MRNA probe for identifying chick embryo blood vessel based on LMO2 gene as well as preparation method and application of mRNA probe

Abstract

The invention discloses an mRNA probe for identifying chick embryo blood vessels based on an LMO2 gene as well as a preparation method and application of the mRNA probe. The nucleotide sequence of the mRNA probe is as shown in SEQ ID NO. 1. An LMO2 gene is selected as a specific blood vessel marker gene, and the expression of the LMO2 gene is detected through an mRNA-ISH method so as to accurately locate chick embryo blood vessels. In addition, by improving tissue treatment and permeabilization methods, the probe can effectively permeate into the whole chick embryo, and the comprehensiveness of blood vessel marking is ensured.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to an mRNA probe for identifying chicken embryo blood vessels based on the LMO2 gene, and a preparation method and application thereof. Background Art

[0002] mRNA in situ hybridization (mRNA-ISH), a mature molecular biology technique, has been widely used to study the spatial localization of gene expression. This technique utilizes probes complementary to the target mRNA, achieving specific binding through base pairing. Combined with fluorescent or enzymatic colorimetric systems, it visualizes the expression location of the target gene. mRNA-ISH offers high specificity and sensitivity, enabling accurate detection of specific gene transcription at the tissue or cellular level. However, in the field of chick embryo vascular labeling, there are currently no established mRNA-ISH methods for visualizing vascularization throughout the chick embryo. Existing studies have primarily focused on labeling in other model organisms (e.g., mice and zebrafish) or at the local tissue section level, while mRNA-ISH labeling of the intact chick embryo vasculature has yet to be reported.

[0003] The main obstacles to the application of this technology in chickens include: (1) the dynamic development characteristics of chicken embryo vascular requires that the probe can stably bind to specific vascular marker genes while providing clear information on the overall vascular distribution; (2) the traditional mRNA-ISH method has certain limitations in tissue permeability, signal amplification and background noise control, making it difficult to meet the labeling requirements of intact chicken embryo vascular systems; (3) there are currently no specific mRNA probes designed and applied for chicken embryo vascular systems, resulting in a blank state in the development of this technology in this field. Therefore, although mRNA-ISH technology has been widely used in gene expression research, there is still a lack of corresponding methods and practices in chicken embryo vascular labeling. To address this technical gap, it is urgent to develop a new vascular labeling method based on mRNA-ISH to achieve efficient and specific visualization of the intact chicken embryo vascular system, thereby providing a more intuitive technical means for the study of chicken embryo vascular development. Summary of the Invention

[0004] Technical problems to be solved: In response to the above technical problems, the present invention provides an mRNA probe for identifying chicken embryo blood vessels based on the LMO2 gene, as well as a preparation method and application thereof, which solves the problem of insufficient labeling of chicken embryo blood vessels in the existing technology and realizes efficient and specific visualization of the complete chicken embryo vascular system.

[0005] Technical solution: In the first aspect, the present invention provides an mRNA probe for identifying chicken embryo blood vessels based on the LMO2 gene. The positive nucleotide sequence of the mRNA probe is shown in SEQ ID NO.1. Specifically: SEQ ID NO.1 (5'-3'): GGUAGUACUAGUCUCAGGAUCCUCCUAGUCUCGGAUCAACUAGGAGGUCAUAGUGCUCCCGGAACGUGGAUGAAGUCCGCGCGUUUCAAUGCAAUGAGGUGAUAUGUGACUU UGGACUUGAGGUGCCCGCAUGGUCAGAGAUUAUGGGAACGGAUCCGGGCAUUGUAGUGGACUUCACAAAGUCUCCGGCCCGGCGUCUCGGCUUGGAGUCCUCUCCCGGCAGAGCUUCUGCCCGGG CAGCUUGUACAGGCGGCGGGCCACUCUCCCCCGGCAGUGCGGUGUCGCAGCUGAGGCAGUCCCUCAUGGUGGAUGAGCCUGUCCGGAUUCCAGGUUUAGCGGUCCCGAUGUUCUUGCUGGCAGCCC CCGCAUGUCAGCAGCGGGGGGGGAUCUGCAGCACCACUCAUCCACCGGCUCCUCGGAAGGAUGAGGCUCUUCCUCUCGAUGGCCGAUGACAUGGUCGGGAUGGUUGAACGCGUGCCUGUGUG.

