRNA stability.

[0090] Cyclin D1 forward and reverse primers were used to amplify the gene encoding the Cyclin D1 protein. Cyclin D1 is a core regulator of cell proliferation. Its normal function ensures the orderly progression of the cell cycle, while abnormal expression promotes tumorigenesis by driving cell cycle deregulation and genomic instability. Cyclin D1 expression was detected by knocking down or overexpressing circZBTB46-2 to verify the effect of circZBTB46-2 on cell proliferation.

[0091] PCNA primers were used to amplify the gene encoding proliferating cell nuclear antigen (PCNA). PCNA is a key accessory protein for DNA replication. Its expression is significantly elevated during the S phase (DNA synthesis) of cells and it is a direct marker of cell proliferation. Its function is closely related to DNA replication, repair, and cell cycle regulation. By knocking down or overexpressing circZBTB46-2, its mRNA expression level was analyzed to assess its effect on cell proliferation.

[0092] BAX primers were used to amplify the gene encoding the pro-apoptotic protein BAX (Bcl-2-associated X protein). BAX is a key gene in the apoptosis (programmed cell death) regulatory network and belongs to the Bcl-2 protein family. This family determines cell survival or death by regulating mitochondrial outer membrane permeability (MOMP), and BAX is a key pro-apoptotic protein. The expression levels of BAX mRNA were analyzed by knockdown or overexpression of circZBTB46-2 to verify the effect of circZBTB46-2 on cell apoptosis.

[0093] BCL2 primers were used to amplify the gene encoding the anti-apoptotic protein BCL2 (B-cell lymphoma 2). BCL2 is a key anti-apoptotic gene and a member of the Bcl-2 protein family. The effect of circZBTB46-2 on cell apoptosis was verified by knocking down or overexpressing circZBTB46-2 and analyzing its mRNA expression level.

[0094] α-SMA forward and reverse primers were used to amplify the gene encoding α-smooth muscle actin (α-SMA). α-SMA is an important member of the cytoskeletal actin family and plays a key role in cell contraction, tissue homeostasis, and pathological processes. α-SMA is not only a core component of smooth muscle cell function but also a key marker and regulator of cell differentiation. Its expression level is closely correlated with cellular phenotypic transitions, particularly playing a central role in smooth muscle cell differentiation, myofibroblast activation, and cellular plasticity under pathological conditions. The effects of circZBTB46-2 on cell differentiation were verified by knocking down or overexpressing circZBTB46-2 and analyzing its mRNA expression level.

[0095] SM22α forward and reverse primers were used to amplify the gene encoding SM22α (Transgelin). SM22α is a highly conserved calmodulin-binding protein belonging to the SM22 / Transgelin family. Its encoding gene, TAGLN, is primarily expressed in smooth muscle cells and some mesenchymal cells. SM22α is a key marker for smooth muscle cell differentiation and is associated with cellular senescence. It plays multiple roles in cell differentiation by regulating cytoskeletal dynamics, signal transduction, and gene expression. By knocking down or overexpressing circZBTB46-2 and analyzing SM22α mRNA levels, we determined whether circZBTB46-2 affects smooth muscle cell phenotypic differentiation and senescence.

[0096] IL-18 forward and reverse primers were used to amplify the gene encoding interleukin-18 (IL-18). IL-18 is an important proinflammatory cytokine belonging to the IL-1 cytokine family that plays a key role in immune responses, inflammatory reactions, and metabolic regulation. IL-18 is also a key component of the senescence-associated secretory phenotype (SASP) and is closely associated with cardiovascular aging. CircZBTB46-2 was knocked down or overexpressed to analyze IL-18 mRNA levels and verify the effect of circZBTB46-2 on cellular inflammatory senescence.

[0097] IL-1β primers were used to amplify the gene encoding interleukin-1β (IL-1β). IL-1β is an important proinflammatory cytokine belonging to the IL-1 cytokine family that plays a central role in immune responses, inflammatory reactions, and various physiological and pathological processes. Similar to IL-18, IL-1β is a core component of the senescence-associated secretory phenotype (SASP). CircZBTB46-2 was knocked down or overexpressed to analyze IL-1β mRNA levels and verify the effect of circZBTB46-2 on inflammatory senescence in cells.

[0098] p53 primers were used to amplify the gene encoding the tumor suppressor protein p53. P53 is one of the most important tumor suppressor genes in the human body. It maintains cellular homeostasis and prevents abnormal proliferation and cancer by regulating key processes such as the cell cycle, apoptosis, DNA repair, and cellular senescence. Its dysfunction is closely associated with cancer, aging, and various age-related diseases. p53 mRNA levels were analyzed by knocking down or overexpressing circZBTB46-2 to verify the effect of circZBTB46-2 on cellular senescence.

[0099] p21 primers were used to amplify the gene encoding Cyclin-Dependent Kinase Inhibitor 1A (CDKN1A). The p21 gene (CDKN1A) is a key gene in cell cycle regulation and stress response. The protein it encodes, p21 (also known as Cip1 / Waf1), belongs to the cyclin-dependent kinase inhibitor (CKI) family. p21 is a core gene linking stress response, cell cycle regulation, and aging, playing a key role in tumor suppression and aging by mediating cell cycle arrest. p21 mRNA levels were analyzed by knockdown or overexpression of circZBTB46-2 to verify the effect of circZBTB46-2 on cell senescence.

[0100] Template DNA 1 μL

[0101] ddH2O To 20μL

[0102] 2) qPCR reaction procedure

[0103] ① Pre-denaturation 95℃ 30sec

[0104] ② Cycle reaction: 95℃ 3-10sec→60℃ 10-30sec, 40 times

[0105] ③ Melting curve uses the instrument default melting curve acquisition program

[0106] 3) Based on the Ct value, the relative expression changes of the target gene were analyzed with the control group as the benchmark.

[0107] 1.7 FISH experiments

[0108] The kit was used (Suzhou Genetech Co., Ltd.).

