Recombinant serum type 4 fowl adenovirus for expressing goose parvovirus virus VP3 protein as well as construction method and application of recombinant serum type 4 fowl adenovirus

Abstract

The invention discloses a recombinant serum type 4 fowl adenovirus for expressing goose parvovirus virus VP3 protein as well as a construction method and application of the recombinant serum type 4 fowl adenovirus. According to the recombinant serum type 4 fowl adenovirus, a coding gene for expressing goose parvovirus GPVSJ20190420 strain VP3 protein is used for replacing 253-site nucleotide to 1440-site nucleotide of a Fiber-2 gene of FAdV-4. The recombinant FAdV-4 virus FAdV4-VP3 (GPV) for expressing goose parvovirus GPVSJ20190420 strain VP3 protein is successfully constructed by taking FAdV-4 as a virus vector, targeting Fiber-2 through a CRISPR / Cas9 technology and a Cre-loxP recombinant system and utilizing a double-fluorescence system, technical support and vaccine candidates are provided for effective joint prevention and joint control of GPV and FAdV-4, and the recombinant FAdV4-VP3 (GPV) has good market application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a method for constructing a cell line for knocking out the chicken EphrinA2 gene based on CRISPR-Cas9. Background Art

[0002] Goose parvovirus (GPV) belongs to the genus Dependovirus within the subfamily Parvovirinae of the family Parvoridae. GPV infection primarily causes a highly contagious, acute disease characterized by fibrinous necrotic enteritis in the intestines of goslings and Muscovy ducklings. GPV carries the risk of co-infection with other pathogens (such as viruses, bacteria, and fungi), resulting in high morbidity and mortality in newborn chicks. The disease primarily affects goslings under two weeks of age, with chicks aged one to ten days being most susceptible.

[0003] Prior art reports indicate that goose-derived avian adenovirus serotype 4 (FAdV-4) can cause clinical symptoms such as pericardial effusion in 10-day-old goslings, with damage to the liver and kidneys. Therefore, avian adenovirus serotype 4 is pathogenic to geese, and its pathogenicity is related to age and mode of infection. However, there is currently no commercially available combined vaccine against GPV and FAdV-4. Summary of the Invention

[0004] Purpose of the invention: In response to the deficiencies in the prior art, the present invention provides a recombinant serotype 4 avian adenovirus expressing the VP3 protein of goose parvovirus disease virus, which can provide active protection for goslings by immunizing them, achieving effective "one-shot, two-link" prevention, and providing assistance for the prevention and purification of goose parvovirus and serotype 4 avian adenovirus. At the same time, it can be used as a genetically engineered vaccine with high safety, good stability, and simple and convenient preparation.

[0005] The present invention also provides a construction method and application of the recombinant serum type 4 avian adenovirus expressing the VP3 protein of goose parvovirus disease virus.

[0006] Technical solution: In order to achieve the above-mentioned purpose, the present invention describes a recombinant serotype 4 avian adenovirus expressing the VP3 protein of goose parvovirus GPVSJ20190420 strain based on CRISPR-Cas9 technology. The recombinant serotype 4 avian adenovirus expressing the VP3 protein of goose parvovirus GPVSJ20190420 strain is a gene encoding the VP3 protein of goose parvovirus GPVSJ20190420 strain that replaces nucleotides 253 to 1440 of the Fiber-2 gene of FAdV-4. The sequence of the gene encoding the VP3 protein of goose parvovirus GPVSJ20190420 strain is shown in SEQ ID NO.1, and the sequence of the Fiber-2 gene of FAdV-4 is shown in SEQ ID NO.2.

