Method for identifying first branch angle of pepper and application thereof
Through genome-wide association analysis and dCAPS technology to identify the first branch angle of pepper, the problem of lack of effective molecular markers in the existing technology is solved, and rapid and accurate identification of pepper plants and breeding efficiency is achieved.
Patent Information
- Application Number
- CN202510682947.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-26
- Publication Date
- 2025-08-19
AI Technical Summary
The lack of effective molecular markers in the prior art is used to identify the first branch angle of pepper, limiting the process of pepper plant-type molecular markers assisted in selective breeding.
Through genome-wide association analysis, SNP sites significantly associated with the first branch angle of pepper were detected under a mixed linear model, SNP molecular markers related to the first branch angle of pepper were developed, and PCR amplification and restriction enzyme digestion were performed using dCAPS primer pairs, and genotypes were detected in combination with agarose gel electrophoresis.
It has achieved rapid and accurate identification of plant-type pepper materials with the first branch angle greater than 60° during the seedling stage, which has improved the efficiency and accuracy of molecular marker-assisted selection, and promoted the improvement and breeding process of pepper varieties.
Smart Images

Figure FT_1
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular markers, and in particular to a method for identifying the first branch angle of pepper and an application thereof. Background Art
[0002] chili( Capsicum spp.) is closely related to its yield. Plant type refers to morphological characteristics such as the spatial distribution of a plant's leaves and stems. During cultivation, an overly expansive or compact plant type can negatively impact yield. Overly compact plants are susceptible to disease, while overly expansive (creeping) plants take up too much space, reducing yield per unit area. Pepper plant type traits primarily include plant height, plant width, number of branches, branch angle, and flowering node. The angle of the first branch is a key indicator for creating an ideal plant type in breeding.
[0003] In the sympodial branching structure of peppers, the main stem stops elongating after reaching a certain height. At this point, the shoot apical meristem transforms into the inflorescence meristem, while growth continues from the lateral meristems of the sympodial meristem. These sympodial meristems give rise to two lateral branches, forming a distinctive "V"-shaped branching pattern known as a sympodial unit. New sympodial meristems continuously arise from the axils of the topmost leaves of the previous sympodial unit, thus continuing the growth cycle. In peppers, the angle between these two initial lateral branches is called the first branching angle. This angle is closely correlated with yield and, therefore, has become an important breeding parameter for cultivating an ideal plant type.
[0004] Previous researchers have conducted genetic analysis of the first branch angle in peppers based on biparental populations, but a molecular marker that can effectively identify this angle has not yet been developed, limiting the progress of molecular marker-assisted selection and breeding for pepper plant types. The present invention, based on genome-wide association analysis, can more broadly utilize the numerous genetic variations in natural populations and efficiently screen for effective molecular markers. The development and application of molecular markers for the first branch angle in peppers will have a positive impact on varietal improvement and industrial development of the pepper plant. Summary of the Invention
[0005] The invention provides a method for identifying the first branch angle of pepper and application thereof.
[0006] Based on 220 natural populations of peppers, the present invention uses genome-wide association analysis to detect a SNP site that is significantly associated with the first branch angle of peppers under a mixed linear model. Molecular markers are developed based on the SNP to screen pepper germplasms with different plant types, which can improve the efficiency and accuracy of molecular marker-assisted selection of pepper plant types, and play an important role in creating new germplasms with different plant types.
[0007] Specifically, the present invention provides the following technical solutions.
[0008] In a first aspect, the present invention provides a SNP molecular marker associated with the first branch angle of pepper, wherein the SNP molecular marker comprises a nucleotide sequence with a polymorphism of G / T at the 190 bp position of the sequence shown in SEQ ID NO.1.
[0009] In the present invention, the nucleotide sequence shown in SEQ ID NO.1 is: GTCATTCATTTGCAGTTTATATGTTAGTTTATCTTTTCTCCCCTCTCTTAGTCAATCTCATTCAAGGACGAATGTTCCCAAGGGGAGATATTGTAATACCCTATACTTCTACCTAACTTGAATTCATCCCAAAAATGTTAAAGATATGTTTTAAAGATGAATCTACTTTTATACACGTGGAATTTTCAA[G / T]ATTTTCACTTTTTTATGTGGAAAATTCAATAAACTTTCATTGATATAAGATTTGC.
[0010] Here, K can also represent G / T in the sequence shown in SEQ ID NO.1.
[0011] Specifically, the SNP sites described above correspond to the pepper genome ( C. annuum cv. CM334 v1.6) on chromosome 2 at position 120,686,854, with a G / T SNP polymorphism.
