SiRNA, conjugate and inhibitor for inhibiting GAPDH gene expression and application of siRNA, conjugate and inhibitor

By designing specific siRNAs and conjugates for GAPDH genes, the problem of lack of positive references in RNAi experiments was solved, and the reproducibility and accuracy of experimental results in different cells and tissues were achieved, especially in embryonic kidney cells, liver cancer cells or liver tissues.

CN120505314APending Publication Date: 2025-08-19SHANGHAI GENEPHARMA CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510665532.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-22
Publication Date
2025-08-19

AI Technical Summary

Technical Problem

In RNAi experiments, the lack of positive references suitable for different cells and tissues makes it difficult to guarantee the repeatability and accuracy of experimental results.

Method used

Design specific siRNA and siRNA conjugates to inhibit the GAPDH gene, select the GAPDH gene as the reference gene, develop positive references suitable for various cells and tissues, and improve the inhibitory effect by modifying nucleotide sequences and conjugation groups.

Benefits of technology

Positive references suitable for various cells and tissues are provided to ensure the repeatability and accuracy of RNAi experimental results, especially in embryonic kidney cells, liver cancer cells or liver tissues, and to verify the effectiveness of the experimental system and the reliability of the results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120505314A_ABST
    Figure CN120505314A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biology, in particular to siRNA, a conjugate and an inhibitor for inhibiting GAPDH gene expression and application of the siRNA, the conjugate and the inhibitor. According to the siRNA for inhibiting GAPDH gene expression, the siRNA comprises a positive-sense strand and an antisense strand, each nucleotide in the siRNA is independently modified or unmodified nucleotide, the positive-sense strand contains a nucleotide sequence a, the antisense strand contains a nucleotide sequence b, the nucleotide sequence a and the nucleotide sequence b are at least partially reversely complementary to form a double-stranded region, and the double-stranded region is a single-stranded region. The nucleotide sequence a and the nucleotide sequence b are selected from the following sequences SEQ ID NO.1-SEQ ID NO.18; the siRNA for inhibiting GAPDH gene expression can be used as a universal positive reference substance suitable for various cells and tissues, and can ensure the repeatability, accuracy and reliability of RNAi experimental results.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an siRNA, a conjugate and an inhibitor for inhibiting GAPDH gene expression and uses thereof. Background Art

[0002] RNA interference (RNAi) technology, a powerful tool for studying gene function, has been widely used in biology in recent years. This technology silences specific gene expression by introducing double-stranded RNA (dsRNA) to specifically degrade complementary mRNA.

[0003] Positive references play a crucial role in RNAi experiments. They verify the effectiveness of the experimental system and ensure the accuracy and reliability of the experimental results. However, in actual operations, significant differences in gene expression have been found between various cell types and tissues. Different cell types, such as immune cells, neural cells, and epithelial cells, each have unique gene expression profiles. Even under the same experimental conditions, these cells respond differently to RNAi treatment. Similarly, samples from different tissue sources show rich diversity in gene expression levels and regulatory mechanisms. This variability in gene expression leads to a lack of suitable positive references for different cells or tissues. This dilemma limits the reproducibility of RNAi experimental results and poses a challenge to researchers in conducting accurate gene function studies in different cell and tissue models. New solutions and methods are urgently needed. Summary of the Invention

[0004] Therefore, the technical problem to be solved by the present invention is to provide an siRNA, a conjugate and an inhibitor for inhibiting the expression of the GAPDH gene and uses thereof.

[0005] To this end, the present invention provides the following technical solutions:

[0006] An embodiment of the present invention discloses an siRNA for inhibiting GAPDH gene expression, wherein the siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence a, and the antisense strand comprises a nucleotide sequence b, wherein the nucleotide sequence a and the nucleotide sequence b are at least partially reverse-complementary to form a double-stranded region, wherein the nucleotide sequence a and the nucleotide sequence b are selected from the following sequences:

[0007] (1) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 1, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 2;

[0008] (2) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 3, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 4;

[0009] (3) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 5, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 6;

[0010] (4) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 7, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 8;

[0011] (5) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 9, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 10;

[0012] (6) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 11, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 12;

[0013] (7) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 13, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 14;

[0014] (8) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 15, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 16;

[0015] (9) The nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 17, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 18.