[0007] The method for constructing a recombinant serotype 4 avian adenovirus expressing the VP3 protein of goose parvovirus GPVSJ20190420 strain based on CRISPR-Cas9 technology of the present invention comprises the following steps:

[0008] (1) Design and screen sgRNA targeting the Fiber-2 gene of avian adenovirus serotype 4;

[0009] (2) A donor plasmid carrying the VP3 protein and RFP expression cassette of goose parvovirus GPVSJ20190420 strain was constructed by PCR and homologous recombination, wherein the RFP expression cassette had LoxP sites at both ends;

[0010] (3) The well-grown LMH cells were digested and cultured, transfected with sgRNA and donor plasmid, and then infected with the recombinant virus serotype 4 fowl adenovirus FA4-EGFP expressing EGFP;

[0011] (4) After infection with serotype 4 avian adenovirus, RFP red fluorescence was observed, and the red fluorescent recombinant virus was purified by plaque assay and limiting dilution method to obtain a recombinant serotype 4 avian adenovirus expressing the VP3 protein of goose parvovirus GPVSJ20190420 strain with an RFP expression cassette;

[0012] (5) The recombinant virus with the RFP expression cassette obtained in step (4) is used to infect LMH cells that overexpress Cre recombinase. After infection, the cell maintenance medium is replaced. The LMH cells inoculated with the virus are observed to have no red fluorescence, but there are CPE cells. The cells there are picked and subjected to limiting dilution until no red fluorescent cells appear in the wells. The recombinant virus with the RFP expression cassette deleted is obtained, that is, the recombinant serum type 4 avian adenovirus expressing the VP3 protein of the goose parvovirus GPVSJ20190420 strain is obtained.

[0013] Among them, the sgRNA in step (1) is sgRNA-F: CACCGAAGGGTGTATCGCTCTCCGG, and sgRNA-R: AAACCCGGAGAGCGATACACCCTTC.

[0014] Wherein, the PCR primers used to construct the donor plasmid in step (2) include a primer pair for amplifying the Fiber-2 gene and its left and right homologous arms, a primer pair for amplifying the RFP expression cassette, and a primer pair for amplifying the goose parvovirus VP3 gene;

[0015] The primer pair for amplifying the Fiber-2 gene and its left and right homology arms is: F:GTGTATCGCTCTCCGGAGGGGTGACCTACTGACCCTC; R:GGTGTATCGCTCTCCGGAGGTTCGTGGAACGCTCCGTCAG;

[0016] The primer pair for amplifying the RFP expression cassette is: F:TAACTCGAGTCTAGAAAGCTTGGATC; R:GGGAGGGCGCGCATAACTTCGTATAATGTATGCTATACGAAGTTATGGTACC GATATC

[0017] The primer pair for amplifying goose parvovirus VP3 gene is: F: CCCATCATCATCAAGAACGCAGAGGGAGGAGGC; R: CTTTCTAGACTCGAGTCAGGGCTGCGACCCCCAGT.

[0018] In step (3), the well-grown LMH cells were trypsinized and inoculated into six-well plates for culture. The next day, 1-5 μg of sgRNA and donor plasmid were transfected, and the cell growth medium was changed 5-8 hours after transfection. The recombinant virus serum type 4 fowl adenovirus FA4-EGFP expressing EGFP was infected 10-12 hours after transfection, and the cell maintenance medium was changed 2-3 hours after infection.

[0019] Preferably, in step (3), the well-grown LMH cells are trypsinized and then inoculated into six-well plates for culture. The next day, 3 μg of sgRNA and donor plasmid are transfected, and the cell growth medium is changed 6 hours after transfection. The recombinant virus serum type 4 fowl adenovirus FA4-EGFP expressing EGFP is infected 12 hours after transfection, and the cell maintenance medium is changed 2 hours after infection.

[0020] The recombinant virus expressing EGFP in step (3), fowl adenovirus FA4-EGFP, can express green fluorescent protein EGFP, which is different from the red fluorescent protein RFP of the recombinant virus.