[0109] 1) Prepare cell culture slides in the well plate in advance;

[0110] 2) After removing the culture medium, wash twice with PBS buffer for 5 minutes each;

[0111] 3) After removing the residual PBS buffer, 500 μL of 4% paraformaldehyde solution was added to each well and fixed at standard ambient temperature for 10 minutes.

[0112] 4) After removing the 4% paraformaldehyde fixative, add 500 μL of freshly prepared 0.1% permeabilization buffer (Buffer A) to each well and incubate at standard ambient temperature for 15 minutes to achieve cell membrane permeabilization.

[0113] 5) After completely removing the residual 0.1% permeabilization buffer (Buffer A), wash twice with PBS buffer (5 min each time);

[0114] 6) Quantitatively load 500 μL of 1× blocking buffer into each well and perform a blocking reaction at 37°C for 30 min.

[0115] 7) After completely removing the remaining 1× blocking buffer, add 500 μL of 2× prehybridization buffer (Buffer C) to each well and incubate at 37°C for 30 minutes.

[0116] 8) Incubate Buffer E in a 73 ± 1°C water bath for 30 minutes, gently mixing the solution every 10 minutes until the solution is completely clear (uniform and transparent with no flocs or particles remaining).

[0117] 9) Probe dilution: Prepare the stock solution according to the nmole / OD260 parameter indicated on the probe powder label (e.g., 4.17 nmole / OD260). For each OD260 unit of probe powder, add 41.7 μL of sterile DEPC water. Gently vortex until completely dissolved. The final concentration of the solution after dissolution is 100 μM (calculation formula: concentration = nmole / OD260 ÷ volume [μL] × 1000, example: 4.17 ÷ 41.7 × 1000 ≈ 100 μM). Aliquot and store in the dark at -20°C. Avoid repeated freezing and thawing (it is recommended to aliquot the amount used for single use and freeze-thaw ≤ 3 times).

[0118] 10) Prepare the probe working solution: dilute the biotinylated probe stock solution to 1 μM and denature it in a 75±1°C constant temperature water bath for 10 minutes to eliminate secondary structure interference. Immediately transfer to ice for 2 minutes to terminate the denaturation process. Mix the probe and streptavidin-Cy3 (SA-Cy3) at a molar ratio of 1:1 in a sterile centrifuge tube: Example system (10 μL): 1 μL 1 μM denatured biotin probe, 1 μL 1 μM SA-Cy3, 8 μL PBS (pH 7.4). Gently vortex to mix and briefly centrifuge to collect droplets; incubate at 37°C for 30 minutes in the dark to promote specific binding of biotin-streptavidin;

[0119] 11) Mix the above probe working solution and Buffer E at a ratio of 1:9;

[0120] 12) After removing 2× Buffer C from the wells, add 500 μL of denatured probe mixture to each well and incubate at 37°C in the dark for 12-16 hours to complete hybridization;

[0121] 13) The next day, remove the plate from the 37°C incubator, discard the probe mixture, add 500 μL of preheated 0.1% Buffer F to each well, and wash with shaking at 37°C for 10 minutes.

[0122] 14) After removing 0.1% Buffer F from the wells, add 500 μL of preheated 2× Buffer C to each well and wash in a 60°C shaker for 10 min. Repeat three times.

[0123] 15) Remove 2× Buffer C and add 500 μL of preheated 2× Buffer C to each well. Wash in a 37°C shaker for 10 min. Repeat three times.

[0124] 16) Remove 2× Buffer C and add 500 μL of DAPI working solution to each well. Cover with a coverslip and store in the dark. Complete imaging within 2 days.

[0125] 1.8 Total cell protein extraction

[0126] 1) Place the treated cells on ice, discard the culture medium, and wash twice with 2 mL of 1× PBS;

[0127] 2) After discarding the PBS, add 700 μL of 1× PBS again, scrape the cells at the bottom of the culture dish with a scraper, and transfer the suspension to an EP tube. Repeat twice;

[0128] 3) Centrifuge at 6,000 rpm for 8 min at 4°C, discard the supernatant, and centrifuge again at 4°C at 6,000 rpm for 1 min. Use a pipette to discard the remaining liquid and retain the cell pellet.

[0129] 4) Add 250 μL of RIPA protease inhibitor lysis buffer to the pellet, place on ice, and perform ultrasonic disruption;

[0130] 5) After sonication, centrifuge at 12,000 rpm for 10 min at 4°C.

[0131] 6) After centrifugation, transfer the supernatant to a new high-pressure EP tube and mix with protein loading buffer (5×) at a ratio of 4:1;

[0132] 7) Boil the protein mixture in boiling water for 10 minutes to fully denature the protein and store at 4°C until ready for use.

[0133] 1.9 Western blot experiment

[0134] 1) Preparation of polyacrylamide gel

[0135] Polyacrylamide gel contains two layers of gel with different pore sizes: the upper gel (5% stacking gel) and the lower gel (separation gel:

[0136] 8%, 10%, 12%);

[0137] 2) Sample loading and gel electrophoresis

[0138] Insert the prepared gel plate into the electrophoresis tank, pour in the prepared electrophoresis solution, and add the proteins in the predetermined order.

[0139] Marker and protein sample; 90V for 30min to compress the sample to reach the separation gel, 120V for 1h. When the bromophenol blue tracer dye migrates to the bottom boundary of the gel separation zone (about 0.5cm from the bottom edge of the gel), immediately cut off the power supply of the electrophoresis instrument to terminate the electrophoresis process.

[0140] 3) Transfer

[0141] Soak the filter paper in 1× semi-dry transfer working solution in advance, cut the PVDF membrane into the same size as the filter paper, place it in methanol for activation, rinse it in distilled water after activation, and place it in semi-dry transfer working solution for later use. Take out the gel, cut off the excess gel, place it in semi-dry transfer working solution to prepare for transfer, and place the filter paper-PVDF membrane-gel-filter paper horizontally in the transfer tank of the semi-dry transfer system from bottom to top in the order, fix the instrument, and incubate at 25V for 30min.