[0016] In some embodiments, at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide, and / or at least one phosphate group is a phosphate group having a modified group.

[0017] In some embodiments, the phosphate group having a modified group is a phosphorothioate group formed by replacing one oxygen atom in the phosphodiester bond of the phosphate group with a sulfur atom.

[0018] In some embodiments, each nucleotide in the sense strand or the antisense strand is independently a 2'-fluoro-modified nucleotide or a non-fluoro-modified nucleotide;

[0019] Optionally, in the sense strand, from the 5' end to the 3' end, the 2'-fluoro-modified nucleotides are located at positions 5, 7, 8 and 9, and the remaining positions are non-fluoro-modified nucleotides;

[0020] In the antisense strand, from the 5' end to the 3' end, 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16, and the remaining positions are non-fluoro-modified nucleotides.

[0021] In some embodiments, each nucleotide in the sense strand or the antisense strand is independently at least one of a 2'-fluoro-modified nucleotide and a 2'-methoxy-modified nucleotide;

[0022] Optionally, in the sense strand, from the 5' end to the 3' end, 2'-fluoro-modified nucleotides are located at positions 5, 7, 8, and 9, and the remaining positions are 2'-methoxy-modified nucleotides;

[0023] In the antisense strand, from the 5' end to the 3' end, 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16, and the remaining positions are 2'-methoxy modified nucleotides.

[0024] In some embodiments, in the direction from the 5' end to the 3' end, at least the 1st and 2nd positions, and the 2nd and 3rd positions in the sense strand are linked by a thiophosphate group; in the direction from the 5' end to the 3' end, at least the 1st and 2nd positions, the 2nd and 3rd positions, the 19th and 20th positions, and the 20th and 21st positions in the antisense strand are linked by a thiophosphate group.

[0025] An embodiment of the present invention discloses an siRNA conjugate, wherein the siRNA conjugate contains the aforementioned siRNA for inhibiting GAPDH gene expression and a conjugated group conjugated to the siRNA for inhibiting GAPDH gene expression.

[0026] In some embodiments, the conjugate group comprises a pharmaceutically acceptable targeting group, and the siRNA and the targeting group are covalently or non-covalently linked;

[0027] Optionally, the targeting group is selected from:

[0028]

[0029] The embodiment of the present invention discloses an inhibitor of GAPDH gene expression, comprising the aforementioned siRNA for inhibiting GAPDH gene expression, or the aforementioned siRNA conjugate, and a pharmaceutically acceptable carrier.

[0030] The present invention discloses the use of the aforementioned siRNA for inhibiting GAPDH gene expression, or the aforementioned siRNA conjugate, or the aforementioned inhibitor of GAPDH gene expression in any of the following uses:

[0031] (1) Use in the preparation of drugs for diseases related to GAPDH gene expression;

[0032] (2) Use as or in the preparation of a positive reference;

[0033] Optionally, the positive reference is a positive reference of embryonic kidney cells, hepatocellular carcinoma cells, or liver tissue. Further, the embryonic kidney cells are 293T cells. The hepatocellular carcinoma cells are Hep3B cells.

[0034] The technical solution of the present invention has the following advantages:

[0035] 1. The present invention provides an siRNA for inhibiting GAPDH gene expression, wherein the siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence a, and the antisense strand comprises a nucleotide sequence b, wherein the nucleotide sequence a and the nucleotide sequence b are at least partially reverse-complementary to form a double-stranded region, wherein the nucleotide sequence a and the nucleotide sequence b are selected from the following sequences: SEQ ID NO. 1-SEQ ID NO.18; In the above scheme, the present invention specifically selects the GAPDH gene as a reference gene. The GAPDH gene is widely present in cells and tissues, such as the GAPDH gene is present in embryonic kidney cells, liver cancer cells or liver tissues. The present invention designs a specific siRNA that inhibits the expression of the GAPDH gene based on the gene, which has an inhibitory effect on the expression of the GAPDH gene in cells and tissues. Therefore, it can be used as a universal positive reference applicable to various cells and tissues, and can ensure the repeatability, accuracy and reliability of RNAi experimental results, especially suitable for embryonic kidney cells, liver cancer cells or liver tissues, and has an obvious high inhibition rate on GAPDH gene expression in embryonic kidney cells, liver cancer cells or liver tissues. Therefore, it can be used as a positive reference for embryonic kidney cells, liver cancer cells or liver tissues, and can ensure the repeatability of RNAi experimental results for embryonic kidney cells, liver cancer cells or liver tissues, and can verify the effectiveness of the experimental system and ensure the accuracy and reliability of the experimental results.

