Construction method and application of engineering strain for improving biosynthesis yield of ergothioneine

By introducing the functional module SyCcaR into the engineering strain, the biosynthesis pathway of ergothioneine was optimized, and the problem of insufficient production performance in the prior art was solved, and a significant increase in ergothioneine fermentation yield was achieved.

CN120519451AActive Publication Date: 2025-08-22THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511020522.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-24
Publication Date
2025-08-22
Estimated Expiration
2045-07-24

AI Technical Summary

Technical Problem

The existing recombinant engineering strains have low production performance in ergothio and are difficult to meet the needs of efficient biosynthesis.

Method used

The functional module SyCcaR was designed and constructed, and it was introduced into the engineered strains through gene editing and electrotransformation methods, optimized the biosynthetic pathway of ergothione and increased the expression of EgtABCDE gene.

Benefits of technology

The fermentation yield of ergothionein was significantly improved, and the output was increased by 4.68 times, which has important application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519451A_ABST
    Figure CN120519451A_ABST
Patent Text Reader

Abstract

The invention provides a construction method and application of an engineering strain for improving the biosynthesis yield of ergothioneine, and belongs to the technical field of genetic engineering. According to the invention, a functional module SyCcaR for improving the biosynthesis yield of the ergothioneine is artificially designed and constructed, and the functional module SyCcaR is utilized to optimize and modify an engineering strain for biosynthesis of the ergothioneine. Researches find that the fermentation yield of ergothioneine of the recombinant strain modified by the method is increased by 4.68 times, and the recombinant strain has important application value in biosynthesis of an active product ergothioneine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a method for constructing an engineering strain for improving the biosynthesis yield of ergothioneine and an application thereof. Background Art

[0002] Ergothioneine (ERG) is a natural amino acid derivative and a thiol compound derived from histidine. Studies have shown that ergothioneine has multiple biological functions. It not only has strong antioxidant activity, such as scavenging hydroxyl free radicals, chelating divalent metal ions, activating antioxidant enzymes, and inhibiting superoxide dismutase, but also has anti-inflammatory and cell-protective effects. Therefore, ergothioneine has been widely used in the fields of food, medicine, and cosmetics.

[0003] The prokaryotic biosynthesis pathway of ergothioneine involves five enzymatic steps. L-histidine methyltransferase EgtD transfers three methyl groups from S-adenosylmethionine to L-histidine, catalyzing the formation of L-histidine betaine (HER). Glutamylcysteine ​​synthetase EgtA then connects glutamate to cysteine ​​to form γ-glutamylcysteine ​​(γ-GC). Next, the non-heme mononuclear iron-dependent enzyme EgtB catalyzes the formation of a C-S bond between γ-GC and HER to form cysteine ​​sulfoxide (γGC-HER). γ-Glutamylthiocysteine ​​S-oxide hydrolase EgtC then removes the L-glutamate (L-Glu) moiety from γGC-HER to form heptylcysteine ​​sulfoxide (Cys-HER). Finally, C-S bond cleavage by C-S lyase EgtE ultimately yields ergothioneine.

[0004] Currently, biosynthetic production of ergothioneine has become a research hotspot, but the production performance of recombinant engineered strains is generally low. Addressing the production performance bottleneck of low-version chassis strains, the introduction of artificially designed functional modules to improve cell activity and metabolic capacity in chassis cell factories under adverse fermentation conditions has become a hot topic in synthetic biology cell factory research. Summary of the Invention

[0005] In view of this, the object of the present invention is to provide a method for constructing an engineered strain that improves thioneine biosynthesis output and its application.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: The present invention provides a functional module SyCcaR for improving the biosynthesis yield of ergothioneine. The nucleotide sequence of the functional module SyCcaR is shown in SEQ ID NO.1.

[0007] The present invention provides a protein for improving the biosynthesis yield of ergothioneine, wherein the protein comprises the functional modules

[0008] SyCcaR encoding is obtained; The amino acid sequence of the protein is shown in SEQ ID NO.2.

[0009] The invention provides an engineering strain for improving the biosynthesis yield of ergothioneine. The engineering strain contains the functional module SyCcaR.