[0012] Preferably, the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, the polymorphic site is located at the 190th bp of the sequence shown in SEQ ID NO.1, and the polymorphism is G / T.
[0013] Preferably, the genotype of the SNP molecular marker is TT, corresponding to a plant spreading type material with a first branching angle > 60°.
[0014] In a second aspect, the present invention provides a primer pair for amplifying the above-mentioned SNP molecular markers.
[0015] Those skilled in the art should understand that there are many methods for analyzing the base type of SNP sites, including sequencing analysis, allele-specific PCR analysis, enzyme digestion product polymorphism analysis, etc.
[0016] Preferably, the primer pair is a dCAPS (derived cleaved amplified polymorphic sequences) primer pair, and the nucleotide sequence is shown in SEQ ID NO. 2-3.
[0017] The specific sequences of the above primers are as follows: SEQ ID NO.2: 2.120-BglII-F: GTCATTCATTTGCAGTTTATATGTTAGTT; SEQ ID NO.3: 2.120-BglII-R: GCAAATCTTATATCAATGAAAGTTTATTGAATTTTCCACATAAAAAAGTGAA G AT.
[0018] The sequence shown in SEQ ID NO. 3 was lengthened to facilitate the distinction of bands of different sizes on agarose gel after enzyme digestion, and one base A was intentionally modified to a base G, which is the base shown in italics above, so that the PCR product generated after amplification can be digested by restriction endonucleases. Bgl II distinguishes target SNPs.
[0019] In a third aspect, the present invention provides the above-mentioned SNP molecular marker detection reagent, detection kit or gene chip.
[0020] Preferably, the reagent, kit or gene chip contains the primer pair described above.
[0021] In a fourth aspect, the present invention provides any of the following uses of the above-mentioned SNP molecular marker, primer pair, detection reagent, detection kit or gene chip: (1) Identify or select pepper materials with a spreading plant type and a first branch angle greater than 60°; (2) Molecular marker-assisted breeding of pepper; (3) Pepper variety improvement.
[0022] Preferably, in the above (2) and (3), the pepper molecular marker-assisted breeding and pepper variety improvement are respectively the pepper plant type molecular marker-assisted breeding and pepper plant type variety improvement.
[0023] Preferably, the application includes: analyzing the genotype of the base at 190 bp of the nucleotide sequence shown in SEQ ID NO.1; if the genotype is TT, it is determined to be a plant-type material with a first branch of pepper >60°.
[0024] In a fifth aspect, the present invention provides any of the following uses of a SNP molecular marker or a detection primer or a detection reagent for the SNP molecular marker: (1) Identify or screen pepper materials with a spreading plant type and a first branch angle greater than 60°; (2) Molecular marker-assisted breeding of pepper; (3) Pepper variety improvement; The polymorphic site of the SNP molecular marker is located at position 120,686,854 of chromosome 2 of the pepper genome, and the polymorphism is G / T; the version number of the pepper genome is C. annuum cv. CM334 v1.6.
[0025] Preferably, in the above (2) and (3), the pepper molecular marker-assisted breeding and pepper variety improvement are respectively the pepper plant type molecular marker-assisted breeding and pepper plant type variety improvement.
[0026] Preferably, the application includes: analyzing the genotype of the SNP site located at position 120,686,854 of chromosome 2 of the pepper genome; if the genotype is TT, it is determined to be a pepper plant type material with a first branch >60°.
[0027] In a sixth aspect, the present invention provides a method for identifying the first branch angle of pepper based on dCAPS technology, the method comprising: (1) Extracting genomic DNA from peppers to be tested; (2) Using the genomic DNA of the pepper to be tested as a template, PCR amplification was performed using the dCAPS primer pair shown in SEQ ID NO. 2-3; (3) Analyze the PCR amplification products to determine the genotype of the SNP molecular markers mentioned above, and identify the pepper materials with a plant-type spreading type and a first branching angle greater than 60° based on the genotype of the SNP molecular markers.
[0028] Preferably, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing at 55°C-60°C for 20 s, extension at 72°C for 30 s-60 s, for 36-40 cycles.
[0029] Further preferably, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing at 55°C for 20 s, and extension at 72°C for 30 s, for 39 cycles.
[0030] Preferably, the 20 μL reaction system for PCR amplification is: 10 μL of 2×Taq Master Mix, 0.4 μL each of 10 μM forward and reverse primers, 1.0 μL of DNA template, and 8.2 μL of ddH2O.