[0021] The present invention discloses a CRISPR-Cas9-based recombinant serotype 4 avian adenovirus expressing the VP3 protein of the goose parvovirus GPVSJ20190420 strain in the preparation of a combined vaccine for the prevention and control of serotype 4 avian adenovirus disease and goose parvovirus disease.

[0022] The present invention provides a CRISPR-Cas9-based method for preparing a recombinant serotype 4 avian adenovirus expressing the VP3 protein of the goose parvovirus GPVSJ20190420 strain in the preparation of a recombinant serotype 4 avian adenovirus with low replication capacity.

[0023] The present invention uses CRISPR-Cas9 technology to construct a recombinant serotype 4 avian adenovirus that expresses the VP3 protein of the goose parvovirus GPVSJ20190420 strain. The key technology of the present invention is to find a suitable position in the serotype 4 avian adenovirus to insert an exogenous gene; at the same time, CRISPR-Cas9 technology is used to insert the VP3 protein of the goose parvovirus GPVSJ20190420 strain into the serotype 4 avian adenovirus, and the RFP expression cassette with a LoxP site is inserted into the serotype 4 avian adenovirus. The RFP protein is used to purify the virus. After purification, the RFP expression cassette is knocked out using Cre recombinase, and finally a recombinant serotype 4 avian adenovirus that can stably express the VP3 protein of the goose parvovirus GPVSJ20190420 strain is obtained. Specifically, the fiber-2 gene sequence of the FAdV-4HB1505 strain was used to design a sgRNA targeting the fiber-2 gene and cloned into the Lenti CRISPR v2 vector. The sgRNA construction vector was verified by sequencing.

[0024] The present invention uses FAdV-4 as a viral vector, targets Fiber-2 through CRISPR / Cas9 technology and Cre-loxP recombination system, and successfully constructs a recombinant FAdV-4 virus FAdV4-VP3 (GPV) expressing the VP3 protein of goose parvovirus GPVSJ20190420 strain using a dual fluorescence system, providing technical support and vaccine candidates for the effective joint prevention and control of GPV and FAdV-4.

[0025] The present invention uses CRISPR / Cas9 technology and the Cre-loxP recombination system to construct a recombinant serotype 4 avian adenovirus and its application. Using serotype 4 avian adenovirus as a vector to insert the goose parvovirus VP3 protein, the recombinant serotype 4 avian adenovirus expressing the goose parvovirus VP3 protein was successfully obtained. This provides technical support and vaccine candidates for the simultaneous immunization and control of serotype 4 avian adenovirus and goose parvovirus. Unlike traditional methods for constructing recombinant avian adenoviruses, this method targets the virulence gene fiber-2, utilizes a dual fluorescence system, and integrates CRISPR / Cas9 technology and the Cre-loxP recombination system. This eliminates the need for cloning the entire avian adenovirus genome, making the construction, screening, and purification of the recombinant avian adenovirus extremely rapid and efficient.

[0026] Currently, GPV attenuated vaccines and passive immunization with antibodies are the main strategies for preventing and controlling GP. However, due to the lack of effective cell culture amplification technology, the titer of GPV amplified from goose embryos is not high and the risk of contamination is high, resulting in high costs for large-scale production of vaccines and antibodies. VP3 protein is the main capsid protein of GPV, which can induce the host body to produce neutralizing antibodies and is an important immune protective antigen. At the same time, the hepatitis-pericardial effusion syndrome caused by serotype 4 avian adenovirus (FAdV-4) infection that has broken out in chicken flocks in recent years has also been reported in goose flocks. In order to develop a genetically engineered vaccine that can effectively amplify goose parvovirus protective antigen VP3 through cell culture, the present invention targeted the editing of the FAdV-4 virulence gene fiber-2, and used the recombinant avian adenovirus FAdV4-EGFP as a template vector. For the first time, the main protective antigen VP3 of goose parvovirus was inserted into the FAdV-4 genome by gene replacement, and the recombinant virus FAdV4-VP3 (GPV) that stably expresses GPV VP3 protein was successfully constructed. The virus titer in LMH cells reached 10 6 TCID 50 / mL, providing a new genetically engineered vaccine candidate for immunizing goslings to prevent goose parvovirus disease.