[0036] 2. The present invention provides a siRNA conjugate for inhibiting GAPDH gene expression. In the above scheme, the present invention specifically selects the GAPDH gene as a reference gene, and designs a specific siRNA conjugate for inhibiting GAPDH gene expression based on the gene, which has an inhibitory effect on GAPDH gene expression in cells and tissues. Therefore, it can be used as a universal positive reference suitable for various cells and tissues, and can ensure the repeatability, accuracy and reliability of RNAi experimental results. It is especially suitable for embryonic kidney cells, liver cancer cells or liver tissues, and has a significantly high inhibition rate on GAPDH gene expression in embryonic kidney cells, liver cancer cells or liver tissues. It can be used as a positive reference for embryonic kidney cells, liver cancer cells or liver tissues, which ensures the repeatability of RNAi experimental results for embryonic kidney cells, liver cancer cells or liver tissues, verifies the effectiveness of the experimental system, and ensures the accuracy and reliability of the experimental results. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0038] Figure 1 This is the result of the 293T cell screening test in Experimental Example 1 of the present invention;

[0039] Figure 2 This is the result of the in vivo screening experiment on C57 mice in Experimental Example 2 of the present invention;

[0040] Figure 3 is the IC50 of H-GAPDH006M in Hep3B cells in Experimental Example 3 of the present invention;

[0041] Figure 4 This is the self-absorption test of H-GAPDH004M in Hep3B cells in Experimental Example 3 of the present invention. DETAILED DESCRIPTION

[0042] The following examples are provided for a better understanding of the present invention and are not intended to limit the best mode of implementation. They do not limit the content and scope of protection of the present invention. Any product identical or similar to the present invention obtained by anyone under the guidance of the present invention or by combining the features of the present invention with other prior arts shall fall within the scope of protection of the present invention.

[0043] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in this field can be used. If the manufacturer of the reagents or instruments is not specified, they are all commercially available conventional reagents.

[0044] Example 1 A siRNA for inhibiting GAPDH gene expression

[0045] This example provides an siRNA for inhibiting GAPDH gene expression. The nucleotide sequence of the siRNA was designed based on positions NM_002046.7, NM_008084.4, and NM_017008.4, as shown in Table 1. The sequence was synthesized by Suzhou Genetron Health Co., Ltd.

[0046] Table 1. siRNA design

[0047]

[0048] Example 2 A siRNA for inhibiting GAPDH gene expression

[0049] This example provides an siRNA for inhibiting GAPDH gene expression. The siRNA was modified based on Example 1, and the modified sequence was synthesized by Suzhou GeneGene Co., Ltd. See the table below (the base sequences of the sense and antisense strands of H-GAPDH001M-H-GAPDH009M before modification correspond to the sense and antisense strands of H-GAPDH001-H-GAPDH009 in Table 1 of Example 1, respectively):

[0050] Table 2. Modified siRNA

[0051]

[0052] In the above table, capital letters C, G, U, and A represent ribonucleotides; lowercase letter m indicates that the nucleotide adjacent to the left of the letter m is a 2'-methoxy-modified nucleotide; lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a 2'-fluoro-modified nucleotide; lowercase letter s indicates that the nucleotides adjacent to the left and right of the letter s are modified with a phosphorothioate group.

[0053] Example 3 A siRNA conjugate for inhibiting GAPDH gene expression

[0054] This embodiment provides a siRNA conjugate for inhibiting GAPDH gene expression, comprising the following steps:

[0055] The siRNA in Example 2 was coupled to the conjugated group GalNAc, which was covalently coupled to the 3' end of the sense strand of the siRNA. The exemplary structural formula of the resulting conjugate is as follows:

[0056]

[0057] The preparation method is:

[0058] Alnylam Pharmaceuticals, Inc. first reported that siRNA based on GalNAc conjugation technology exerted interference activity in mice (Nair et al., J. Am. Chem. Soc., 2014, 136, 16958-16961). The literature reported that siRNA conjugated to three clusters of GalNAc exhibited good delivery activity in both in vivo and in vitro experiments, referring to the preparation method in the above literature.