[0010] The present invention provides a method for preparing the engineered strain, comprising the following steps: 1) After the gene editing plasmid is introduced into competent cells, it is induced with IPTG to obtain competent cells containing the gene editing plasmid; 2) The gRNA expression vector and the functional module fusion fragment are transferred into competent cells containing a gene editing plasmid and incubated, and then placed in a culture medium containing 0.1% to 0.5% arabinose at 25 to 35°C for 8 to 16 hours, and then placed in a culture medium at 35 to 40°C for 12 to 24 hours to obtain the engineered strain; The gRNA expression vector is a plasmid in which the N20 targeting sequence is removed; The functional module fusion fragments are sequentially a fusion fragment of the upstream homology arm of the knock-in site with the gRNA expression vector, the functional module SyCcaR and the downstream homology arm of the knock-in site with the gRNA expression vector.

[0011] Preferably, the gene editing plasmid includes pCas#62225.

[0012] Preferably, the gRNA expression vector in step 2) includes a pTargetF plasmid.

[0013] Preferably, the concentration of IPTG is 0.05~0.2 mM.

[0014] Preferably, the transfer method in step 1) or step 2) comprises electroporation, and the electroporation procedure is 1800-2200 V, 23-27 µF, and 180-220 Ω.

[0015] Application of the gene, the protein or the engineered strain in improving the synthesis yield of ergothioneine.

[0016] Use of the gene, protein or engineered strain in increasing the expression level of EgtABCDE genes; The nucleotide sequence of EgtABCDE is shown in SEQ ID NO.3.

[0017] Compared with the prior art, the present invention has the following beneficial effects: The present invention artificially designs and constructs a kind of functional module SyCcaR, utilizes functional module SyCcaR to optimize and transform the engineering strain of biosynthesizing thioneine.Study finds that the thioneine fermentation yield of the recombinant strain transformed using this method increases 4.68 times, has important application value in the biosynthesis of active product thioneine. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of functional module SyCcsR and chassis strain transformation; Figure 2 The figure is the biosynthetic pathway of thioneine and the results of liquid chromatography-mass spectrometry (LC-MS / MS). A is the synthesis principle of thioneine, and B is the peak time comparison between the extracted sample and the thioneine standard. Figure 3 Analysis of ergothioneine production in the recombinant strain BWR-E with integrated functional module SyCcsR. DETAILED DESCRIPTION

[0019] The present invention provides a functional module SyCcaR for improving the biosynthesis yield of ergothioneine, wherein the nucleotide sequence of the functional module SyCcaR is shown in SEQ ID NO.1: SEQ ID NO.1:

[0020] The present invention provides a protein for improving the biosynthesis yield of ergothioneine, wherein the protein is encoded by the functional module SyCcaR; The amino acid sequence of the protein is shown in SEQ ID NO.2: SEQ ID NO.2: .

[0021] The invention provides an engineering strain for improving the biosynthesis yield of ergothioneine. The engineering strain contains the functional module SyCcaR.

[0022] The present invention provides a method for preparing the engineered strain, comprising the following steps: 1) After the gene editing plasmid is introduced into competent cells, it is induced with IPTG to obtain competent cells containing the gene editing plasmid; 2) transferring the gRNA expression vector and the functional module fusion fragment into competent cells containing the gene editing plasmid, incubating, and culturing to obtain the engineered strain; The gRNA expression vector is a plasmid in which the N20 targeting sequence in the plasmid is replaced; The functional module fusion fragments are sequentially a fusion fragment of the upstream homology arm of the knock-in site with the gRNA expression vector, the functional module SyCcaR and the downstream homology arm of the knock-in site with the gRNA expression vector.