[0027] The avian adenovirus vector constructed in this invention offers advantages such as high expression efficiency, wide host coverage, simple operation, strong safety, low pathogenicity, high cost-effectiveness, and the ability to induce high levels of humoral and cellular immunity. The adenovirus genome is medium-sized, making it easy to construct exogenous gene vectors for vaccine development. The upstream regions of the E1, E3, and E4 regions allow for the insertion of exogenous genes without affecting viral replication in cells, offering broad application prospects in live vector vaccines, gene therapy, and tumor treatment.

[0028] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0029] This study, published in Nature Communications, for the first time, has achieved the construction of a recombinant serotype 4 avian adenovirus expressing the VP3 protein of the goose parvovirus (GPVSJ20190420) strain. Using CRISPR-Cas9 technology and the Cre-LoxP system, the authors used FAdV-4 as a vector to replace the GPV VP3 gene with the FAdV-4 Fiber-2 gene. This successful construction of a recombinant serotype 4 avian adenovirus expressing the GPV VP3 protein was followed by further in vitro and in vivo characterization studies, providing a candidate attenuated dual vaccine strain for the combined prevention and control of GPV and FAdV-4.

[0030] The FAdV-4 used in this invention has a large cloning capacity, and the FAdV-4 vector has significant advantages over its mammalian analogs. This invention constructs FAdV-4 into a useful vector system, using CRISPR-Cas9 gene editing technology to construct a recombinant virus FA4-EGFP expressing the EGFP-fiber2 fusion protein. Furthermore, the Fiber-2 gene was replaced with EGFP to rescue FAdV-4-EGFP-rF2, demonstrating that Fiber-2 can serve as a potential insertion site for novel vaccine development.

[0031] The present invention differs from traditional methods for constructing recombinant avian adenoviruses. It targets the virulence gene fiber-2, uses a dual fluorescence system, and integrates CRISPR / Cas9 technology and the Cre-loxP recombination system. Cloning of the entire avian adenovirus genome is not required, making the construction, screening, and purification of the recombinant avian adenoviruses extremely fast and efficient. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 It is the amplification of the VP3 gene of goose parvovirus;

[0033] Figure 2 Schematic diagram of the construction strategy of the recombinant virus expressing goose parvovirus VP3 protein;

[0034] Figure 3 Identification of primary recombinant serotype 4 avian adenovirus FAdV4-VP3(GPV)-RFP for IFA; a: recombinant virus FAdV4-VP3(GPV)-RFP; b: parent virus FA4-EGFP; c: negative LMH control;

[0035] Figure 4 PCR identification of recombinant serotype 4 avian adenovirus FAdV4-VP3(GPV)-RFP; 1: purified recombinant virus FAdV4-VP3(GPV)-RFP; 2: purified recombinant virus FAdV4-VP3(GPV); 3: parent virus FA4-EGFP; 4: negative LMH cell control; M: DNA marker;

[0036] Figure 5 IFA identification of VP3 protein expression in recombinant serotype 4 avian adenovirus FAdV4-VP3 (GPV); a: 4E9 monoclonal antibody identification of VP3 protein expression in recombinant virus; b: negative LMH cell control;

[0037] Figure 6 This is the growth curve determination of recombinant serotype 4 avian adenovirus FAdV4-VP3 (GPV). DETAILED DESCRIPTION

[0038] The present invention will be further described below with reference to the accompanying drawings and examples.

[0039] Unless otherwise specified, the materials and reagents used in the following examples are all commercially available. Experimental methods without specific conditions specified in the examples are generally performed under conventional conditions or the conditions recommended by the manufacturer.

[0040] The raw materials such as the carrier and antibody used in the present invention are all existing well-known materials, or are prepared by existing methods.