[0059] The obtained conjugates are shown in the table below:

[0060] Table 3. siRNA conjugates

[0061]

[0062]

[0063] The siRNA in Example 2 was coupled to the conjugated group Chol, which is cholesterol and has the following structural formula:

[0064]

[0065] The preparation method is:

[0066] The siRNA in Example 2 was coupled to the conjugated group Chol using conventional siRNA and conjugated group Chol conjugation technology. The conjugated group Chol was covalently coupled to the 3' end or 5' end of the sense strand of the siRNA. The obtained conjugate can be synthesized by conventional biosynthesis companies such as Suzhou Jima Co., Ltd.

[0067] 4. siRNA conjugates

[0068]

[0069]

[0070] Experimental Example 1

[0071] 293T cells (293T [HEK-293T] (human embryonic kidney cells), purchased from Wuhan Punosai Life Science Technology Co., Ltd., product number: CL-0005) cultured in 10 cm culture dishes were routinely trypsinized 48 hours after passage. Resuspend in complete medium and dilute 293T to 3×10 5 pieces / mL.

[0072] Lipofectamine RNAiMAX (purchased from Thermo Fisher Scientific, catalog number 11668-019) was used to transfect siRNA. The specific steps are as follows:

[0073] (1) Use opti-MEM (purchased from Gibco, catalog number 31985-070) to dilute different siRNAs (see Table 2) to obtain siRNA dilution solutions containing different siRNAs at different concentrations;

[0074] (2) Mix 25 μL of opti-MEM with 0.25 μL of Lipofectamine RNAiMAX transfection reagent (purchased from Thermo Fisher Scientific, catalog number 11668-019) to obtain transfection dilution solution;

[0075] (3) 25 μL of siRNA dilution solution containing different siRNAs were mixed with the transfection reagent dilution solution in step (2) and allowed to stand at room temperature (25°C) for 15 min to obtain transfection solutions containing different siRNAs;

[0076] (4) The cell suspension was inoculated into a 96-well plate at 50 μL / well. The experimental group was set up in the 96-well plate, H-GAPDH001M~H-GAPDH009M, and NC was set up as a control. The NC group was a negative control siRNA that was not related to GAPDH.

[0077] (5) 50 μL of transfection solution containing different siRNAs was added to the wells of the experimental group. The H-GAPDH001M group was given a transfection solution containing H-GAPDH001M, and so on. In each experimental group, the final concentration of siRNA was 50 nM, 10 nM or 1 nM, and three biological replicates were set for each siRNA at each concentration. 50 μL of transfection solution containing negative control siRNA unrelated to GAPDH was added to the wells of the control group. The final concentration of the siRNA was 50 nM, 10 nM or 1 nM, and three biological replicates were set for each siRNA at each concentration. Each group was cultured in a 5% (v / v) CO2, 37°C cell culture incubator for 48 h for transfection. After transfection, the culture medium was removed and the cells were collected for RNA extraction. Total RNA was extracted using a magnetic bead method cell total RNA extraction kit (Jima Gene-E31008-96) according to the instructions.

[0078] Follow the steps below to perform qPCR to detect GAPDH gene expression levels.

[0079] (1) RNA template preparation

[0080] Genomic DNA removal: Add samples according to the order in the table below and mix thoroughly by gently pipetting. Incubate at 42°C for 2 minutes.

[0081] Table 5. Genome removal reaction system

[0082] Reaction solution Single reaction dosage 4×gDNA wiper mix 4μL RNA 12 μL

[0083] (2) Reverse transcription

[0084] Prepare a first-strand cDNA synthesis reaction solution (20 μL total) and mix thoroughly by gently pipetting. Incubate at 50°C for 15 minutes and then at 85°C for 2 minutes. After reverse transcription, dilute the cDNA 5-fold for PCR analysis and store at -20°C until needed (or at 4°C for short-term storage).