[0023] In the present invention, the gene editing plasmid preferably includes pCas#62225, and the introduction method is preferably electroporation, specifically: Pick E. coli, preferably E. coli Monoclonal colonies of BW25113 were cultured on a shaking platform, and the cells were collected by centrifugation, washed with glycerol, and diluted to obtain competent cells; In the present invention, the shaking culture temperature is preferably 35-40 ° C, more preferably 36-38 ° C, and more preferably 37 ° C, and the shaking speed is preferably 180-260 rpm, more preferably 200-240 rpm, and more preferably 220 rpm, and the culture is carried out until the OD 600 =0.6~0.8, preferably OD 600 =0.7; the centrifugation temperature is preferably 0-6 ° C, more preferably 1-5 ° C, and more preferably 4 ° C, the centrifugation speed is preferably 4000-12000 rpm, more preferably 6000-10000 rpm, and more preferably 8000 ° C centrifugation, the centrifugation time is preferably 1-5 min, more preferably 2-4 min, and more preferably 3 min, the supernatant is discarded, and the bacteria are collected; the glycerol washing is to use ice-cold mass concentration of preferably 8-16%, more preferably 10-14%, and more preferably 12% glycerol to wash twice under the same conditions, discard the supernatant and then dilute, the dilution is to use a volume of preferably 80-120 μL, more preferably 90-110 μL, and more preferably 100 μL pre-cooled mass concentration of preferably 8-16%, more preferably 10-14%, and more preferably 12% glycerol to resuspend the bacteria to obtain competent cells,

[0024] Then, the gene editing plasmid was added to the competent cells, and after electroporation and shaking culture, IPTG was used for induction to obtain competent cells containing the gene editing plasmid.

[0025] In the present invention, the amount of gene editing plasmid added is preferably 200-600 ng, more preferably 300-500 ng, and more preferably 400 ng. The gene editing plasmid is preferably pCas#62225 plasmid. The voltage of the electric shock program is: 1800-2200 V, more preferably 1900-2100 V, and more preferably 2000 V; the capacitance of the click program is preferably 20-30 μF, more preferably 23-27 μF, and more preferably 25 μF; the resistance of the electric shock program is preferably 180-220 Ω, more preferably 190-210 Ω, and more preferably 200 Ω; the temperature of the shaker culture is preferably 25-35 ° C, more preferably 27-32 ° C, and more preferably 30 ° C; the speed of the shaker is preferably 180-260 rpm, more preferably 200-240 rpm, and more preferably 220 rpm; the shaker culture time is preferably 2-4 h, more preferably 2.5-3.5 h, more preferably 3 h; after the shaking culture is completed, the obtained bacterial liquid is spread on an LB (Kan) solid plate for culture, the culture temperature is preferably 25-35 ° C, more preferably 27-32 ° C, more preferably 30 ° C, the culture time is preferably 12-36 h, more preferably 18-28 h, more preferably 24 h; then a single colony is picked and inoculated into an LB (Kan) liquid medium for culture, the culture temperature is preferably 25-35 ° C, more preferably 27-32 ° C, more preferably 30 ° C, and cultured until the OD 600 =0.4, and then IPTG is added for induction, the final concentration of IPTG is preferably 0.05-0.2 mM, more preferably 0.07-0.15 mM, and further preferably 0.1 mM, and the induction time is preferably 0.5-2 h, more preferably 0.7-1.5 h, and further preferably 1 h, to prepare competent cells containing the gene editing plasmid.

[0026] In the present invention, the gRNA expression vector in step 2) preferably includes a pTargetF plasmid.

[0027] In the present invention, the gRNA expression vector and the functional module fusion fragment are transferred into the competent cells containing the gene editing plasmid and incubated, and then placed in a culture medium containing arabinose for culture, and then placed in a culture medium for culture to obtain the engineered strain; the transfer amount of the gRNA expression vector is preferably 150~250 ng, more preferably 180~220 ng, and more preferably 200 ng, and the transfer amount of the functional module fusion fragment is preferably 300~500 ng, more preferably 350~450 ng, and more preferably 400 ng; the transfer is electrical, and the voltage of the electric shock program is: 1800~2200 V, more preferably 1900~2100 V, and more preferably 2000 V; the capacitance of the click program is preferably 20~30 μF, more preferably 23~27 μF, and more preferably 25 μF; the resistance of the electric shock program is preferably 180~220 Ω, more preferably 190~210 Ω, and more preferably 200 Ω; the incubation is carried out on a shaker, the incubation temperature is preferably 25-35°C, more preferably 27-32°C, more preferably 30°C, the incubation speed is preferably 200-240 rpm, more preferably 210-230 rpm, more preferably 220 rpm, and the incubation time is preferably 2-4 h, more preferably 2.5-3.5 h, more preferably 3 h; the culture medium containing arabinose is preferably LB (Kan) liquid culture medium containing arabinose, the mass concentration of arabinose is 0.1%-0.5%, preferably 0.2%-0.4%, more preferably 0.3%; the culture temperature of the culture medium containing arabinose is 25-35°C, preferably 27-32°C, more preferably 30°C, and the culture time is preferably 8-16 h, more preferably 10-14 h, more preferably 12 h; and then cultured in a culture medium, wherein the culture medium is preferably LB liquid culture medium, the culture temperature is 35-40°C, preferably 36-38°C, more preferably 37°C, and the culture time is 12-24 h, preferably 14-22 h, more preferably 18 h.