[0006] In a second aspect, the present invention provides a method for preparing an mRNA probe for identifying chicken embryo blood vessels based on the LMO2 gene according to the first aspect, comprising the following steps: S1. Obtain the specific cDNA sequence of the LMO2 gene: Based on the CDS region sequence of the LMO2 gene from NCBI, specific primers were synthesized using Primer5 software. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3. Using chicken cDNA as a template, a specific fragment of the LMO2 gene was synthesized. Specifically: SEQ ID NO.2 (5'-3'): GGTAGTACTAGTCTCAGGATCC; SEQ ID NO.3 (5'-3'): CACACAGGCACGCTACGTTC; S2. Synthesis of LMO2 gene mRNA probe: S2-1. Obtaining LMO2 gene fragments with SP6 and U7 promoters: Use restriction endonucleases NcoI and MluI to digest the specific fragment of the LMO2 gene synthesized in step S1 and the pGEM-T-Easy vector. Ligate the linearized specific fragment of the LMO2 gene to the pGEM-T-Easy vector, and obtain the LMO2 gene fragment with the SP6 or T7 promoter by sequencing. S2-2. Synthesize sense and antisense probes: Use the LMO2 gene fragment with the SP6 or T7 promoter obtained in step S2-1 as a template, respectively, and use SP6 or T7 primers and a digoxigenin kit to synthesize mRNA probes labeled with digoxigenin. Subsequently, ethanol precipitation is used to purify the obtained mRNA probes, and the OD value of each mRNA probe is measured to ensure that the probe concentration is greater than 50 ng / μL.

[0007] Preferably, the ethanol precipitation method in step S2-2 comprises the following steps: adding 30 μL of enzyme-free water, 2.5 μL of 4 M lithium chloride, and 75 μL of pre-chilled anhydrous ethanol to the obtained mRNA probe solution and mixing the reaction mixture; incubating the mixture at a temperature not exceeding -60°C for at least 30 minutes, or at a temperature between -15°C and -25°C for 2 hours. The mixture is then centrifuged at 13,000 × g for 15 minutes at 4°C; the supernatant is removed, and the precipitate is washed with 50 μL of pre-chilled 70% ethanol; the mixture is centrifuged at 13,000 × g for 5 minutes, the upper ethanol layer is removed, and the precipitate is dried under vacuum; the precipitate is dissolved in 50 μL of RNase-free double-distilled water or UE buffer to a probe concentration of 0.1-1 μg / μL; the mixture is used immediately or stored at a temperature not exceeding -60°C.

[0008] Furthermore, the pre-cooling temperature of anhydrous ethanol and 70% ethanol is -15°C to -25°C.

[0009] In a third aspect, the present invention provides the use of the mRNA probe for identifying chicken embryo blood vessels based on the LMO2 gene described in the first aspect in marking chicken embryo blood vessels.

[0010] Preferably, the specific process of mRNA probe labeling chicken embryo blood vessels is as follows: a. Obtaining chicken embryos: Wipe the surface of the chicken embryo after incubation for 24 hours or 48 hours with 75% alcohol, then use tweezers to open the air chamber from the blunt end of the egg, carefully pour out the egg liquid, and remove the chicken embryo attached to the yolk membrane to ensure that the embryo is not damaged or wrinkled. Then wash it with PBS and fix it with 4% paraformaldehyde for 12 hours to obtain the fixed tissue; b. In situ hybridization steps: After fixation, the tissue is dehydrated in a gradient of methanol solutions and then washed three times in PBTX. The embryonic tissue is then digested with proteinase K in PBTX for a duration determined by the size of the embryo. The digested tissue is then washed multiple times in PBTX to remove the proteinase K and fixed again with 4% paraformaldehyde for 20 minutes. Next, the embryonic tissue is washed extensively in prehybridization buffer on a shaker at 65°C. After the prehybridization buffer has been in contact with the tissue for 2 hours, the solution is removed and the embryonic sample is transferred to hybridization buffer containing a labeled sense or antisense probe at a concentration of at least 250 ng / mL and incubated overnight. After hybridization, the embryonic tissue is rinsed extensively in a mixture of Solution 1 and SSC. The tissue is then equilibrated in TBTX at room temperature and blocked in 10% sheep serum-TBTX for 2 hours. 0.5 μL of an alkaline phosphatase-conjugated DIG antibody is diluted 1:2000 in 1 mL of 10% sheep serum-TBTX and added to the tissue, shaking overnight at 4°C. After washing the embryos with 0.1% fetal bovine serum / TBTX solution, 19 μL of NBT / BCIP color development solution was added to each ml of TBS and incubated in the dark for 3-5 h until color was developed.

[0011] Furthermore, the specific steps for obtaining a complete chicken embryo in step a are as follows: cutting a circle with a radius of 0.5-1 cm from the middle of the adsorption paper, and then gently sticking the adsorption paper on the vitelline membrane, and ensuring that the embryonic tissue is exposed in the circular hole; then cutting the vitelline membrane along the edge of the adsorption paper, using ophthalmic tweezers to peel off the adsorption paper, and the embryonic tissue together with the blastodisc is completely obtained from the vitelline membrane.

[0012] Furthermore, the gradient dehydration step of the methanol solution in step b was as follows: washing with PBTX twice, 5 minutes each time; washing with 25% methanol + 75% PBTX for 5 minutes; washing with 50% methanol + 50% PBTX for 5 minutes; washing with 75% methanol + 25% PBTX for 5 minutes; washing with methanol twice, 5 minutes each time; washing with 75% methanol + 25% PBTX for 5 minutes; washing with 50% methanol + 50% PBTX for 5 minutes; washing with 25% methanol + 75% PBTX for 5 minutes; washing with PBTX three times, 5 minutes each time.