[0041] Goose parvovirus (GPV strain SJ20) was provided by Yangzhou University.

[0042] The detailed construction method of the recombinant virus expressing EGFP, fowl adenovirus serotype 4 FA4-EGFP, is shown in patent CN112877303A, provided by Yangzhou University.

[0043] FAdV-4 strain SD2015 was provided by Yangzhou University. For details, see the literature: Liang Guangcheng, Gao Wei, Xie Quan, et al. Isolation and identification of a highly pathogenic serotype 4 avian adenovirus [J]. China Poultry, 2016, 38(19): 25-28.

[0044] LMH cells were provided by the American Type Culture Collection (ATCC).

[0045] The pUC-57-LoxP-RFP-LoxP vector was provided by Yangzhou University. For details, see the following reference: Xie Q, Cao S, Zhang W, et al. A novel fiber-2-edited live attenuated vaccine candidate against the highly pathogenic serotype 4 fowl adenovirus[J]. Veterinary Research, 2021, 52: 1-10.

[0046] The plasmid pMD19-HAL-Lox P-RFP-Lox P-HAR carrying the red fluorescent protein (RFP) expression cassette was provided by Yangzhou University. For details, see the reference: Mu Yaru. Construction of recombinant serotype 4 avian adenovirus expressing red fluorescent protein and study of its partial characteristics [D]. Yangzhou University, 2022.

[0047] Example 1

[0048] 1. Viral genome preparation: Use the Tiangen Genome Extraction Kit (MAT: 4991108) for extraction. Transfer 200 μL of goose parvovirus supernatant to a 1.5 mL finger-shaped tube, add 200 μL of Proteinase K solution, and mix thoroughly. Add 200 μL of Buffer GB, mix thoroughly by inversion, incubate at 70°C for 10 minutes, briefly centrifuge, add 200 μL of anhydrous ethanol, and vortex thoroughly for 15 seconds. Add the above solution to an adsorption column CB3 (placed in a collection tube), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and return the adsorption column CB3 to the collection tube. Add 500 μL of Buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and return the adsorption column CB3 to the collection tube. Add 600 μL of rinse solution PW to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and return the adsorption column CB3 to the collection tube. Repeat the process by adding 600 μL of rinse solution PW, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and return the adsorption column CB3 to the collection tube. Centrifuge at 12,000 rpm for 2 minutes, discard the waste liquid, and let the adsorption column CB3 stand at room temperature for several minutes to allow the rinse solution to dry from the adsorption material. Transfer the adsorption column CB3 to a 1.5 mL finger-shaped tube and add 200 μL of elution buffer TE dropwise to the center of the adsorption membrane. Let it stand at room temperature for 2 minutes, then centrifuge at 12,000 rpm for 2 minutes. The solution collected in the centrifuge tube is the viral genome.

[0049] 2. Construction of sgRNA expression vector: sgRNAs were designed and screened based on the Fiber-2 gene sequence of FAdV-4. The designed sgRNAs were cloned into the lentiCRISPR v2 plasmid and verified by sequencing. The specific sgRNA sequences are shown in Table 1 and were synthesized by Nanjing Qingke Biotechnology Co., Ltd.

[0050] Table 1 sgRNA sequences targeting Fiber-2 gene

[0051]

[0052] The specific process of obtaining double-stranded sgRNA, digesting the vector plasmid, and constructing the knockout vector is as follows:

[0053] (1) Obtaining double-stranded sgRNA: sgRNA-F and sgRNA-R (SEQ ID NO. 3-4) were dissolved in ddH2O to a final concentration of 100 μM. The following annealing system was used: 1 μL each of sgRNA-F and sgRNA-R, 1 μL of 10× PCR buffer, and 7 μL of ddw. The annealing program was a gradient cooling of 5°C / min to 25°C to obtain double-stranded DNA.