[0142] 4) Milk powder sealing

[0143] After the transfer was completed, the PVDF membrane was immersed in 1×TBST blocking solution containing 5% skim milk powder and incubated at room temperature for 2 h.

[0144] 5) Film washing and cutting

[0145] After blocking, rinse with tap water 3 times, distilled water 3 times, and triple-distilled water 3 times; cut the PVDF membrane according to the protein molecular weight and protein marker.

[0146] 6) Primary antibody incubation

[0147] Immerse the pretreated PVDF membrane in the target primary antibody dilution solution and place it in a 4°C refrigerator for 12-16 hours.

[0148] 7) Primary antibody washing

[0149] The PVDF membrane that has been incubated with the primary antibody was transferred to a clean container containing TBST solution and placed on a horizontal shaker for oscillation and washing at room temperature for 10 minutes each time, repeated 3 times, and fresh pre-cooled TBST was replaced each time.

[0150] 8) Secondary antibody incubation

[0151] After incubation with the primary antibody and washing, the PVDF membrane was immersed in a secondary antibody solution diluted at a volume ratio of 1:10,000 (the secondary antibody species must match the primary antibody) in TBST buffer and incubated at room temperature for 1.5 h.

[0152] 9) Secondary antibody washing

[0153] Transfer the PVDF membrane that has completed the secondary antibody incubation to a clean container containing fresh TBST solution and place it on a horizontal shaker for oscillation and washing at room temperature for 10 minutes each time. Repeat 3 times in total, completely changing the washing solution each time and ensuring that the membrane is completely immersed.

[0154] 10) Imaging

[0155] Prepare chemiluminescent solution and detect protein bands using a chemiluminescent imager.

[0156] 1.10 RNase R experiment

[0157] 1) Configure the reaction system

[0158] RNA sample is calculated as 1 μg, 10× reaction buffer 2 μL, RNase R 0.5 μL (RNase R dosage can be optimized according to specific experiments), and Nucleas-Free water is added to 20 μL.

[0159] 2) After the reaction system is prepared, shake and mix thoroughly, and react at 37°C for 10-30 minutes (the reaction time should not exceed 1 hour).

[0160] 3) After the reaction is complete, incubate at 70°C for 10 minutes. The resulting product can be directly used for subsequent reverse transcription experiments.

[0161] 1.11 Circ RNA Circularization Verification

[0162] 1) Collect total RNA and gDNA from cells treated with the same method and perform reverse transcription;

[0163] 2) PCR amplification of cDNA and gDNA using divergent primers and convergent primers, respectively;

[0164] Divergent primer upstream primer circZBTB46-2-HF sequence: AGCCGAGACTCAAAGTCTGT;

[0165] Divergent primer downstream primer circZBTB46-2-HR sequence: CCGGTAGTGGGACGTGATTT;

[0166] Convergent primer upstream primer ZBTB46-HF sequence: AGGACCTGCCCGTGTGAAGAC;

[0167] Convergence primer downstream primer ZBTB46-HR ​​sequence: GCTGGTGCTCTACCTGACAATGTG;

[0168] 3) Prepare a gel containing 1× TAE buffer and nucleic acid dye at the appropriate concentration based on the length of the target gene fragment;

[0169] 4) Mix the amplified product with 6× DNA Loading Buffer in appropriate proportions;

[0170] 5) Add the DNA ladder and mixed sample to an agarose gel in sequence and perform gel electrophoresis at 75V for 50 minutes.

[0171] 6) After electrophoresis, place the gel in a gel imager for imaging and observing the bands.

[0172] 1.12 RNA stability test (actinomycin D method)

[0173] 1) Culture cells normally and perform passage processing according to the experimental design;

[0174] 2) Actinomycin D treatment was performed at the designed time points;

[0175] 3) When the corresponding time point is reached, the cells are collected and RNA is extracted;

[0176] 4) Reverse transcription of RNA into cDNA;

[0177] 5) qRT-PCR was performed to detect the expression levels of RNA in the treatment group and the control group;

[0178] 6) Calculate the half-life of the target gene through data analysis.

[0179] 1.13 Protein silver staining

[0180] According to the instructions for use of the Beyotime Rapid Silver Staining Kit:

[0181] 1) Fixed

[0182] After electrophoresis, the gel was trimmed to the target size and immersed in 100 mL of fixative solution (anhydrous ethanol: glacial acetic acid: ddH2O in a volume ratio of 5:1:4), and fixed with continuous shaking on a horizontal shaker (65±5 rpm) at room temperature (25±2°C) for 12-16 h.

[0183] 2) Wash with 30% ethanol

[0184] After discarding the overnight fixative, add 100 mL of pre-prepared 30% ethanol solution (mix 30 mL of anhydrous ethanol with 70 mL of ddH2O and vortex for 10 seconds) to ensure that the gel is completely covered. Place the container on a horizontal shaker with an oscillation frequency of 65 ± 5 rpm and wash at room temperature (25 ± 2°C) for 10 minutes to remove residual glacial acetic acid and fixation byproducts.

[0185] 3) Wash with double distilled water

[0186] After discarding the 30% ethanol, add 100 mL of sterile double-distilled water (ddH2O) to cover the gel and wash with shaking on a horizontal shaker (65±5 rpm) at room temperature (25±2°C) for 10 min. Repeat twice, completely replacing fresh ddH2O each time and ensuring that the gel is completely immersed.

[0187] 4) Sensitization

[0188] After removing the double-distilled water, add 100 mL of freshly prepared 1× silver stain sensitizer (mix 1 mL of 100× stock solution with 99 mL of ddH2O and vortex to mix thoroughly). Oscillate on a horizontal shaker (65±5 rpm) at room temperature (25±2°C) for 2 min. The sensitizer working solution must be prepared before use (≤2 h after preparation) to avoid oxidative inactivation.