[0031] In the above method, the analysis of the PCR amplification product is to digest the PCR amplification product with a restriction endonuclease, perform electrophoresis detection on the digestion product, and determine the genotype of the SNP molecular marker based on the band pattern.
[0032] Preferably, the restriction endonuclease is a restriction endonuclease that specifically recognizes AGATCT Bgl II.
[0033] Specifically, restriction enzymes are used Bgl The reaction system (10 μL) of the PCR amplification product digested with II enzyme is: ddH2O 4.1 μL, NEBuffer™ r3.1 0.7 μL, Bgl II 0.2 μL, PCR amplification product 5 μL; enzyme digestion reaction conditions: 37 ℃ enzyme digestion for 8 h; after the completion of enzyme digestion, 4 μL of the digestion product was electrophoresed on 3.5% agarose gel.
[0034] In the above method, if the genotype of the base at the 190th bp of the nucleotide sequence shown in SEQ ID NO.1 is TT, that is, after enzyme digestion of the PCR amplification product, a 245 bp band is displayed, then the pepper to be tested is a plant spreading type material with a first branch angle >60°.
[0035] The beneficial effects of the present invention include at least: (1) The present invention can more widely utilize the numerous genetic variations in natural populations based on whole-genome association analysis and efficiently screen effective molecular markers. The developed molecular markers are based on the significantly associated SNPs detected in the whole-genome association analysis and can represent the variation patterns in natural pepper populations. They are universal and have a high accuracy rate in identifying the first branch angle of pepper.
[0036] (2) The dCAPS primer pair developed by the present invention can be used to perform SNP genotyping simply by gel electrophoresis, which has the advantages of being convenient, fast, and having reliable results.
[0037] (3) By using the molecular markers of the present invention to assist in the selection of the first branch angle of pepper, plant development materials with a first branch angle of >60° can be quickly and accurately identified at the seedling stage, accelerating the breeding process and improving the efficiency of molecular marker-assisted selection of pepper plant types, which has a positive role in promoting the variety improvement and industrial development of pepper. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction will be given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0039] Figure 1The results of agarose gel electrophoresis of the dCAPS detection primer pair for identifying the SNP2.120 genotype of pepper germplasm using SNP molecular markers in Examples 1 and 2 of the present invention are shown; wherein M is a DNA marker, and the band sizes from top to bottom are 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp, respectively; 1-54 are pepper germplasm to be tested; 55-60 are pepper germplasm with a genotype of TT, having a 245 bp band; 61-66 are pepper germplasm with a genotype of GG, having double bands of 193 bp and 52 bp, of which the 52 bp band is weaker. 1, A018; 2, A026; 3, A047; 4, A060; 5, A066; 6, A086; 7, A088; 8, A089; 9, A108; 10 , A120; 11, A123; 12, A124; 13, A131; 14, A138; 15, A144; 16, A183; 17, A186; 18, A 198; 19, A237; 20, A252; 21, B007; 22, B008; 23, B018; 24, B025; 25, B112; 26, B1 19; 27, B125; 28, B134; 29, B142; 30, B166; 31, B308; 32, B316; 33, B324; 34, B345 ;35, B430; 36, B438; 37, B441; 38, B445; 39, BJ10; 40, C002; 41, C004; 42, C005; 43, C018; 44, C022; 45, C024; 46, C025; 47, C099; 48, C139; 49, WY042; 50, WY113; 51, WY120; 52, WY248; 53, WY260; 54, ZHE10; 55, A041; 56, A052; 57, A161; 58, A19 3; 59, A196; 60, B003; 61, A008; 62, A010; 63, A011; 64, A012; 65, A013; 66, A031. DETAILED DESCRIPTION
[0040] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.
[0041] Unless otherwise specified, all examples were performed according to conventional experimental conditions, such as those in Sambrook et al. Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions.