[0054] (2) Enzyme digestion of vector plasmid: The lentiCRISPR v2 vector was digested with BsmBI restriction endonuclease. The digestion system was as follows: 1 μL of BsmBI restriction endonuclease, 1 μg of lentiCRISPR v2 plasmid, 0.5 μL of 0.1 M DTT, 5 μL of NEB buffer 3.1, and the rest was made up to 50 μL with ddH2O. The digestion conditions were 55°C for 15 min, and the lentiCRISPR v2 vector plasmid containing sticky ends was obtained by gel recovery.

[0055] (3) Construction of knockout plasmid: The double-stranded sgRNA obtained by annealing was diluted 100 times, and the enzyme-cut vector recovered from the gel was diluted to 50 ng / μL. Then, the plasmid was connected according to the following system: 1 μL of vector plasmid, 1 μL of double-stranded sgRNA, 1 μL of T4 ligase, 1 μL of 10×T4 buffer, and 6 μL of ddH2O. The ligation was carried out at 16°C overnight and then transformed into Stbl3 competent cells. The colony was picked and cultured. After the plasmid was extracted and sequenced, it was confirmed to be correct to obtain the sgRNA expression vector.

[0056] 3. Donor plasmid construction: Nanjing Qingke Biotechnology Co., Ltd. synthesized a fragment containing two LoxP sequences, which were inserted at both ends of the RFP expression cassette by PCR. The constructed pUC-57-LoxP-RFP-LoxP vector was provided by Yangzhou University.

[0057] Using the pUC-57-LoxP-RFP-LoxP vector as a template, primers (SEQ ID NO.7-8) were designed to amplify the RFP expression cassette with the LoxP sequence; the pMD19-T vector was linearized using the pMD19-T vector as a template; using the serotype 4 avian adenovirus genome as a template, primers (SEQ ID NO.5-6) ​​were designed to amplify the Fiber-2 gene (SEQ ID NO.2) and its left homologous arm HR1 and right homologous arm HR2, and cloned into the pMD19-T vector; using the goose parvovirus genome as a template, primers (SEQ ID NO.9-10) were designed to amplify the gene encoding the VP3 protein of the goose parvovirus GPVSJ20190420 strain (SEQ ID NO.1) (as shown in FIG. Figure 1 After agarose gel electrophoresis, the plasmid was recovered and assembled on pMD19-T using homologous recombination in the order HR1-Fiber-2-RFP-HR2. The resulting donor plasmid was sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The primer sequences used to construct the donor plasmid are shown in Table 2.

[0058] Table 2 PCR primers used to construct donor plasmids

[0059]

[0060]

[0061] 4. Rescue of red fluorescent recombinant virus: Construction strategy such as Figure 2 , LMH cells were plated in a 6-well plate. The next day, 3ug sgRNA expression vector, 3ug donor plasmid and 6uL transfection reagent Mirus were added to 200uL Opti-MEM and incubated at room temperature for 45min. It was then added to the LMH cells and replaced with cell growth medium after 6h of transfection. 12h after transfection, the cell growth medium was discarded, and the LMH cells were infected with 0.1MOI FA4-EGFP and replaced with cell maintenance medium after 2h of infection. Three days after virus infection, the supernatant was removed and centrifuged at 12000rpm for 10 minutes, and then blindly transferred to LMH cells in a new 96-well plate, and red fluorescent clusters were observed by fluorescence microscopy every day. The appearance of red fluorescent clusters indicates that the recombinant virus (such as Figure 3 ) and named FAdV4-VP3(GPV)-RFP. In this step, LMH cells were successfully infected with the recombinant virus containing RFP, showing red fluorescence under a fluorescence microscope. The RFP tag was subsequently removed using the Cre enzyme.