[0189] 5) Wash with double distilled water

[0190] Add 100 mL of sterile double-distilled water, shake and wash on a horizontal shaker (65 ± 5 rpm) at room temperature (25 ± 2 ° C) for 1 min, discard the liquid completely, repeat adding an equal volume of fresh ddH2O, and wash under the same conditions for 1 min to ensure that the residual sensitization reagent is removed.

[0191] 6) Silver staining

[0192] After removing the rinse buffer, add 100 mL of freshly prepared 1× silver stain working solution (mix 1 mL of 100× silver stain stock solution with 99 mL of sterile ddH2O), ensuring complete coverage of the gel. Incubate on a horizontal shaker (65 ± 5 rpm) at room temperature (25 ± 2°C) in the dark for 10 minutes to activate the binding of silver ions to proteins. The working solution should be prepared and used immediately (≤ 2 hours after preparation) to prevent silver ion oxidation, which may reduce staining sensitivity.

[0193] 7) Wash with double distilled water

[0194] After removing the silver solution, immediately add 100 mL of double-distilled water and place in a shaker (65±5 rpm) at room temperature for 1 to 1.5 minutes of washing (the total time is strictly controlled within 1.5 minutes).

[0195] 8) Color development

[0196] After discarding the aqueous phase, immediately add 100 mL of freshly prepared silver staining solution and develop the color on a shaker at room temperature (65 ± 5 rpm). Dynamically observe the gel until the target protein band clearly appears, then terminate the color development process (the color development process should be dynamically terminated within 3-10 minutes). Silver staining solution preparation method: Mix 80 mL of double-distilled water and 20 mL of 5× silver stain base solution in a volume ratio of 4:1. Then accurately measure 0.05 mL of 2000× color accelerator to add the system, vortex to mix, and prepare it immediately for use (effective period ≤ 20 minutes). It is important to note that the color development time should not be too long, otherwise it may cause the background signal to reach an undesirable level.

[0197] 9) Termination

[0198] Immediately after discarding the colorimetric solution, add 100 mL of freshly prepared 1× Silver Stain Stop Solution and shake continuously at room temperature (65 ± 5 rpm) for 10 minutes. (The formation of bubbles during the reaction is normal and does not require intervention.) Prepare 1× Silver Stain Stop Solution by mixing 5 mL of 20× Silver Stain Stop Solution with 95 mL of double-distilled water in a 19:1 volume ratio. Vortex to mix thoroughly and use immediately (expiration date ≤ 24 hours).

[0199] 10) Wash with double distilled water

[0200] Discard the silver staining stop solution, add 100 mL of double-distilled water, and wash on a shaker at room temperature for 2-5 minutes at a shaking speed of 60-70 rpm.

[0201] 11)Save

[0202] After washing, store in double-distilled water. The strips or gel blocks can be cut out and analyzed by MS.

[0203] 1.14 Plasmid DNA extraction

[0204] According to EZNA Endo-free Plasmid DNA Mini Kit I Instructions Manual

[0205] 1) First, inoculate the bacterial suspension into high-pressure LB liquid medium at a ratio of 1:1000, add the corresponding antibiotic (bacteria suspension: antibiotic = 1:1), and shake at 37°C and 200 rpm for 12-16 hours.

[0206] 2) Aliquot the shaken culture into 50 mL tubes and centrifuge at 10,000 × g for 1 minute at room temperature to collect the bacteria. Discard the supernatant and retain the pellet.

[0207] 3) Add 2.5 mL of solution I (with RNase A added) to the pellet and vortex or pipette.

[0208] 4) Add 250 μL of solution II. Gently invert the tube 4-5 times along the axis of the tube wall (avoid vortexing). After the liquid phase separates, let it stand until the lysate is completely clear. This may take 2-3 minutes. Avoid vigorous shaking. After use, immediately cap solution II tightly to prevent contact with CO2 in the air.

[0209] 5) Add 1.25 mL of pre-chilled N3 buffer. Gently invert the tube several times until a flocculent white precipitate forms. Centrifuge at 13,000 × g for 10 min at room temperature.

[0210] 6) Pipette the clarified lysate into a new 15 mL centrifuge tube. Observe the volume of the aspirated lysate and add 0.1 times the volume of the lysate to the ETR solution. Invert the tube 10 times to mix thoroughly. The lysate should now be turbid.

[0211] 7) Incubate on ice for 10 minutes. Invert the tube several times during the incubation process until the lysate gradually becomes clear.

[0212] 8) After the ice bath, incubate the lysate at 42°C for 5 minutes. The lysate will become turbid again.

[0213] 9) Centrifuge at 12,000 × g for 3 min at 25°C. After centrifugation, the liquid in the tube will separate into layers. The bottom blue layer is the ETR solution, and the upper clear aqueous phase is the lysate.

[0214] 10) Transfer the lysate to a new 15 mL tube and add 0.5 volumes of absolute ethanol (room temperature). Gently invert the tube several times to mix. Incubate at room temperature for 1-2 minutes.

[0215] 11) Insert the DNA binding column into a 2 mL cannula. Transfer 70 μL of the mixture from step 10 to the DNA binding column and centrifuge at 10,000 × g for 1 minute at room temperature.

[0216] 12) Discard the filtrate and reinsert the DNA binding column.

[0217] 13) Repeat steps 11-12 until all the mixture is bound to the column

[0218] 14) Add 500 μL of HBC buffer (HBC buffer must be diluted with isopropanol before use) to the binding column. Centrifuge at 10,000 × g for 1 minute at room temperature.

[0219] 15) Discard the filtrate and reinsert the DNA binding column.

[0220] 16) Add 700 μL DNA Wash Buffer (must be diluted with 100% ethanol before use) and centrifuge at 10,000 × g for 1 min at room temperature.

[0221] 17) Discard the filtrate and reinsert the DNA binding column.