[0028] The present invention provides application of the gene, the protein or the engineered strain in improving the synthesis yield of ergothioneine.

[0029] The present invention provides the use of the gene, the protein or the engineered strain in increasing the expression level of the EgtABCDE gene; The nucleotide sequence of EgtABCDE is shown in SEQ ID NO.3: SEQ ID NO.3:

[0030] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0031] Example 1

[0032] (1.1) Functional module SyCcaR

[0033] Through synthetic biology design, the full-length nucleic acid sequence of the functional module SyCcaR was obtained using artificial chemical synthesis. The length is 2782 bp, including the promoter region and coding region. The promoter region is 742 bp long, and the coding region is 2040 bp long. The specific nucleotide sequence is shown in SEQ ID NO. 1. The amino acid sequence of the protein transcribed from the functional module SyCcaR is shown in SEQ ID NO. 2, which is 679 amino acids long.

[0034] (1.2) Construction of gRNA expression vector

[0035] Design primers: pTargetF-yjiP_yjiR-F, the sequence is shown in SEQ ID NO.4: SEQ ID NO.4: gtcctaggtataatactagtGCTTAATTCAGGCTGGAACGgttttagagctagaaatag; pTargetF-yjiP_yjiR-R, the sequence is shown in SEQ ID NO.5: SEQ ID NO.5: ctatttctagctctaaaacCGTTCCAGCCTGAATTAAGCactagtattatacctaggac.

[0036] Synthesize the pTargetF plasmid with the N20 targeting sequence removed by inverse PCR: amplify the pTargetF plasmid by inverse PCR, and the reaction system is: 10 μM Primer pTargetF-yjiP_yjiRF 2 μL, 10 μM Primer pTargetF-yjiP_yjiRR 2 μL, pTargetF plasmid 200 ng, 2×Phanta Master Mix 25 μL, ddH2O Up to 50 μL.

[0037] The PCR products were excised and recovered by agarose gel electrophoresis. The recovered products were ligated using the ClonExpress seamless cloning kit. The ligation system was as follows: Recover product 400 ng, 2×ClonExpress Mix 5 μL, ddH2O up to 10 μL.

[0038] The ligation product was transformed into E. coli DH5α competent cells, and then verified by monoclonal colony PCR and sequencing.

[0039] TF (SEQ ID NO.6): ACGGTGAGCAGCACAATGACGCT; TR (SEQ ID NO. 7): GTAGGGATAACAGGGTAATAGA.

[0040] After picking a single colony, place it in a PCR tube as a PCR template. The colony PCR reaction system is as follows: 10 μM Forward Primer 1 μL, 10 μM Resverse Primer 1 μL, 2×Rapid TaqMaster Mix 10 μL, ddH2O Up to 20 μL.

[0041] Denaturation at 95°C for 3 min → (denaturation at 95°C for 30 s → annealing at 60°C for 30 s → extension at 72°C for 1 min) × 35 cycles → extension at 72°C for 5 min → storage at 4°C.

[0042] The nucleotide sequence of the Forward Primer 1 is shown in SEQ ID NO.8: SEQ ID NO.8: aggggggcggagcctatggaaaaac; The nucleotide sequence of the Resverse Primer 1 is shown in SEQ ID NO.9: SEQ ID NO.9: gacattgcactccaccgctgatgac.