[0013] Furthermore, the preparation process of PBTX is as follows: 0.1 mL of Triton X-100 solution is added to 49.9 mL of PBS.

[0014] Furthermore, proteinase K digestion treatment was performed by adding 1 mL of 10 μg / mL proteinase K to digest the embryonic tissue for 5 minutes.

[0015] Furthermore, the prehybridization solution included 50% formamide, 5× SSC, 0.1% UriUon X-100, 0.5% Chaps surfactant, 5 mM EDTA, 50 μg / mL heparin, 1 mg / mL yeast RNA, and 2% blocking powder.

[0016] Furthermore, the hybridization solution included 50% formamide, 5× SSC, 0.1% triton X-100, 0.5% Chaps surfactant, 5 mM EDTA, 50 μg / mL heparin, 1 mg / mL yeast RNA, 2% blocking powder and mRNA probe.

[0017] Furthermore, the SoluUion 1 solution includes 50% formamide, 5×SSC, 0.1% Triton X-100 and 0.5% surfactant Chaps.

[0018] Furthermore, the hybridized embryonic tissue was extensively rinsed in a mixture of Solution 1 and SSC as follows: the rinsing environment was 65°C, 75% Solution 1 + 25% 2×SSC for 5 minutes; 50% Solution 1 + 75% 2×SSC for 5 minutes; 25% Solution 1 + 75% 2×SSC for 5 minutes; 2×SSC-0.1% Chaps for 15 minutes; 2×SSC-0.1% Chaps for 15 minutes; 0.2×SSC-0.1% Chaps for 15 minutes; and 0.2×SSC-0.1% Chaps for 15 minutes.

[0019] Furthermore, TBTX includes 50 mM tris-HCl, 150 mM NaCl, and 0.1% Triton X-100, and the pH of the solution is 7.5.

[0020] Furthermore, TBS includes 100 mM sodium chloride and 100 mM tris-HCl, and the pH of the solution is 9.5.

[0021] Beneficial Effects: The mRNA probe of the present invention selects the LMO2 gene as a specific vascular marker gene, and its expression is detected by mRNA-ISH, allowing precise localization of blood vessels in chick embryos. Furthermore, improved tissue processing and permeabilization methods enable the probe to effectively penetrate the entire chick embryo, ensuring comprehensive vascular labeling. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is the specific fragment length of the LMO2 gene in Example 1 of the present invention; Figure 2 is the OD value of the antisense mRNA probe of the LMO2 gene in Example 1 of the present invention; Figure 3 This is a schematic diagram of blood vessels in a 48-hour chicken embryo labeled with the antisense mRNA probe of the LMO2 gene in Example 1 of the present invention; Figure 4 48h chicken embryos not labeled with mRNA probes in Example 1 of the present invention; Figure 5 This is a schematic diagram of blood vessels in a 24-hour chicken embryo labeled with the antisense mRNA probe of the LMO2 gene in Example 2 of the present invention; Figure 6 This is a 24h chicken embryo that was not labeled with an mRNA probe in Example 2 of the present invention. DETAILED DESCRIPTION

[0023] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments: Example 1

[0024] A method for labeling mRNA probes based on the LMO2 gene to identify blood vessels in 48-hour chicken embryos, comprising the following steps: S1. Extract total RNA from chicken embryos, reverse transcribe to obtain cDNA, and store at -20℃ for future use. According to the CDS region sequence of the LMO2 gene in NCBI, use Primer5 software to synthesize specific primers, where the upstream primer nucleotide sequence (5'-3'): GGTAGTACTAGTCTCAGGATCC, the downstream primer nucleotide sequence (5'-3'): CACACAGGCACGCTACGTTC. Use cDNA as a template for PCR amplification (use high-fidelity enzyme amplification to reduce mutations in gene sites). The amplified PCR product was analyzed by 2% gel electrophoresis to ensure that the obtained fragment length was correct. Figure 1 As shown, the target fragment of 486 bp in length was purified using a gel excision recovery kit to purify the PCR product.

[0025] S1-2. After gel excision, the specific fragments recovered were tailed at their 3' ends (incubated at 72°C for 20 minutes and placed on ice for 1-2 minutes) according to the Takala "A-tailing" kit. The tailed fragments were blunt-ended with the pGEM-T easy vector (Promega, Cat# PR-A1360). The cells were then transformed into competent E. coli cells and inoculated onto LB ampicillin agar plates. Full, independently growing colonies were selected and a portion was placed in LB medium and shaken for 12 hours. The bacterial suspension was then subjected to a plasmid miniprep and sequencing to ensure plasmid accuracy (ensuring that each gene could be ligated in either the forward or reverse orientation). Depending on the insertion direction of the gene fragment, the ends were cleaved with restriction enzymes T7 (New England Biolabs, Cat# M0207) / SP6 (New England Biolabs, Cat# M0251). Transcription was initiated by cleaving at one end and selecting the promoter sequence at the other end. The restriction endonuclease sites selected should be those that produce a 5' overhang to avoid 3' overhangs. In this example, NcoI and MluI sites were selected for restriction endonuclease digestion. After the plasmid is completely linearized, the DNA fragments are purified using a gel extraction kit, and the concentration of the purified linear DNA is preferably greater than 1 μg.