[0222] 18) Repeat steps 16-17 for a second DNA wash step with wash buffer.

[0223] 19) Centrifuge the empty DNA binding column at 13,000×g for 2 minutes to dry the binding column.

[0224] 20) Insert the DNA binding column into a clean 1.5 mL microcentrifuge tube. Add 30-100 μL Endotoxin-Free Elution Buffer or sterile deionized water to the center of the column and let it stand at room temperature for 1 minute.

[0225] 21) After standing, centrifuge at 13,000 × g for 1 minute. The resulting DNA will be approximately 70% bound to the column. You can perform a second elution, repeating step 20.

[0226] 22) Store the plasmid DNA at -20°C.

[0227] 1.15 Immunofluorescence on cell slides

[0228] 1) Place a circular coverslip in a well plate, inoculate the cell suspension, and culture to the appropriate concentration for treatment.

[0229] 2) After treatment, the culture medium was discarded and the cells were washed with 1× PBS for 5 min three times.

[0230] 3) Discard PBS, add 1.5 mL of 4% paraformaldehyde, and fix at room temperature for 15 minutes.

[0231] 4) Discard the paraformaldehyde and permeabilize the cells with PBS buffer containing 0.5% Triton X-100 (PBS-T) for 5 min three times.

[0232] 5) Discard PBS-T and wash cells with 1× PBS for 5 min three times.

[0233] 6) Place the slide flat on the center of the slide, circle the edge with an immunohistochemistry pen, add 5% goat serum blocking solution to cover the sample area, and let it stand at room temperature for 30 minutes.

[0234] 7) Discard the goat serum, add primary antibody to cover the slide, place in a humidified chamber, and incubate at 4°C overnight.

[0235] 8) The next day, take out the wet box and place it at room temperature for 30 minutes.

[0236] 9) Washing the primary antibody: Wash the cells with PBS-T for 5 minutes three times; discard the PBS-T and wash the cells with 1× PBS for 5 minutes three times.

[0237] 10) Discard PBS, add secondary antibody (corresponding to the species of the primary antibody), and incubate at 37°C in the dark for 1 hour.

[0238] 11) Wash the secondary antibody (in the dark): Wash the cells with PBS-T for 10 min three times; discard the PBS-T and wash the cells with 1× PBS for 10 min three times.

[0239] 12) Add DAPI antifade mounting medium to cover the sample area. After solidification in the dark, select an appropriate excitation wavelength for microscopic examination under a fluorescence microscope and adjust the exposure parameters to capture the target fluorescence signal image.

[0240] 1.16 β-galactosidase staining

[0241] According to the instructions of the Solebro β-galactosidase staining kit:

[0242] 1) Discard the culture medium from the treated cells, rinse the monolayer with 1× PBS, add freshly prepared β-Gal fixative, and fix at room temperature for 15 minutes.

[0243] 2) After discarding the β-Gal fixative, wash the cells with 1× PBS buffer for 3 minutes each time and repeat three times.

[0244] 3) Prepare the working staining solution according to the instructions and the proportions. Discard the PBS and add 1 mL of the working staining solution to each well.

[0245] 4) Place in a 37°C oven and react overnight for 12-24 hours. To prevent the working solution in the plate from drying out, the plate can be placed in a humidified box.

[0246] 5) After the reaction is complete, observe and count under an optical microscope. If delayed detection is required, discard the staining solution, rinse twice with PBS, and finally cover with 2 mL of fresh PBS. Seal and store in a dark place at 4°C (shelf life ≤ 7 days).

[0247] 1.17 Co-immunoprecipitation (co-IP)

[0248] 1) Magnetic bead activation

[0249] Take 30 μL of the magnetic bead suspension (vortex thoroughly to prevent aggregation), add 400 mL of PBS-T, mix gently with a pipette, separate on a magnetic stand, and discard the supernatant. Repeat this washing step three times to remove stabilizers and unbound impurities from the storage solution.

[0250] 2) Antibody conjugation

[0251] Add 2 μg of target antibody (the negative control group uses the same type of IgG antibody) to the activated magnetic beads, fill the volume to 400 μL with 0.5% Triton PBS, add 2 μg of target antibody (the negative control group uses the same type of IgG antibody), and incubate at room temperature in a horizontal mixer at 15 rpm for 30 minutes;

[0252] 3) Magnetic bead washing

[0253] After incubation, the beads were separated by magnetic stand, the supernatant was discarded, and the beads were washed four times with 400 μL PBS-T.

[0254] 4) Cell lysis and protein extraction

[0255] Lyse cells with RIPA buffer and collect the protein supernatant after centrifugation. Determine protein concentration using the BCA assay. A portion of the protein lysate is used as the input control, while the remaining sample is incubated with the magnetic bead-antibody complex. Before incubation, add PBS-T to bring the volume to 400 μL to ensure uniformity of the reaction system.

[0256] 5) Antigen-antibody binding

[0257] The protein sample and the magnetic bead-antibody complex were incubated at room temperature for 30 min in a flip mixer to promote the specific binding of the target protein.

[0258] 6) Magnetic bead washing

[0259] After incubation, the beads were separated by magnetic stand, the supernatant was discarded, and the beads were washed five times with 400 μL PBS-T to remove unbound proteins.

[0260] 7) Thermal denaturation elution

[0261] Separate the magnetic beads, discard the supernatant, add 30 μL 1× Loading Buffer (lysate diluted) to the magnetic beads and mix evenly, boil in a boiling water bath for 5 min, separate the magnetic beads, collect the supernatant, and perform SDS-PAGE detection.

[0262] 1.18 Vector Construction

[0263] (1) Construction of circZBTB46-2 vector

[0264] 1) Use PCR to isolate the target gene from a plasmid cloning template containing the target gene. If no template is available, use full gene synthesis to obtain the target gene. Perform enzyme digestion on the target gene and the target vector separately. Purify the digestion products and ligate them. Transform the ligated products into competent bacterial cells. The resulting clones are first identified by enzyme digestion to confirm that the target gene has been specifically linked into the target vector. Positive clones are then sequenced and analyzed for alignment. Those with a correct alignment are considered to be successfully constructed plasmid vectors expressing the target gene. The constructed recombinant vector is then subjected to ultrapurification extraction.