[0085] Table 6. cDNA synthesis reaction system

[0086] Reaction solution Single reaction dosage 5×RT Mix 4 μL The mixture from the previous step 16μL

[0087] (3) RT-qPCR reaction system

[0088] Table 7. RT-qPCR probe reaction system

[0089]

[0090]

[0091] Table 8. Primer information

[0092] name Sequence 5'-3' hACTB-F CAGAGCCTCGCCTTTGCC hACTB-R ACCATCACGCCCTGGTGC mACTB-F CACTGTCGAGTCGCGTCC mACTB-R TCATCCATGGCGAACTGGTG mGAPDH-F AGGTCGGTGTGAACGGATTTG mGAPDH-R TGTAGACCATGTAGTTGAGGTCA hGAPDH-F AGGTCGGAGTCAACGGATTT hGAPDH-R TGGAATTTGCCATGGGTGGA

[0093] In the above table, the initial letter "h" in the primer name indicates human origin, and "m" indicates mouse origin. The ATCB gene is the target gene of the control group.

[0094] exist Quantitative PCR reactions were performed on the 480II. Data were analyzed using the ΔΔCt method and normalized to the control group to calculate relative fold change. Note: The control group mean represents the average of triplicate wells in the control group.

[0095] ΔCt(test group)=Ct(test group target gene)-Ct(test group internal reference gene);

[0096] ΔCt(control group)=Ct(control group target gene)-Ct(control group internal reference gene);

[0097] ΔΔCt(test group)=ΔCt(test group)-ΔCt(average of control group);

[0098] ΔΔCt(control group)=ΔCt(control group)-ΔCt(control group average);

[0099] The expression level of GAPDH mRNA in the test group was normalized with the control group as the benchmark, and the expression level of GAPDH mRNA in the control group was defined as 100%.

[0100] The relative expression level of GAPDH mRNA in the test group = 2 -ΔΔCt(测试组) ×100%.

[0101] Test group gene: GAPDH gene, internal reference gene: ACTB gene.

[0102] For the same test group siRNA, the average relative expression level of GAPDH mRNA in the test group at each concentration is the arithmetic mean of the relative expression levels of three culture wells at that concentration.

[0103] The inhibition rate of siRNA on GAPDH mRNA expression was calculated according to the following equation: inhibition rate = (1-relative expression level of GAPDH mRNA in the test group) × 100%. The results are shown in the following table and some of the results are shown in Figure 1 , it can be concluded that H-GAPDH001M~H-GAPDH005M still have a good inhibitory effect at a concentration of 1nM, especially the sequences H-GAPDH002M and H-GAPDH004M, whose inhibition rates in 293T cells are ≥90%.

[0104] The inhibition rate of each group = (1-GAPDH mRNA relative expression level) × 100%.

[0105] Table 9. Relative expression levels of GAPDH mRNA in 293T cells by different siRNAs

[0106]

[0107] Experimental Example 2

[0108] This experimental example provides a single-dose study of modified siRNA in mice at a dose level of 9 mg / kg. The experimental sequence was H-GAPDH003MG, H-GAPDH006MG, H-GAPDH007MG, H-GAPDH008MG, and H-GAPDH009MG. The groups were H-GAPDH003MG, H-GAPDH006MG, H-GAPDH007MG, H-GAPDH008MG, and H-GAPDH009MG, as well as a control group (normal saline). The experimental procedure was as follows:

[0109] Four C57BL / 6J mice (female, 6-8 weeks old) in each group were subcutaneously administered a single dose of 9 mg / kg of GalNAc-conjugated siRNA or saline as a control.

[0110] On day 14 after administration, the mice were sacrificed, liver samples were collected and snap-frozen in liquid nitrogen, and liver mRNA was extracted and analyzed by RT-qPCR. The RT-qPCR detection steps were as follows:

[0111] Step 1: RNA extraction:

[0112] 1) 20 mg of mouse liver tissue was collected and lysed by adding 1 mL of Trizol Lysis Buffer (Life Technologies, Cat. No. 410701). The tissue was then ground and lysed. The completely dissolved mixture was transferred to an RNase-free 1.5 mL centrifuge tube. The mixture was shaken vigorously for approximately 15 seconds to fully lyse the tissue cells and allowed to stand at room temperature (25°C) for 5 minutes.