[0026] S1-3. According to the kit requirements, use T7 RNA polymerase and DIG labeling kit to synthesize an antisense RNA probe, the nucleotide sequence of which is: CACACAGGCACGCGUUCAACCAUCCCGACCAUGUCAUCGGCCAUCGAGAGGAAGAGCCUCAUCCUUCCGAGUGAGCCGGUGGAUGAGUGGUGCUGCAGAUCCCCCCCCUCGCUGCUGACAU GCGGGGGCUGCCAGCAAGAACAUCGGGACCGCUAAACCUGGAAUCCGGACAGGCUCAUCCACCAUGAGGACUGCCUCAGCUGCGACACCGCACUGCCGGGGGAGAGUGGCCCGCCGCCTGUA The 20 μL synthesis system includes: 1 μg of purified linearized plasmid DNA, 2 μL of 10× DIG RNA Labeling Mix, 2 μL of 10× transcription buffer, and 0.8 μL of T7 RNA polymerase. The remaining volume is made up to 20 μL with enzyme-free water. Mix the system thoroughly and briefly centrifuge. Incubate in a water bath (37°C) for 2 hours. Subsequently, 2 μL of 0.2 mol / L EDTA (pH 8.0) was added to terminate the reaction.

[0027] S1-4. Purify the obtained mRNA probe according to the requirements of the ethanol precipitation method. Add 30 μL of enzyme-free water, 2.5 μL of 4M lithium chloride and 75 μL of pre-cooled anhydrous ethanol (-15°C to -25°C) to the above 22 μL reaction solution, and mix the reactants evenly. Let stand at -80°C for 30 minutes. Then centrifuge at 13000×g (12000rpm) for 15 minutes at 4°C. Aspirate the supernatant and wash the precipitate with 50 μL of pre-cooled 70% ethanol (-15°C to -25°C), centrifuge at 13000×g (12000rpm) for 5 minutes, aspirate the upper layer of ethanol, and briefly dry the precipitate under vacuum (dry thoroughly). Dissolve the precipitate in 50 μL of RNase-free double-distilled water or UE buffer to a probe concentration of 0.1-1 μg / μL, as shown in Figure 5. Figure 2As shown in FIG, the OD value of the obtained mRNA probe was 146 ng / μL. Finally, the probe was stored at -80°C.

[0028] S2. Wipe the surface of the 48-hour-incubated chicken embryo with 75% alcohol. Then, use tweezers to open the air chamber from the blunt end of the egg and carefully pour out the egg liquid. Cut a circle with a radius of 1 cm from the center of the adsorption paper, and then gently stick the adsorption paper on the vitelline membrane, ensuring that the embryonic tissue is exposed in the circular hole. Then, cut the vitelline membrane along the edge of the adsorption paper, and use ophthalmic tweezers to peel off the adsorption paper. The embryonic tissue and the blastoderm are completely removed from the vitelline membrane. Finally, wash with PBS and fix with 4% paraformaldehyde for 12 hours.

[0029] S3. Wash the fixed tissue with varying gradients of methanol-PBTX. Specific washes in PBTX (PBS + 0.1% Triton X-100) include: two 5-minute PBTX washes; 5-minute washes with 25% methanol + 75% PBTX; 5-minute washes with 50% methanol + 50% PBTX; 5-minute washes with 75% methanol + 25% PBTX; two 5-minute methanol washes; 5-minute washes with 75% methanol + 25% PBTX; 5-minute washes with 50% methanol + 50% PBTX; 5-minute washes with 25% methanol + 75% PBTX; and three 5-minute PBTX washes. Digest the sample with proteinase K (10 μg / mL) in PBTX for 5 minutes. To 10 mL of PBTX, add 10 μL of 10 mg / mL proteinase K for a final concentration of 10 μg / mL. The specific digestion time depends on the size of the sample and should be completed when the sample becomes somewhat transparent and the edges are blurred. Quickly aspirate the sample after digestion. The samples were washed three times with PBTX for 5 minutes each, then fixed briefly with freshly prepared 4% paraformaldehyde for 20 minutes, and finally eluted three times with PBUX for 5 minutes each.