[0265] 2) Experimental process

[0266] a. Use PCR to obtain sequence fragments

[0267] Oligo design, circZBTB46-2 gene upstream and downstream primers were added with BamHI and EcoRI and protective bases respectively for vector subcloning. The oligo sequences are as follows:

[0268]

[0269]

[0270]

[0271] b. The above primers were synthesized by Suzhou GeneGene Co., Ltd.

[0272] c. Dissolve the oligo into 50μM, take the same volume of oligo into a 1.5ml centrifuge tube, mix well, and prepare oligo mix.

[0273] d. Perform the first round of PCR using the prepared oligo mix. The PCR system is as follows:

[0274]

[0275] Loop conditions:

[0276]

[0277]

[0278] e. Perform the second round of PCR reaction using oligo-1 and oligo-30, and use the product of the first round of PCR reaction as the template.

[0279] The PCR system is as follows:

[0280]

[0281] Loop conditions:

[0282]

[0283] The first round of PCR can obtain a non-single band PCR product mixture mixed with the target gene band. Then, using the first round of PCR product as a template, a single target gene band can be obtained through the second round of PCR.

[0284] f. After the PCR reaction is completed, use Agarose electrophoresis and gel cutting to recover the gene fragments.

[0285] 3) ZBTB46-2 gene was cloned into the vector pcDNA3.1(+)

[0286] a. Digest the ZBTB46-2 fragment with BamHI and EcoRI at 37°C for 2 hours. The enzyme digestion system is as follows:

[0287]

[0288] b. Digest the vector pcDNA3.1(+) with BamHI and EcoRI at 37°C for 2 hours. The enzyme digestion system is as follows:

[0289]

[0290] c. Electrophoresis, use DNA gel recovery kit to recover ZBTB46-2 gene fragment and vector

[0291] pcDNA3.1(+).

[0292] d. Use T4 DNA ligase to connect the double-digested ZBTB46-2 gene fragment and the linearized vector.

[0293] Connect at 22℃ for 2 hours. The connection system is as follows:

[0294] T4 DNA ligase buffer 2 μl pcDNA3.1(+) 2 μl ZBTB46-2 5μl T4 DNA ligase 1 μl <![CDATA[ddH2O]]> 10 μl

[0295] e. Preparation of competent cells: (Calcium chloride method)

[0296] A single colony was picked from a fresh plate grown at 37°C for 16 hours and transferred to a 1 L flask containing 100 ml of LB medium. The culture was incubated at 37°C for 3 hours with vigorous shaking (rotating shaker, 300 rpm).

[0297] Aseptically transfer the bacteria to a sterile, disposable, ice-cold 50 ml polypropylene tube and place on ice for 10 minutes to cool the culture to 0°C.

[0298] The cells were recovered by centrifugation at 4000 rpm at 4°C for 10 minutes.

[0299] Pour off the culture medium and invert the tube for 1 minute to allow the last traces of culture medium to flow out.

[0300] Resuspend each pellet in 10 ml of ice-cold 0.1 mol / L CaCl2 and place on an ice bath.

[0301] The cells were recovered by centrifugation at 4000 rpm for 10 minutes at 4°C.

[0302] Pour off the culture medium and invert the tube for 1 minute to allow the last traces of culture medium to flow out.

[0303] Resuspend each cell pellet with 2 ml of ice-cold 0.1 mol / L CaCl2 (containing 20% ​​glycerol) per 50 ml of initial culture.

[0304] Aliquot the cells into small aliquots (100 μl / vial) and freeze at -70°C. (For preparation of competent cells, refer to Molecular Cloning Protocols, 2nd edition, page 55)

[0305] f. Transform the ligation product into competent cells

[0306] Remove the competent cells from -70°C and place the centrifuge tube containing the competent cells on ice for 4 minutes. After the competent cells are thawed, add 10 μl of the ligation product, gently mix the contents, and place on ice for 30 minutes.

[0307] Place the centrifuge tube on a test tube rack in a water bath preheated to 42°C and leave it there for 90 seconds without shaking the centrifuge tube.

[0308] Quickly transfer the tube to an ice bath and allow the cells to cool for 3 minutes.

[0309] 800 μl of LB medium (without antibiotics) was added to each centrifuge tube, and then the centrifuge tube was transferred to a 37°C shaker at 250 rpm and incubated for 45 minutes to allow the bacteria to recover.

[0310] Take 200 μl of the cultured cells and evenly spread them on an LB plate containing 50 μg / ml Ampicillin.

[0311] After the liquid on the plate is absorbed, place the plate upside down in a 37°C incubator and culture for 16 hours.

[0312] g. Pick clones from the plate, extract the plasmid and identify the positive clones.

[0313] Pick 4 separate, full colonies from the cultured plate and place them in a test tube containing 5 ml of LB medium (containing 50 μg / ml Ampicillin).

[0314] The test tubes were placed in a bacterial shaker and cultured at 37°C, 250 rpm, for 16 hours.

[0315] The cultured bacterial suspension was used to extract the plasmid using a plasmid extraction kit (Tiangen Biochemical, DP104-02) (for details on the plasmid extraction steps, please refer to the instructions of the plasmid extraction kit).

[0316] 4) Sequencing verification of recombinant plasmid and large-scale extraction

[0317] a. Take 200 μl of the bacterial solution corresponding to the positive clone for sequencing, and store the remaining bacterial solution in glycerol.

[0318] b. Compare the sequencing results with the target gene sequence. Once the results are correct, use the preserved glycerol bacterial solution to inoculate LB culture medium and perform large-scale plasmid extraction to obtain a sufficient amount of recombinant plasmid.