[0042] Example 1 Development of molecular markers for the first branch angle in pepper 1. Association analysis of the first branch angle in pepper based on simplified genome sequencing 220 pepper germplasms were selected, including breeding lines, local varieties and transitional germplasm resources. Most of them were core pepper germplasm materials from the Institute of Vegetables and Flowers of Jiangxi Academy of Agricultural Sciences, mainly from 28 provinces in China, and a small part (10%) came from 9 other countries (the United States, the United Kingdom, Hungary, Indonesia, Italy, Japan, the Netherlands, South Korea and Thailand). Genotyping (Genotyping-by-sequencing, GBS) was performed on the 220 pepper germplasms. Restriction enzymes were used to identify the genotypes. EcoR I and Nla III The genomic DNA was digested by enzymes, and the digested fragments were added with sequencing adapters with labels to construct a small fragment library. PE125 double-end sequencing was performed. After quality control, a total of 955,772 high-quality variants were obtained for subsequent whole-genome association analysis, including 919,743 SNPs and 36,029 Indels. The first branch angle of peppers, that is, the angle between the two initial side branches of the first sympodial unit, was measured at the four-door green ripening stage of peppers to obtain the phenotypic data of the first branch angle of peppers. GEMMA software (v0.98.1) was used to perform association analysis on the first branch angle phenotypic data and genotypic data of 220 peppers. Significantly associated SNPs were detected under the mixed linear model, including the SNP sites in the present invention, corresponding to the pepper genome ( C . annuum cv. CM334 v1.6) chromosome 2, position 120,686,854, with a G / T SNP (p = 3.04×10 -6 ), named SNP2.120. SEQ ID NO. 1 shows the nucleotide sequence containing the SNP site SNP2.120. Among 220 pepper germplasms, the first branch angles of the materials with the GG and TT genotypes at this site, identified by GBS, were 55.72 ± 9.50° and 73.14 ± 9.30°, respectively. There was a highly significant difference in the first branch angles between the two genotypes (p = 8.00×10 -8 <0.0001).
[0043] 2. Development of molecular markers for the first branch angle in pepper Based on simplified genome sequencing data from 220 pepper accessions, 10 accessions harbored the TT genotype for SNP 2.120. All of these accessions, including A041, A052, A161, A193, A196, B003, B245, WY086, WY215, and WY269, showed that this SNP could be used to identify pepper accessions with large branching angles. Primer pairs 2.120-BglII-F and 2.120-BglII-R were designed to flank SNP 2.120, with the nucleotide sequences shown in SEQ ID NOs. 2 and 3, respectively. Amplification using primers 2.120-BglII-F (SEQ ID NO. 2) and 2.120-BglII-R (SEQ ID NO. 3) revealed that the SNP could be detected by restriction endonucleases. Bgl II was identified and subsequently developed into a dCAPS molecular marker.
[0044] Based on reduced genome sequencing data, six pepper accessions each with the TT and GG genotypes at the SNP locus were randomly selected and amplified using the primer pair 2.120-BglII-F (SEQ ID NO. 2) and 2.120-BglII-R (SEQ ID NO. 3). The PCR system consisted of 10 μL of 2× Taq Master Mix, 0.4 μL of each 10 μM forward and reverse primer, 1.0 μL of DNA template, and 8.2 μL of ddH₂O. The 2× Taq Master Mix was obtained from the commercial kit E005-02B from Nearshore Protein Technology Co., Ltd. The PCR amplification protocol was as follows: 95°C pre-denaturation for 10 min, followed by 39 cycles of denaturation at 95°C for 20 s, annealing at 55°C for 20 s, and extension at 72°C for 30 s.
[0045] The PCR product digestion system is: ddH2O 4.1 μL, NEBuffer™ r3.1 0.7 μL, Bgl II 0.2 μL, PCR product 5 μL, 37℃ enzyme digestion for 8 h. Alu I. Mnl I and Taq I and II were commercial kits R0144V from New England Biolabs. 4 μL of the digested product was run on a 3.5% agarose gel. The results showed that all six pepper germplasms with the TT genotype had a single 245 bp band ( Figure 1 , electrophoresis results number 55-60), the six pepper germplasms with genotype GG all had double bands of 193 bp + 52 bp after enzyme digestion ( Figure 1 The results were obtained using the dCAPS markers (electrophoresis results, numbers 61-66), indicating that the dCAPS marker can accurately identify the genotype of SNP 2.120. The 52 bp band is relatively weak, so in practice, the 245 bp and 193 bp bands are the primary markers for genotyping.