[0062] 5. Purification and identification of red fluorescent recombinant virus: The rescued red fluorescent recombinant virus was purified by plaque assay and limiting dilution method to obtain purified red fluorescent recombinant virus. The purity was identified by PCR. The primers are shown in Table 3. The results are shown in Table 3. Figure 4 The results showed that pure recombinant virus was successfully obtained.

[0063] Table 3 PCR primers for identifying recombinant viruses

[0064]

[0065] 6. Deletion of RFP expression cassette: Infect LMH cells that overexpress Cre recombinase with 0.1 MOI of red fluorescent recombinant virus. After 2 hours of infection, replace the cell maintenance medium. Observe that there is no red fluorescence in the cells inoculated with the virus, but there are LMH cells with CPE. Pick the cells there and perform limiting dilution until there are no red fluorescent cells in the well. Finally, all the cells obtained are cells infected with "recombinant virus that deletes RFP expression cassette", and the recombinant virus that deletes RFP expression cassette is obtained. The recombinant virus with RFP expression cassette removed was identified by PCR and IFA, and the recombinant virus FAdV4-VP3 (GPV) (such as Figure 4 , 5).

[0066] 7. Growth curve of recombinant virus: LMH cells were plated in 6-well plates. The next day, LMH cells were inoculated with 0.1 MOI of wild-type FAdV-4 and recombinant virus FAdV4-VP3 (GPV). After 2 hours, the cells were replaced with 1% maintenance medium. Cell supernatants were collected at 24 hours, 48 ​​hours, 72 hours, 96 hours, and 120 hours after infection. TCID 50 The virus titer at each time point was measured and the virus growth curve was drawn. The results showed that the replication ability of the recombinant virus was lower than that of the wild-type serotype 4 avian adenovirus (such as Figure 6 ).

[0067] The present invention replaces the protective antigen gene VP3 of the GPV epidemic strain SJ20190420 with part of the virulence gene fiber-2 of FAdV-4, and successfully constructs a recombinant genetic engineering vaccine candidate strain FAdV4-VP3 (GPV) expressing GPV VP3 protein. The recombinant virus FAdV4-VP3 (GPV) can effectively replicate in LMH cells, and the virus titer can reach 10 6 TCID 50 / 0.1mL, and can stably express GPV VP3 protein after 20 blind passages in LMH cells. The GPV VP3 protein expressed by the recombinant virus FAdV4-VP3 (GPV) can be effectively recognized by the anti-GPV VP3 protein broad-spectrum monoclonal antibody 2F9. The development of the recombinant genetically engineered virus FAdV4-VP3 (GPV) that can effectively replicate and stably express GPV VP3 protein in LMH cells provides a technology for the development of a new, highly effective GPV vaccine based on cell culture technology that is not dependent on goose or duck embryos, and provides a candidate for a two-in-one vaccine for the joint prevention and control of GPV and FAdV-4 in clinical practice.

Claims

1. A recombinant serotype 4 avian adenovirus expressing the VP3 protein of goose parvovirus GPVSJ20190420 strain based on CRISPR-Cas9 technology, characterized in that: The recombinant serotype 4 avian adenovirus expressing the VP3 protein of the goose parvovirus GPVSJ20190420 strain is obtained by replacing nucleotides 253 to 1440 of the Fiber-2 gene of FAdV-4 with the coding gene for expressing the VP3 protein of the goose parvovirus GPVSJ20190420 strain. The coding gene sequence for expressing the VP3 protein of the goose parvovirus GPVSJ20190420 strain is shown in SEQ ID NO.1, and the Fiber-2 gene sequence of FAdV-4 is shown in SEQ ID NO.

2.