[0319] (2) Construction of circZBTB46-2-ATG mut vector

[0320] The construction method is basically the same as that of circZBTB46-2 vector, except that the oligo sequences are as follows:

[0321]

[0322]

[0323]

[0324] (3) Construction of circZBTB46-2-Flag vector

[0325] The construction method is basically the same as that of circZBTB46-2 vector, except that the oligo sequences are as follows:

[0326]

[0327]

[0328] (4) Construction of linZBTB46-2-Flag vector

[0329] The construction method is basically the same as that of circZBTB46-2 vector, except that the oligo sequences are as follows:

[0330]

[0331]

[0332]

[0333] 1.19 Statistical Processing and Correlation Analysis

[0334] Statistical analysis was performed using GraphPad Prism 8.3.0. Statistical comparisons were performed using two-sided t-tests and one-way analysis of variance. All statistical data are presented as mean ± standard deviation. P < 0.05 was considered statistically significant.

[0335] 1.20 Results

[0336] 1.circZBTB46-2 is stably present in cells and localized in the cytoplasm and nucleus.

[0337] The circZBTB46-2 sequence is derived from the second exon of the ZBTB46 gene on human chromosome 20q13.33 and is 970 bp long. Figure 1 As shown in A. First, we designed and synthesized two primers, of which the divergent primer was used to amplify

[0338] circZBTB46-2, convergent primers were used to amplify linear ZBTB46 mRNA. cDNA and gDNA were extracted from HASMC as templates. Agarose gel electrophoresis results showed that circZBTB46-2 could only be amplified from cDNA by divergent primers, but not from gDNA, as shown in Figure 2. Figure 1 As shown in Figure B, this indicates that the circular structure of circZBTB46-2 is formed by reverse splicing. To further confirm the correctness of its circular structure, we verified the reverse splicing site of circZBTB46-2 by Sanger sequencing, as shown in Figure 4 Figure 1 C. Subsequently, the stability of circZBTB46-2 in cells was detected, and the results of RNase R digestion experiments showed that circZBTB46-2 was resistant to nuclease degradation compared with linear ZBTB46 mRNA. After treating cells with actinomycin D, we found that the half-life of circZBTB46-2 was significantly longer than that of linear ZBTB46 mRNA. These results indicate that circZBTB46-2 is stably present in HASMCs, as shown in Figure 3. Figure 1 As shown in D and E. Based on the reverse splicing site sequence unique to circRNA, a specific fluorescent probe for circZBTB46-2 was designed for fluorescence in situ hybridization experiments. The results showed that circZBTB46-2 was distributed in the cytoplasm and nucleus of HASMC, as shown in Figure 1 As shown in F.

[0339] 2.circZBTB46-2 encodes a protein containing 462 amino acids.

[0340] According to the predictions of the online databases circRNADb and TransCirc, the sequence of circZBTB46-2 contains an internal ribosome entry site (IRES) and an open reading frame (ORF) spanning the junction, which has the potential to encode a protein containing 462 amino acids. We named this protein circZBTB46-462aa. Because the reading process spans the junction and the start codon ATG, the C-terminus of circZBTB46-462aa has a unique 150 amino acid sequence, such as Figure 2 As shown in A. We inserted the tag protein FLAG sequence before the stop codon TGA of the circZBTB46-2 sequence to construct

[0341] The circZBTB46-2-FLAG expression vector was transfected into HASMC, and Western blot was performed using anti-FLAG antibody. The results showed that after transfection of circZBTB46-2-FLAG, a clear band with a molecular weight of 55-70 kDa was observed, as shown in Figure 2. Figure 2 B, lane 4. Although the online database predicted that circZFAT and circCTDP1 also had coding potential, no specific FLAG band was observed in the same experiment, as shown in Figure 2 B, lanes 5 and 6. Similarly, no FLAG band was observed for circZBTB46. Figure 2 B lane 3. Subsequently, the circZBTB46-2 sequence was spliced ​​to construct a linear FLAG-tagged

[0342] The circZBTB46-462aa expression vector linZBTB46-2-Flag was constructed, and the circZBTB46-2 expression vector and the ATG mutant circZBTB46-2 expression vector (circZBTB46-2-ATG mut) were constructed. Figure 2 As shown in C. HASMC was transfected with linZBTB46-2-Flag, and Western blot results showed that there was a clear FLAG band with a molecular weight of 55-70 kDa, as shown in Figure 2 As shown in D, immunofluorescence staining (IF) results showed that circZBTB46-462aa was mainly distributed in the cytoplasm. Figure 2 As shown in E.

[0343] To further determine the coding potential of circZBTB46-2, linZBTB46-2-Flag was overexpressed in HASMC, immunoprecipitated (IP) with anti-FLAG antibody, and the eluate was subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis.

[0344] (SDS-PAGE), silver staining, and mass spectrometry analysis further verified the predicted molecular weight and specific peptide fragments of circZBTB46-462aa, such as Figure 2 These data indicate that circZBTB46-2 encodes a novel protein, circZBTB46-462aa. Western blot analysis using antibodies against the common sequence of ZBTB46 and circZBTB46-462aa revealed that in addition to endogenous ZBTB46 expression, a protein band with a molecular weight of 55-70 kDa was also detected in HASMC.

[0345] The expression of this protein increased after transfection with linZBTB46-2-Flag and circZBTB46-2, while transfection with circZBTB46-2-ATG mut did not increase the expression of this protein. Figure 2 G. Subsequently, Alphafold3 was used to predict the protein spatial structure of circZBTB46-462aa, as shown in Figure 2 As shown in H.

[0346] 3.circZBTB46-2 promotes the expression of HASMC aging marker genes.

[0347] To investigate the biological function of circZBTB46-2, we designed and constructed circZBTB46-2-specific small interfering RNA (siRNA).