[0030] S4. Wash the sample treated in step S2 in prehybridization solution for 10 minutes. Subsequently, wash the embryo sample in prehybridization solution on a shaker at 65°C for 2 hours. The prehybridization solution contains: 50% formamide, 5× SSC, 0.1% Triton X-100, 0.5% Chaps, 5mM EDTA, 50μg / mL Heparin, 1mg / mL yeast RNA, and 2% blocking powder. Then, remove the prehybridization solution and transfer the embryo sample to hybridization solution containing a labeled antisense probe at a concentration of at least 250ng / mL and incubate overnight at 65°C. The incubation period is typically 12-16 hours. After incubation, samples were rigorously washed at 65°C and rinsed with a mixture of Solution 1 and SSC. The specific process included: 75% Solution 1 / 25% 2× SSC for 5 minutes; 50% Solution 1 / 75% 2× SSC for 5 minutes; 25% Solution 1 / 75% 2× SSC for 5 minutes; 2× SSC-0.1% Chaps for 15 minutes; 2× SSC-0.1% Chaps for 15 minutes; 0.2× SSC-0.1% Chaps for 15 minutes; and 0.2× SSC-0.1% Chaps for 15 minutes. The specific composition of Solution 1 is: 50% formamide, 5× SSC, 0.1% Triton X-100, and 0.5% Chaps. After washing, the samples were equilibrated in TBTX (50 mM Tris-HCl, 150 mM NaCl, and 0.1% Triton X-100, pH 7.5), washed twice at room temperature for 5 minutes each, and finally blocked in 10% sheep serum-TBTX for 2-3 hours.

[0031] S5. Add 0.5 μL of DIG antibody conjugated with alkaline phosphatase to each mL of 10% sheep serum-TBTX solution at a ratio of 1:2000, add it to the tissue, and shake at 4°C overnight.

[0032] S6. Aspirate the antibody reaction solution and wash the embryo sample five times in 0.1% sheep serum-TBTX solution for 10 minutes each. Subsequently, wash the embryo in 0.1% fetal bovine serum-TBTX solution at 4°C for 3-4 hours. Rinse the embryo sample twice in TBTX solution at room temperature for 10 minutes each. Next, rinse the sample three times in TBS solution (100mM sodium chloride and 100mM Tris-HCl, pH 9.5) for 5 minutes each. Carefully aspirate the TBS rinse solution and add freshly prepared color development solution, NBT / BCIP-TBS, at a concentration of 19μL per mL of TBS. Incubate with shaking, covered with tin foil, protected from light, for approximately 1-3 hours. The color development time depends on the mRNA expression level in the sample; higher expression levels result in faster color development.

[0033] S7. After successful color development, remove the color development solution and place the embryo sample in TBS solution for 10 minutes, then place it in PBTX solution for 15 minutes. Figure 3 As shown in the figure, the blood vessels and heart outline of the 48h embryo are marked with blue-purple by the probe, and the entire blood circulation system is clearly visible. Figure 4 Finally, the embryos were washed in 1% Triton X-100 solution for 10 minutes each time to reduce the background color until the washing solution became colorless and transparent. Example 2

[0034] A method for labeling mRNA probes based on the LMO2 gene to identify blood vessels in 24-hour chicken embryos, comprising the following steps: S1. Extract total RNA from chicken embryos, reverse transcribe to obtain cDNA, and store at -20℃ for future use. According to the CDS region sequence of the LMO2 gene in NCBI, use Primer5 software to synthesize specific primers, where the upstream primer nucleotide sequence (5'-3'): GGTAGTACTAGTCTCAGGATCC, the downstream primer nucleotide sequence (5'-3'): CACACAGGCACGCTACGTTC. Use cDNA as a template for PCR amplification (use high-fidelity enzyme amplification to reduce mutations in gene sites). The amplified PCR product was analyzed by 2% gel electrophoresis to ensure that the obtained fragment length was correct. Figure 1 As shown, the target fragment of 486 bp in length was purified using a gel excision recovery kit to purify the PCR product.

[0035] S1-2. After gel excision, the specific fragments recovered were tailed at their 3' ends (incubated at 72°C for 20 minutes and placed on ice for 1-2 minutes) according to the Takala "A-tailing" kit. The tailed fragments were blunt-ended with the pGEM-T easy vector (Promega, Cat# PR-A1360). The cells were then transformed into competent E. coli cells and inoculated onto LB ampicillin agar plates. Full, independently growing colonies were selected and a portion was placed in LB medium and shaken for 12 hours. The bacterial suspension was then subjected to a plasmid miniprep and sequencing to ensure plasmid accuracy (ensuring that each gene could be ligated in either the forward or reverse orientation). Depending on the insertion direction of the gene fragment, the ends were cleaved with restriction enzymes T7 (New England Biolabs, Cat# M0207) / SP6 (New England Biolabs, Cat# M0251). Transcription was initiated by cleaving at one end and selecting the promoter sequence at the other end. The restriction endonuclease sites selected should be those that produce a 5' overhang to avoid 3' overhangs. In this example, NcoI and MluI sites were selected for restriction endonuclease digestion. After the plasmid is completely linearized, the DNA fragments are purified using a gel extraction kit, and the concentration of the purified linear DNA is preferably greater than 1 μg.