2. A method for constructing a recombinant serotype 4 avian adenovirus expressing the VP3 protein of goose parvovirus GPVSJ20190420 strain based on CRISPR-Cas9 technology according to claim 1, characterized in that: The steps include: (1) Design and screen sgRNA targeting the Fiber-2 gene of avian adenovirus serotype 4; (2) A donor plasmid carrying the VP3 protein and RFP expression cassette of goose parvovirus GPVSJ20190420 strain was constructed by PCR and homologous recombination, wherein the RFP expression cassette had LoxP sites at both ends; (3) The well-grown LMH cells were digested and cultured, transfected with sgRNA and donor plasmid, and then infected with the recombinant virus serotype 4 fowl adenovirus FA4-EGFP expressing EGFP; (4) After infection with serotype 4 avian adenovirus, RFP red fluorescence was observed, and the red fluorescent recombinant virus was purified by plaque assay and limiting dilution method to obtain a recombinant serotype 4 avian adenovirus expressing the VP3 protein of goose parvovirus GPVSJ20190420 strain with an RFP expression cassette; (5) The recombinant virus with the RFP expression cassette obtained in step (4) is used to infect LMH cells that overexpress Cre recombinase. After infection, the cell maintenance medium is replaced. The LMH cells inoculated with the virus are observed to have no red fluorescence, but there are CPE cells. The cells there are picked and subjected to limiting dilution until no red fluorescent cells appear in the wells. The recombinant virus with the RFP expression cassette deleted is obtained, that is, the recombinant serum type 4 avian adenovirus expressing the VP3 protein of the goose parvovirus GPVSJ20190420 strain is obtained.

3. The construction method according to claim 2, characterized in that In step (1), the sgRNA is preferably sgRNA-F: CACCGAAGGGTGTATCGCTCTCCGG, sgRNA-R: AAACCCGGAGAGCGATACACCCTTC.

4. The construction method according to claim 2, characterized in that The PCR primers used in step (2) to construct the donor plasmid include a primer pair for amplifying the Fiber-2 gene and its left and right homology arms, a primer pair for amplifying the RFP expression cassette, and a primer pair for amplifying the goose parvovirus VP3 gene; The primer pair for amplifying the Fiber-2 gene and its left and right homology arms is: F:GTGTATCGCTCTCCGGAGGGGTGACCTACTGACCCTC; R:GGTGTATCGCTCTCCGGAGGTTCGTGGAACGCTCCGTCAG; The primer pair for amplifying the RFP expression cassette is: F:TAACTCGAGTCTAGAAAGCTTGGATC; R:GGGAGGGCGCGCATAACTTCGTATAATGTATGCTATACGAAGTTATGGTACC GATATC The primer pair for amplifying goose parvovirus VP3 gene is: F: CCCATCATCATCAAGAACGCAGAGGGAGGAGGC; R: CTTTCTAGACTCGAGTCAGGGCTGCGACCCCCAGT.

5. The construction method according to claim 2, characterized in that In step (3), the well-grown LMH cells were trypsinized and inoculated into six-well plates for culture. The next day, 1-5 μg of sgRNA and donor plasmid were transfected. 5-8 hours after transfection, the cell growth medium was replaced. 10-12 hours after transfection, the recombinant virus serum type 4 fowl adenovirus FA4-EGFP expressing EGFP was infected. 2-3 hours after infection, the cell maintenance medium was replaced.

6. The construction method according to claim 2, characterized in that The recombinant virus expressing EGFP in step (3), fowl adenovirus serotype 4 FA4-EGFP, can express green fluorescent protein EGFP, which is different from the red fluorescent protein RFP of the recombinant virus.

7. Use of the recombinant serotype 4 avian adenovirus expressing the VP3 protein of goose parvovirus GPVSJ20190420 strain based on CRISPR-Cas9 technology according to claim 1 in the preparation of a combined vaccine for the prevention and control of serotype 4 avian adenovirus disease and goose parvovirus disease.

8. Use of the recombinant serotype 4 avian adenovirus expressing the VP3 protein of goose parvovirus GPVSJ20190420 strain based on CRISPR-Cas9 technology according to claim 1 in the preparation of a recombinant serotype 4 avian adenovirus with low replication capacity.

Images