[0348] (siRNA) was used to knock down circZBTB46-2. qRT-PCR results showed that siRNA transfection led to

[0349] The level of circZBTB46-2 was decreased, but it did not affect the expression level of ZBTB46 mRNA, e.g. Figure 3 As shown in A. Western blot results showed that knockdown of circZBTB46-2 could inhibit the expression of aging-related genes such as p53, p21, IL-18, IL-1β, and SM22α. Figure 3 As shown in B. Overexpression of circZBTB46-2 promoted the expression of the above genes, as shown in Figure 3 C. At the same time, qRT-PCR results showed that after knocking down circZBTB46-2, the mRNA expression levels of IL-18, IL-1β, p53, and p21 were significantly downregulated, as shown in Figure 3 As shown in D, overexpression of circZBTB46-2 promoted the mRNA expression of these genes, as shown in Figure 3 E. Description

[0350] circZBTB46-2 may promote cell senescence.

[0351] To further investigate the role of circZBTB46-2 in cell senescence, HASMC were treated with D-galactose (D-Gal) to construct a cell senescence model. qRT-PCR results showed that the mRNA expressions of p53 and p21 were increased, indicating that the cell senescence model was successfully established. Figure 3 F. It was also found that after cells were treated with D-Gal, the expression level of circZBTB46-2 was upregulated, as shown in Figure 3 G. A rescue experiment was then performed, and the results of SA-β-Gal staining showed that after D-Gal treatment, the number of positively stained cells increased. When circZBTB46-2 was knocked down, the increase in the number of positively stained cells caused by D-Gal was reduced, as shown in Figure 2. Figure 3 H. Western blot results showed that D-Gal could induce the expression of IL-18, IL-1β, p53, and p21, while knockdown of circZBTB46-2 could significantly antagonize this effect, as shown in Figure 3. Figure 3 As shown in I. These results indicate that circZBTB46-2 promotes HASMC senescence.

[0352] 4.circZBTB46-2 promotes cell senescence through the encoded protein circZBTB46-462aa.

[0353] To further explore whether circZBTB46-2 promotes cell senescence through the encoded circZBTB46-462aa, HASMC were transfected with the vectors circZBTB46-2, circZBTB46-2-ATG mut, and linZBTB46-2-Flag to observe the expression of senescence-related genes. qRT-PCR results showed that compared with the control group, the expression of circZBTB46-2 was significantly upregulated in cells transfected with the above three vectors, while the expression of ZBTB46 mRNA did not change significantly. Figure 4 As shown in A. Western blot results showed that compared with the control group, the expression levels of IL-18, IL-1β, p53, and p21 in HASMCs in the circZBTB46-2 group and linZBTB46-2-Flag group were upregulated, while in the circZBTB46-2-ATG mut transfection group, there was no significant change in the above genes, as shown in Figure 4As shown in B. ELISA results showed that the levels of IL-18 and IL-1β in the supernatant of cells transfected with circZBTB46-2 and linZBTB46-2-Flag increased, while the levels of IL-18 and IL-1β in the supernatant of cells transfected with circZBTB46-2-ATG mut did not change significantly, as shown in Figure 4 As shown in C, D. SA-β-Gal staining results showed that compared with the control group, the number of positively stained cells increased in cells treated with D-Gal. When circZBTB46-2-ATG mut was overexpressed, the number of positively stained cells did not change significantly. Figure 4 As shown in E, overexpression of linZBTB46-2-Flag can increase the number of positively stained cells caused by D-Gal. Figure 4 4F as shown in A. These results indicate that circZBTB46-2 promotes cellular senescence by encoding circZBTB46-462aa.

[0354] It should be understood that the present invention is described by way of example only and is susceptible to modification within the scope and spirit of the present invention. The preferred embodiments of the present invention have been described in detail above. It should be understood that numerous modifications and variations based on the concepts of the present invention can be made by one of ordinary skill in the art without requiring creative effort. Therefore, any technical solution that can be derived by one of ordinary skill in the art based on the concepts of the present invention through logical analysis, reasoning, or limited experimentation on the basis of the prior art should be within the scope of protection defined by the claims.

Claims

1. A circular RNA molecule circZBTB46-2, characterized by: The circZBTB46-2 is derived from the second exon of the ZBTB46 gene on human chromosome 20q13.33, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. A method for amplifying the circular RNA molecule circZBTB46-2 according to claim 1, characterized in that: The circZBTB46-2 was amplified in cDNA using divergent primers, wherein the sequence of the upstream primer circZBTB46-2-HF was AGCCGAGACTCAAAGTCTGT, as shown in SEQ ID NO.2; and the sequence of the downstream primer circZBTB46-2-HR was CCGGTAGTGGGACGTGATTT, as shown in SEQ ID NO.

3.

3. The protein encoded by the circular RNA molecule circZBTB46-2 according to claim 1, characterized in that: The protein is named circZBTB46-462aa, and its amino acid sequence is shown in SEQ ID NO.

4.

4. Application of preparations for detecting the expression level of circZBTB46-462aa in the preparation of cell aging diagnostic reagents.

5. The use according to claim 4, characterized in that The detection preparation detects the expression of circZBTB46-462aa in the HASMC cells of the subjects, and the expression is significantly upregulated compared with the healthy control group, thereby judging whether the subjects are aging.

6. The use according to claim 5, characterized in that The expression level of circZBTB46-462aa in the HASMC cells is increased, which can upregulate the expression of aging-related genes p53, p21, IL-18 and IL-1β.

7. A reagent for detecting cell senescence, characterized in that: The reagent can detect the expression level of the protein circZBTB46-462aa.

8. A kit for detecting cell senescence, characterized in that: At least comprising the reagent according to claim 7.

9. Use of the protein according to claim 3 as a biomarker or target in the preparation of diagnostic and / or therapeutic anti-aging drugs.

10. An anti-aging drug, characterized in that: The method comprises at least a reagent capable of detecting the protein according to claim 3 and its expression level, and a pharmaceutically suitable carrier.

Images