[0036] S1-3. According to the kit requirements, use T7 RNA polymerase and DIG labeling kit to synthesize an antisense RNA probe, the nucleotide sequence of which is: CACACAGGCACGCGUUCAACCAUCCCGACCAUGUCAUCGGCCAUCGAGAGGAAGAGCCUCAUCCUUCCGAGUGAGCCGGUGGAUGAGUGGUGCUGCAGAUCCCCCCCCUCGCUGCUGACAU GCGGGGGCUGCCAGCAAGAACAUCGGGACCGCUAAACCUGGAAUCCGGACAGGCUCAUCCACCAUGAGGACUGCCUCAGCUGCGACACCGCACUGCCGGGGGAGAGUGGCCCGCCGCCTGUA The 20 μL synthesis system includes: 1 μg of purified linearized plasmid DNA, 2 μL of 10× DIG RNA Labeling Mix, 2 μL of 10× transcription buffer, and 0.8 μL of T7 RNA polymerase. The remaining volume is made up to 20 μL with enzyme-free water. Mix the system thoroughly and briefly centrifuge. Incubate in a water bath (37°C) for 2 hours. Subsequently, 2 μL of 0.2 mol / L EDTA (pH 8.0) was added to terminate the reaction.

[0037] S1-4. Purify the obtained mRNA probe according to the requirements of the ethanol precipitation method. Add 30 μL of enzyme-free water, 2.5 μL of 4M lithium chloride and 75 μL of pre-cooled anhydrous ethanol (-15°C to -25°C) to the above 22 μL reaction solution, and mix the reactants evenly. Let stand at -80°C for 30 minutes. Then centrifuge at 13000×g (12000rpm) for 15 minutes at 4°C. Aspirate the supernatant and wash the precipitate with 50 μL of pre-cooled 70% ethanol (-15°C to -25°C), centrifuge at 13000×g (12000rpm) for 5 minutes, aspirate the upper layer of ethanol, and briefly dry the precipitate under vacuum (dry thoroughly). Dissolve the precipitate in 50 μL of RNase-free double-distilled water or UE buffer to a probe concentration of 0.1-1 μg / μL, as shown in Figure 5. Figure 2As shown in FIG, the OD value of the obtained mRNA probe was 146 ng / μL. Finally, the probe was stored at -80°C.

[0038] S2. Wipe the surface of the 24-hour-incubated chicken embryo with 75% alcohol. Then, use tweezers to open the air chamber from the blunt end of the egg and carefully pour out the egg liquid. Cut a circle with a radius of 1 cm from the center of the adsorption paper, and then gently stick the adsorption paper on the vitelline membrane, ensuring that the embryonic tissue is exposed in the circular hole. Then, cut the vitelline membrane along the edge of the adsorption paper, and use ophthalmic tweezers to peel off the adsorption paper. The embryonic tissue and the blastoderm are completely removed from the vitelline membrane. Finally, wash with PBS and fix with 4% paraformaldehyde for 12 hours.

[0039] S3. Wash the fixed tissue with varying gradients of methanol-PBTX. Specific washes in PBTX (PBS + 0.1% Triton X-100) include: two 5-minute PBTX washes; 5-minute washes with 25% methanol + 75% PBTX; 5-minute washes with 50% methanol + 50% PBTX; 5-minute washes with 75% methanol + 25% PBTX; two 5-minute methanol washes; 5-minute washes with 75% methanol + 25% PBTX; 5-minute washes with 50% methanol + 50% PBTX; 5-minute washes with 25% methanol + 75% PBTX; and three 5-minute PBTX washes. Digest the sample with proteinase K (10 μg / mL) in PBTX for 5 minutes. To 10 mL of PBTX, add 10 μL of 10 mg / mL proteinase K for a final concentration of 10 μg / mL. The specific digestion time depends on the size of the sample and should be completed when the sample becomes somewhat transparent and the edges are blurred. Quickly aspirate the sample after digestion. The samples were washed three times with PBTX for 5 minutes each, then fixed briefly with freshly prepared 4% paraformaldehyde for 20 minutes, and finally eluted three times with PBTX for 5 minutes each.