[0046] Example 2 Application of molecular markers for the first branch angle of pepper Among the 220 pepper accessions used for genome-wide association analysis, the genotype of SNP2.120 in 54 accessions was not identified by simplified genome sequencing. To verify the accuracy and effectiveness of this molecular marker, the SNP2.120 marker was used to identify the genotypes of these 54 accessions. DNA was extracted using the CTAB method and amplified using the primer pair 2.120-BglII-F and 2.120-BglII-R. The PCR system consisted of 10 μL of 2× Taq Master Mix, 0.4 μL of each 10 μM primer, 1.0 μL of DNA template, and 8.2 μL of ddH2O. The PCR reaction program was as follows: 95°C pre-denaturation for 10 min, followed by 39 cycles of 95°C denaturation for 20 s, 55°C annealing for 20 s, and 72°C extension for 30 s. The PCR product digestion system is: ddH2O4.1 μL, NEBuffer™ r3.1 0.7 μL, Bgl II 0.2 μL, PCR product 5 μL. After enzyme digestion at 37℃ for 8 h, 4 μL of the digestion product was electrophoresed on a 3.5% agarose gel ( Figure 1 , lanes 1-54). The results showed that A088 and B125 were of the TT genotype, with a single 245 bp band, while the others were of the GG genotype, with double bands of 193 bp + 52 bp (the 52 bp band was weaker). The first branch angles of A088 and B125 were 66.10° and 70.46°, respectively. This further confirmed that pepper germplasm with the TT genotype at this locus has a first branch angle greater than 60°. This indicates that this molecular marker can accurately identify spreading pepper germplasm with large branch angles, significantly improving the efficiency and accuracy of molecular marker-assisted breeding for the first branch angle locus, and has important application value.
[0047] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.
Claims
1. A SNP molecular marker associated with the first branch angle of pepper, characterized in that: The SNP molecular marker contains a nucleotide sequence with a polymorphism of G / T at the 190 bp position of the sequence shown in SEQ ID NO.
1.
2. The SNP molecular marker according to claim 1, characterized in that The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, the polymorphic site is located at the 190th bp of the sequence shown in SEQ ID NO.1, and the polymorphism is G / T; Preferably, the genotype of the SNP molecular marker is TT, corresponding to a plant-type spreading material with a first branching angle > 60°.
3. A primer pair for amplifying the SNP molecular marker according to claim 1 or 2; Preferably, the primer pair is a dCAPS primer pair, and the nucleotide sequence is shown as SEQ ID NO. 2-3.
4. The detection reagent, detection kit or gene chip for the SNP molecular marker according to claim 1 or 2; Preferably, the reagent, kit or gene chip contains the primer pair according to claim 3.
5. Any of the following uses of the SNP molecular marker according to claim 1 or 2, the primer pair according to claim 3, or the detection reagent, detection kit, or gene chip according to claim 4: (1) Identify or select pepper materials with a spreading plant type and a first branch angle greater than 60°; (2) Molecular marker-assisted breeding of pepper; (3) Pepper variety improvement.
6. The use according to claim 5, characterized in that The application includes: analyzing the genotype of the base at the 190th bp of the nucleotide sequence shown in SEQ ID NO.1; if the genotype is TT, it is determined to be a plant type material with the first branch of pepper >60°.
7. Any of the following applications of a SNP molecular marker or a detection primer or reagent for the SNP molecular marker: (1) Identify or screen pepper materials with a spreading plant type and a first branch angle greater than 60°; (2) Molecular marker-assisted breeding of pepper; (3) Pepper variety improvement; in, The polymorphic site of the SNP molecular marker is located at position 120,686,854 of chromosome 2 of the pepper genome, and the polymorphism is G / T; the version number of the pepper genome is C . annuum cv. CM334 v1.
6.
8. A method for identifying the first branch angle of pepper based on dCAPS technology, characterized in that: The method comprises: (1) Extracting genomic DNA from peppers to be tested; (2) Using the genomic DNA of the pepper to be tested as a template, PCR amplification was performed using the dCAPS primer pair shown in SEQ ID NO. 2-3; (3) Analyze the PCR amplification product to determine the genotype of the SNP molecular marker according to claim 1 or 2, and identify the pepper material with a plant-type spreading type and a first branching angle greater than 60° based on the genotype of the SNP molecular marker.
9. The method according to claim 8, characterized in that The reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing at 55°C-60°C for 20 s, extension at 72°C for 30 s-60 s, and 36-40 cycles.
10. The method according to claim 8 or 9, characterized in that The analysis of the PCR amplification product is to digest the PCR amplification product with a restriction endonuclease, perform electrophoresis on the digestion product, and determine the genotype of the SNP molecular marker according to the band pattern; Preferably, the restriction endonuclease is a restriction endonuclease that specifically recognizes AGATCT Bgl II; More preferably, if the genotype of the base at the 190th bp of the nucleotide sequence shown in SEQ ID NO.1 is TT, that is, after enzyme digestion of the PCR amplification product, a 245 bp band is displayed, then the pepper to be tested is a plant spreading type material with a first branching angle > 60°.