[0043] Finally, Escherichia coli containing the gRNA expression vector was obtained, and the gRNA expression vector was extracted using a kit (commercially available product #MF076-01 from Beijing Polymer Biotechnology Co., Ltd.).

[0044] (1.3) Construction of gene recombination fusion DNA fragments

[0045] Design primers to amplify the upstream and downstream homology arm sequences of the genome inserted into the gRNA expression vector, which correspond to the breakpoints of the pTargetF plasmid with the N20 targeting sequence removed (see the specific connection method for details). Figure 1 ): The upstream homology arm amplification primers are UP-F and UP-R, respectively. The nucleotide sequence of UP-F is shown in SEQ ID NO.10, and the nucleotide sequence of UP-R is shown in SEQ ID NO.11: SEQ ID NO.10: tgatggggcttatcgatcaactggtagtat; SEQ ID NO. 11: AACGTTCAGCGCGTATGaaagtacgctttgttcatgc.

[0046] The downstream homology arm amplification primers are DOWN-F and DOWN-R, respectively. The nucleotide sequence of DOWN-F is shown in SEQ ID NO.12, and the nucleotide sequence of DOWN-R is shown in SEQ ID NO.13: SEQ ID NO.12: gcaggacgctgcacagtgatggcgatgacccagcaaaga; SEQ ID NO. 13: taaactgatgcatatgaaatacgccatcag.

[0047] The activator amplification primers are CcaR-F and CcaR-R, respectively. The nucleotide sequence of CcaR-F is shown in SEQ ID NO.14, and the nucleotide sequence of CcaR-R is shown in SEQ ID NO.15: SEQ ID NO.14: gcatgaacaaagcgtactttCATACGCGCTGAACGTT; SEQ ID NO.15: tctttgctgggtcatcgccatcactgtgcagcgtcctgc The three fragments were connected using a homologous recombination kit to obtain a functional module fusion fragment. The functional module fusion fragment was a fusion fragment of the upstream homology arm of the knock-in site with the gRNA expression vector, the functional module SyCcaR, and the downstream homology arm of the knock-in site with the gRNA expression vector, with a length of 3782 bp.

[0048] (1.4) Obtaining engineered strains integrating functional gene modules by electroporation

[0049] Pick a single colony of E. coli BW25113 and culture it at 37°C with a shaker at 220 rpm until the OD 600 = 0.6-0.8, 4 ℃, 8000 rpm centrifugation for 3 min to collect the bacteria, and use ice-cold 12% glycerol to wash twice under the same conditions. Finally, use 100 μL of pre-cold 12% glycerol to resuspend the bacteria. At this time, competent cells can be obtained.

[0050] 400 ng of pCas#62225 plasmid was added to the competent cells, and the cells were electroporated at 2000 V, 25 μF, 200 Ω, incubated at 30°C and 220 rpm for 3 h, and then spread on LB (Kan) solid plates to obtain E. coli BW25113 strain BW-pCas containing pCas#62225 plasmid. A single colony was picked and inoculated into LB (Kan) liquid medium and cultured at 30°C until OD 600 =0.4, and then induced with 0.1 mM IPTG for 1 h to prepare BW-pCas competent cells.

[0051] Take BW-pCas competent cells, add 400 ng functional module fusion fragment and 200 ng gRNA expression vector, and incubate at 2000 V, 25 μF, 200 Ω program electric shock, 30 ℃, 220 rpm for 3 hours. Then, spread the incubated culture on LB (Kan+Spec) solid plates to further identify positive clones. Pick single clones and inoculate them into LB (Kan) liquid medium supplemented with 0.2% arabinose to eliminate the pTargetF plasmid. Then, transfer the bacterial liquid to LB liquid medium with a 1% inoculum and culture for 18 hours to eliminate the pCas#62225 plasmid, obtaining the strain BW-CcaR with integrated gene module (for details of the functional module SyCcsR and chassis strain transformation, see the schematic diagram). Figure 1 ).