[0113] 2) Carefully open the tube cap and add 200 μL of chloroform (purchased from Shanghai Lingfeng Chemical Reagent Co., Ltd., catalog number 20140925); shake vigorously for 20 seconds, let stand at room temperature (25°C) for 3 minutes; and centrifuge at 4°C, 12,000 × g, for 20 minutes.

[0114] 3) After centrifugation, carefully remove the centrifuge tube to a centrifuge tube rack, aspirate the supernatant aqueous phase into a new 2.0 mL centrifuge tube, add 1.5 times the volume of anhydrous ethanol (purchased from Jiangsu Qiangsheng Functional Chemical Co., Ltd., catalog number 20210802) of the supernatant aqueous phase, and mix by inversion.

[0115] 4) Add 700 μL of the mixture from step 3) to a purification column with a collection tube (purchased from VWI, catalog number 11822AG0627). Let stand for 2 minutes. Centrifuge at 4°C, 10,000 × g, for 1 minute, and discard the filtrate. Repeat the above steps with the remaining mixture.

[0116] 5) Add 700 μL of 80% (v / v) ethanol to the purification column, centrifuge at 10,000 × g at 4°C for 1 min, and discard the filtrate.

[0117] 6) Add 700 μL of 80% (v / v) ethanol to the purification column, centrifuge at 10,000 × g at 4°C for 1 min, and discard the filtrate.

[0118] 7) Centrifuge the column at 4°C, 10,000 × g for 2 min.

[0119] 8) After centrifugation, carefully remove the purification column with the collection tube (if there is liquid in the collection tube, be careful not to splash the liquid onto the purification column), discard the collection tube, place the purification column in a new 1.5 mL centrifuge tube, add 100 μL of DEPC water to the purification column, let it stand at room temperature (25°C) for 2 minutes, and then centrifuge at 4°C, 10,000 × g, for 1 minute.

[0120] 9) Collecting the RNA solution from step 8) for subsequent experiments;

[0121] Step 2: RNA reverse transcription

[0122] HiScript III RT SuperMix for qPCR (purchased from Novozymes, catalog number R323-01) was used according to the product instructions. A 20 μL reverse transcription reaction system was prepared according to the reverse transcription protocol in the kit instructions, and total cellular RNA was reverse transcribed. The reverse transcription conditions were as follows: the reverse transcription reaction system was incubated at 37°C for 15 min, followed by incubation at 85°C for 5 s. 80 μL of DEPC water was added to each reverse transcription reaction system to obtain a solution containing cDNA.

[0123] Step 3: RT-qPCR procedure refers to Experimental Example 1.

[0124] The experimental results are as follows Figure 2 As shown, it can be concluded that the relative inhibition level of H-GAPDH006MG in C57 mice is high, and GAPDH is knocked down by 75% in C57BL / 6J black mice.

[0125] Experimental Example 3

[0126] Referring to the cell transfection method in Experimental Example 1, H-GAPDH006M was transfected in Hep3B cells (human liver cancer cells, purchased from Wuhan Punosai Life Science Technology Co., Ltd., product number: CL-0102), except that the final transfection concentrations were 10nM, 1nM, 0.1nM, 0.01nM, 0.001nM, and 0.0001nM.

[0127] Draw a curve and get the IC50 value of siRNA. Figure 3 As shown, the IC50 of H-GAPDH006M is 2.5 pM.

[0128] Experimental Example 4

[0129] Three concentrations of self-absorption were tested in Hep3B cells for H-GAPDH004M-3Chol, H-GAPDH004M-5Chol, and the NC group. Chol represents cholesterol. The experimental steps were similar to those in Experimental Example 1, except that 293T cells were replaced with Hep3B cells in equal amounts, and siRNA was directly added to the culture medium without adding a transfection reagent. 0.25 μL of Lipofectamine RNAiMAX transfection reagent was omitted in step (2). The final concentrations of siRNA in this experiment were 1000 nM, 500 nM, and 10 nM.

[0130] The results are as follows Figure 4 As shown, it can be concluded that H-GAPDH004M-3Chol and H-GAPDH004M-5Chol produced better delivery effects at a concentration of 10 nM.