[0040] S4. Wash the sample treated in step S2 in prehybridization solution for 10 minutes. Subsequently, wash the embryo sample in prehybridization solution on a shaker at 65°C for 2 hours. The prehybridization solution contains: 50% formamide, 5× SSC, 0.1% Triton X-100, 0.5% Chaps, 5mM EDTA, 50μg / mL Heparin, 1mg / mL yeast RNA, and 2% blocking powder. Then, remove the prehybridization solution and transfer the embryo sample to hybridization solution containing a labeled antisense probe at a concentration of at least 250ng / mL and incubate overnight at 65°C. The incubation period is typically 12-16 hours. After incubation, samples were rigorously washed at 65°C and rinsed with a mixture of Solution 1 and SSC. The specific process included: 75% Solution 1 / 25% 2× SSC for 5 minutes; 50% Solution 1 / 75% 2× SSC for 5 minutes; 25% Solution 1 / 75% 2× SSC for 5 minutes; 2× SSC-0.1% Chaps for 15 minutes; 2× SSC-0.1% Chaps for 15 minutes; 0.2× SSC-0.1% Chaps for 15 minutes; and 0.2× SSC-0.1% Chaps for 15 minutes. The specific composition of Solution 1 is: 50% formamide, 5× SSC, 0.1% Triton X-100, and 0.5% Chaps. After washing, the samples were equilibrated in TBTX (50 mM Tris-HCl, 150 mM NaCl, and 0.1% Triton X-100, pH 7.5), washed twice at room temperature for 5 minutes each, and finally blocked in 10% sheep serum-TBTX for 2-3 hours.

[0041] S5. Add 0.5 μL of DIG antibody conjugated with alkaline phosphatase to each mL of 10% sheep serum-TBTX solution at a ratio of 1:2000, add it to the tissue, and shake at 4°C overnight.

[0042] S6. Aspirate the antibody reaction solution and wash the embryo sample five times in 0.1% sheep serum-TBTX solution for 10 minutes each. Subsequently, wash the embryo in 0.1% fetal bovine serum-TBTX solution at 4°C for 3-4 hours. Rinse the embryo sample twice in TBTX solution at room temperature for 10 minutes each. Next, rinse the sample three times in TBS solution (100mM sodium chloride and 100mM Tris-HCl, pH 9.5) for 5 minutes each. Carefully aspirate the TBS rinse solution and add freshly prepared color development solution, NBT / BCIP-TBS, at a concentration of 19μL per mL of TBS. Incubate with shaking, covered with tin foil, protected from light, for approximately 1-3 hours. The color development time depends on the mRNA expression level in the sample; higher expression levels result in faster color development.

[0043] S7. After successful color development, remove the color development solution and place the embryo sample in UBS solution for 10 minutes, then place it in PBTX solution for 15 minutes. Figure 5 As shown, the early vascular endothelial cells of 24h chicken embryos were labeled with blue-purple by the probe, while Figure 6 Finally, the embryos were washed in 1% Triton X-100 solution for 10 min each time to reduce the background color until the washing solution became colorless and transparent.

[0044] Conclusion: The present invention has the advantages of high sensitivity and high specificity, and can visually present the vascular network structure at the level of intact chicken embryos, providing reliable methodological support for the study of chicken embryo vascular development, and has important scientific research value and application prospects.

[0045] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. An mRNA probe for identifying chicken embryo blood vessels based on the LMO2 gene, characterized in that: The nucleotide sequence of the mRNA probe is shown in SEQ ID NO.

1.

2. A method for preparing an mRNA probe for identifying chicken embryo blood vessels based on the LMO2 gene according to claim 1, characterized in that: The following steps are involved: S1. Obtain the specific cDNA sequence of the LMO2 gene: Based on the CDS region sequence of the LMO2 gene in NCBI, specific primers were synthesized using Primer5 software. The nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3. Chicken cDNA was used as a template to synthesize a specific fragment of the LMO2 gene. S2. Synthesis of LMO2 gene mRNA probe: S2-1. Obtain the LMO2 gene fragment with SP6 and T7 promoters: Ligate the cDNA sequence synthesized in step S1 to the pGEM-T-Easy vector and identify the ligation direction by sequencing. Select appropriate restriction enzymes to linearize the vector according to the ligation direction to obtain the LMO2 gene fragment with SP6 or T7 promoter; S2-2. Synthesize sense and antisense probes: Using the LMO2 gene fragment with the SP6 or T7 promoter obtained in step S2-1 as a template, synthesize digoxigenin-labeled mRNA probes using SP6 or T7 primers and a digoxigenin kit. Purify the resulting mRNA probes using ethanol precipitation, and measure the OD value of each mRNA probe.

3. The preparation method according to claim 2, wherein: The specific steps of the ethanol precipitation method in step S2-2 are as follows: 30 μL of enzyme-free water, 2.5 μL of 4 M lithium chloride, and 75 μL of pre-chilled anhydrous ethanol are added to the obtained mRNA probe solution and mixed thoroughly; the reaction mixture is allowed to stand at a temperature not higher than -60°C for at least 30 minutes, or at -15°C to -25°C for 2 hours. Subsequently, the mixture is centrifuged at 13,000 × g at 4°C for 15 minutes; Aspirate the supernatant and wash the precipitate with 50 μL of pre-cooled 70% ethanol; centrifuge at 13,000 × g for 5 min, aspirate the upper ethanol layer, and dry the precipitate under vacuum; dissolve the precipitate in 50 μL of RNase-free double-distilled water or TE buffer to a probe concentration of 0.1-1 μg / μL; use immediately or store at or below -60°C.