[0052] Among them, the pTargetF plasmid mainly expresses gRNA for guiding the Cas9 protein to target and cut the BW25113 genome; the main function of pCas#62225 is to express the Cas9 protein and the λ-RED homologous recombination system for targeted cutting and subsequent homologous recombination knock-in of the fusion fragment. The chassis strain genes were successfully integrated to construct a recombinant E. coli engineered strain expressing the functional module SyCcaR. The correct insertion sequence was verified by PCR, enzyme digestion, and sequencing, and the strain was named BW-CcaR. The control chassis strain BW25113 was prepared according to the method for preparing BW-CcaR as described above, except that the control chassis strain BW25113 does not have the functional module SyCcaR.

[0053] Example 2 Biosynthesis of ergothioneine in Escherichia coli

[0054] 1. Experimental Methods

[0055] 1. Construction of an ergothioneine-producing strain

[0056] The ergothioneine biosynthesis pathway genes EgtABCDE (gene ID: MSMEG_6250-MSMEG_6249-MSMEG_6248-MSMEG_6247-MSMEG_6246) were synthesized by chemical synthesis, and the sequence is shown in SEQ ID NO.3.

[0057] The target gene sequence is amplified from the target DNA by PCR.

[0058] PCR reaction program: 95°C denaturation for 5 min → (95°C denaturation for 30 s → 60°C annealing for 30 s → 72°C extension for 1 min) × 35 cycles → 72°C extension for 5 min → 4°C storage.

[0059] The PCR product S1 fragment was recovered by gel ligation and ligated to the pBAD-hisA vector containing sticky ends obtained by NcoⅠ / Hind III double enzyme digestion to construct the plasmid pBAD-EgtABCDE

[0060] The PCR primers are EGT-F and EGT-R, respectively. The nucleotide sequence of EGT-F is shown in SEQ ID NO.16, and the nucleotide sequence of EGT-R is shown in SEQ ID NO.17: SEQ ID NO.16: GCTAACAGGAGGAATTAACCATGGATGGCCTTACCCGCCAGAAGTG SEQ ID NO.17: TCATCCGCCAAAACAGCCAAGCTTTCAGGGCGCCTCACGCAACGCT The constructed expression vector pBAD-EgtABCDE was transformed into the chassis-optimized BW-CcaR and control Escherichia coli BW25113, and the strains were named BWR-E and BW-E.

[0061] 2. Induced expression and yield detection of ergothioneine engineered strains

[0062] Recombinant strains BWR-E and BW-E were activated, and a single colony was picked and inoculated into LB liquid medium containing ampicillin. The culture was shaken at 37°C and 220 rpm for 12 h to prepare a seed solution. The seed solution was transferred to 50 mL of antibiotic-free M9Y liquid medium (10 g / L glucose, 1 g / L yeast extract, 1 g / L NH4Cl, 8 g / L Na2HPO4, 5 g / L KH2PO4, 0.5 g / L NaCl, 1.5 g / L MgSO4·7H20, 0.02 g / L CaCl2·2H20) at an OD600 of 0.1 and shaken at 37°C and 220 rpm. During the culture period, when the OD600 light absorption value of the bacterial solution reached 0.8, L-arabinose was added to a final concentration of 3‰ and induced at 30°C, 220 rpm for 24 h. L-arabinose was then added again to a final concentration of 3‰ and induced for another 24 h.

[0063] Centrifuge at 8,000 × g for 10 min to collect the cells. Resuspend the cells in 2.5 mL of Bugbuster, add 0.3 μL of nuclease, and incubate at 26°C, 80 rpm for 20 min. Centrifuge at 8,000 × g for 30 min. Pass the supernatant through a 0.22 μm filter into a 5 mL centrifuge tube and store at -80°C until needed.

[0064] UPLC-MS / MS detection conditions

[0065] Chromatographic column: HypersilGOLD aQ column (100×2.1 mm, 1.9 μm, Thermo Scientific, USA); column temperature: 30°C; injector temperature: 4°C; mobile phase ratio: water / methanol = 99 / 1, flow rate: 0.3 mL / min, detection time: 20 min; injection volume: 5 μL.