[0131] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. An siRNA for inhibiting GAPDH gene expression, characterized in that: The siRNA comprises a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleotide sequence a, and the antisense strand contains a nucleotide sequence b, and the nucleotide sequence a and the nucleotide sequence b are at least partially reverse-complementary to form a double-stranded region, wherein the nucleotide sequence a and the nucleotide sequence b are selected from the following sequences: (1) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 1, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 2; (2) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 3, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 4; (3) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 5, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 6; (4) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 7, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 8; (5) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 9, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 10; (6) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 11, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 12; (7) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 13, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 14; (8) the nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 15, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO: 16; (9) The nucleotide sequence a comprises the nucleotide sequence shown in SEQ ID NO: 17, and the nucleotide sequence b comprises the nucleotide sequence shown in SEQ ID NO:

18.

2. The siRNA for inhibiting GAPDH gene expression according to claim 1, wherein At least one nucleotide in the sense strand or the antisense strand is a modified nucleotide, and / or at least one phosphate group is a phosphate group having a modified group.

3. The siRNA for inhibiting GAPDH gene expression according to claim 2, wherein The phosphate group having a modified group is a thiophosphate group formed by replacing one oxygen atom in the phosphodiester bond of the phosphate group with a sulfur atom.

4. The siRNA for inhibiting GAPDH gene expression according to any one of claims 1 to 3, characterized in that Each nucleotide in the sense strand or the antisense strand is independently a 2'-fluoro-modified nucleotide or a non-fluoro-modified nucleotide; Optionally, in the sense strand, from the 5' end to the 3' end, the 2'-fluoro-modified nucleotides are located at positions 5, 7, 8 and 9, and the remaining positions are non-fluoro-modified nucleotides; In the antisense strand, from the 5' end to the 3' end, 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16, and the remaining positions are non-fluoro-modified nucleotides.

5. The siRNA for inhibiting GAPDH gene expression according to any one of claims 1 to 4, characterized in that Each nucleotide in the sense strand or the antisense strand is independently at least one of a 2'-fluoro-modified nucleotide and a 2'-methoxy-modified nucleotide; Optionally, in the sense strand, from the 5' end to the 3' end, 2'-fluoro-modified nucleotides are located at positions 5, 7, 8, and 9, and the remaining positions are 2'-methoxy-modified nucleotides; In the antisense strand, from the 5' end to the 3' end, 2'-fluoro modified nucleotides are located at positions 2, 6, 14 and 16, and the remaining positions are 2'-methoxy modified nucleotides.

6. The siRNA for inhibiting GAPDH gene expression according to any one of claims 1 to 5, characterized in that In the direction from the 5' end to the 3' end, at least the 1st and 2nd positions, and the 2nd and 3rd positions in the sense chain are connected by a thiophosphate group; in the direction from the 5' end to the 3' end, at least the 1st and 2nd positions, the 2nd and 3rd positions, the 19th and 20th positions, and the 20th and 21st positions in the antisense chain are connected by a thiophosphate group.

7. A siRNA conjugate, characterized in that The siRNA conjugate contains the siRNA for inhibiting GAPDH gene expression according to any one of claims 1 to 6 and a conjugated group conjugated to the siRNA for inhibiting GAPDH gene expression.

8. The siRNA conjugate according to claim 7, characterized in that The conjugate group comprises a pharmaceutically acceptable targeting group, and the siRNA and the targeting group are covalently or non-covalently linked; Optionally, the targeting group includes but is not limited to a conjugated group GalNAc or cholesterol; Optionally, the structural formula of the siRNA conjugate is as follows: 9 . An inhibitor of GAPDH gene expression, comprising the siRNA for inhibiting GAPDH gene expression according to any one of claims 1 to 6, or the siRNA conjugate according to claim 7 or 8, and a pharmaceutically acceptable carrier.

10. Use of the siRNA for inhibiting GAPDH gene expression according to any one of claims 1 to 6, or the siRNA conjugate according to claim 7 or 8, or the inhibitor of GAPDH gene expression according to claim 9 in any of the following: (1) Use in the preparation of drugs for diseases related to GAPDH gene expression; (2) Use as or in the preparation of a positive reference; Optionally, the positive reference is a positive reference of embryonic kidney cells, liver cancer cells or liver tissue.