4. The preparation method according to claim 3, wherein: The pre-cooling temperature of anhydrous ethanol and 70% ethanol is -15℃~-25℃.

5. The application of the mRNA probe for identifying chicken embryo blood vessels based on the LMO2 gene of claim 1 in marking chicken embryo blood vessels, characterized in that: The following steps are involved: a. Obtaining chicken embryos: Wipe the surface of the chicken embryo after incubation for 24 hours or 48 hours with 75% alcohol, then use tweezers to open the air chamber from the blunt end of the egg, carefully pour out the egg liquid, and remove the chicken embryo attached to the yolk membrane to ensure that the embryo is not damaged or wrinkled. Then wash it with PBS and fix it with 4% paraformaldehyde for 12 hours to obtain the fixed tissue; b. In situ hybridization steps: After fixation, the tissue is dehydrated in a gradient of methanol solutions and then washed three times in PBTX. The embryonic tissue is then digested with proteinase K in PBTX for a duration determined by the size of the embryo. The digested tissue is then washed multiple times in PBTX to remove the proteinase K and fixed again with 4% paraformaldehyde for 20 minutes. Next, the embryonic tissue is washed extensively with prehybridization solution on a shaker at 65°C. After the prehybridization solution has been in contact with the tissue for 2 hours, the solution is removed and the embryonic sample is transferred to hybridization solution containing a labeled sense or antisense probe at a concentration of at least 250 ng / mL and incubated overnight. After hybridization, the embryonic tissue is rinsed extensively in a mixture of Solution 1 and SSC. The tissue is then equilibrated in TBTX and blocked with 10% sheep serum-TBTX for 2 hours at room temperature. Dilute 0.5 μL of alkaline phosphatase-conjugated DIG antibody to 1 mL of 10% sheep serum-TBTX at a 1:2000 ratio, add to the tissue, and shake overnight at 4°C. Wash the embryos with 0.1% fetal bovine serum / TBTX solution, then add 19 μL of NBT / BCIP color development solution per mL of TBS. Incubate in the dark for 3-5 hours until color develops.

6. The use according to claim 5, characterized in that: The specific steps for obtaining a complete chicken embryo in step a are as follows: cutting a circle with a radius of 0.5-1 cm from the middle of the adsorption paper, then gently sticking the adsorption paper on the vitelline membrane, and ensuring that the embryonic tissue is exposed in the circular hole; then cutting the vitelline membrane along the edge of the adsorption paper, using ophthalmic forceps to peel off the adsorption paper, and the embryonic tissue together with the blastodisc is completely obtained from the vitelline membrane.

7. The use according to claim 5, characterized in that: Gradient dehydration step of methanol solution in step b: PBTX washing twice, 5 minutes each time; 25% methanol + 75% PBTX washing for 5 minutes; 50% methanol + 50% PBTX washing for 5 minutes; 75% methanol + 25% PBTX washing for 5 minutes; methanol washing twice, 5 minutes each time; 75% methanol + 25% PBTX washing for 5 minutes; 50% methanol + 50% PBTX washing for 5 minutes; 25% methanol + 75% PBTX washing for 5 minutes; PBTX washing three times, 5 minutes each time.

8. The use according to claim 5, characterized in that: Proteinase K digestion treatment was performed by adding 1 mL of 10 μg / mL proteinase K to digest the embryonic tissue for 5 minutes.

9. The use according to claim 5, characterized in that: The specific operation of extensively rinsing the hybridized embryonic tissue in a mixture of Solution 1 and SSC is as follows: the rinsing environment is 65°C, 75% Solution 1 + 25% 2×SSC for 5 minutes; 50% Solution 1 + 75% 2×SSC for 5 minutes; 25% Solution 1 + 75% 2×SSC for 5 minutes; 2×SSC-0.1% Chaps for 15 minutes; 2×SSC-0.1% Chaps for 15 minutes; 0.2×SSC-0.1% Chaps for 15 minutes; 0.2×SSC-0.1% Chaps for 15 minutes.

10. The use according to claim 5, characterized in that: PBTX was prepared as follows: 0.1 mL of Triton X-100 solution was added to 49.9 mL of PBS; the prehybridization solution consisted of 50% formamide, 5× SSC, 0.1% Triton X-100, 0.5% Chaps surfactant, 5 mM EDTA, 50 μg / mL heparin, 1 mg / mL yeast RNA, and 2% blocking powder; the hybridization solution consisted of 50% formamide, 5× SSC, 0.1% Triton X-100, 0.5% Chaps surfactant, 5 mM EDTA, 50 μg / mL heparin, 1 mg / mL yeast RNA, 2% blocking powder, and the mRNA probe; TBTX consisted of 50 mM Tris-HCl, 150 mM NaCl, and 0.1% Triton X-100, with a pH of 7.5; and TBS consisted of 100 mM NaCl and 100 mM Tris-HCl, with a pH of 9.5.

Images