[0066] Mass spectrometry conditions: electrospray ionization (ESI) source, positive ion mode scanning; ion source temperature: 250 ℃, nebulizer flow: 11 L / min, nebulizer gas pressure: 35 psi, sheath gas temperature: 250 ℃, sheath gas flow rate: 11 L / min, capillary voltage: 4000 V; ergothioneine in the recombinant strain was quantitatively analyzed by multiple reaction monitoring (MRM) mode.

[0067] Recombinant strains BWR-E and BW-E expressing the ergothioneine biosynthesis genes EgtABCDE from Mycobacterium smegmatis were successfully constructed using an E. coli expression system. BWR-E and BW-E strains were cultured in shake flasks, and the inducer L-arabinose was added to promote gene expression. LC-MS was used to verify the ergothioneine biosynthesis ability of the strains.

[0068] The results are as follows Figure 2 As shown in the figure, the peak time of the extracted sample is the same as that of the ergothioneine standard, and the mass-to-charge ratio of the sample (m / z=230) is consistent with that of the standard. This result shows that the recombinant strain BW-E successfully synthesizes ergothioneine. According to the standard curve, the ergothioneine production of strain BW-E after 48 hours of induction synthesis is 1.51 mg / L. In the recombinant strain BWR-E integrated with the chassis cell functional module SyCcaR, the ergothioneine production after 48 hours of induction synthesis is 7.07 mg / L, which is lower than that of the control strain BW-E, and the production is increased by 4.68 times. Figure 3 .

[0069] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A functional module SyCcaR for improving thioneine biosynthesis output, characterized in that, The nucleotide sequence of the functional module SyCcaR is shown in SEQ ID NO.

1.

2. A protein that improves thioneine biosynthesis output, characterized in that, The protein is encoded by the functional module SyCcaR according to claim 1; The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. An engineered strain for improving thioneine biosynthesis output, characterized in that, The engineered strain contains the functional module SyCcaR according to claim 1.

4. The method for preparing the engineered strain according to claim 3, characterized in that: The following steps are involved: 1) After the gene editing plasmid is introduced into competent cells, it is induced with IPTG to obtain competent cells containing the gene editing plasmid; 2) The gRNA expression vector and the functional module fusion fragment are transferred into competent cells containing a gene editing plasmid and incubated, and then placed in a culture medium containing 0.1% to 0.5% arabinose at 25 to 35°C for 8 to 16 hours, and then placed in a culture medium at 35 to 40°C for 12 to 24 hours to obtain the engineered strain; The gRNA expression vector is a plasmid in which the N20 targeting sequence is removed; The functional module fusion fragment is sequentially a fusion fragment of the upstream homology arm of the knock-in site with the gRNA expression vector, the functional module SyCcaR according to claim 1, and the downstream homology arm of the knock-in site with the gRNA expression vector.

5. The preparation method according to claim 4, characterized in that The gene editing plasmid includes pCas#62225.

6. The preparation method according to claim 4, characterized in that Step 2) The gRNA expression vector includes a pTargetF plasmid.

7. The preparation method according to claim 4, characterized in that The concentration of IPTG is 0.05-0.2 mM.

8. The preparation method according to claim 4, characterized in that The transfer method in step 1) or step 2) includes electroporation, wherein the electroporation procedure is 1800-2200 V, 23-27 µF, and 180-220 Ω.

9. Use of the gene described in claim 1, the protein described in claim 2 or the engineered strain described in claim 3 in improving the synthetic yield of thioneine.

10. Use of the gene according to claim 1, the protein according to claim 2, or the engineered strain according to claim 3 in increasing the expression level of the EgtABCDE gene; The nucleotide sequence of EgtABCDE is shown in SEQ ID NO.3.

Citation Information

Patent Citations

  • Production process and application of ergothioneine

    CN114854659A

  • High-yield ergothioneine engineering strain and method for producing ergothioneine by using same

    CN116355820A

  • Engineering bacterium for producing ergothioneine as well as construction method and application of engineering bacterium

    CN118755747A

  • Ergothioneine synthetic microorganisms, and method for producing ergothioneine

    JP2019149972A