A method for constructing and applying an engineered strain to enhance ergothioneine biosynthesis yield.
By constructing the functional module SyCcaR, the biosynthetic pathway of ergothionein was optimized, which solved the problem of low production performance of existing recombinant engineered strains and achieved a significant increase in ergothionein fermentation yield.
Patent Information
- Application Number
- CN202511020522.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-24
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2045-07-24
AI Technical Summary
Existing recombinant engineered strains have low performance in ergothioneine production, which is insufficient to meet the requirements for efficient biosynthesis.
The functional module SyCcaR was constructed to optimize the ergothioneine biosynthesis pathway and increase the expression level of the EgtABCDE gene through the fusion fragment of gene editing and gRNA expression vector.
It significantly increased the fermentation yield of ergothioneine, achieving a 4.68-fold increase in yield, and has important application value.
Smart Images

Figure CN120519451B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to a method for constructing an engineered strain that increases the biosynthetic yield of ergothionein and its application. Background Technology
[0002] Ergothioneine (ERG) is a natural amino acid derivative, a thiol compound derived from histidine. Studies have shown that ergothioneine has a variety of biological functions. It not only has strong antioxidant activity, such as scavenging hydroxyl radicals, chelating divalent metal ions, activating antioxidant enzymes, and inhibiting superoxide dismutase, but also has anti-inflammatory and cell-protective effects. Therefore, ergothioneine has been widely used in the food, pharmaceutical, and cosmetic fields.
[0003] The prokaryotic biosynthesis of ergothionein involves five enzymatic reactions. First, L-histidine methyltransferase EgtD catalyzes the formation of L-histidine betaine (HER) by transferring three methyl groups from S-adenosylmethionine to L-histidine. Then, gamma-glutamylcysteine synthase EgtA links glutamate and cysteine to form γ-glutamylcysteine (γ-GC). Next, the non-heme mononuclear iron-dependent enzyme EgtB catalyzes the formation of the CS bond between γ-GC and HER to form hexylenyl-glutamylcysteine sulfoxide (γGC-HER). Then, γ-glutamyl thiocysteine S-oxide hydrolase EgtC removes the L-glutamate (L-Glu) portion from γGC-HER to generate heptylacetylcysteine sulfoxide (Cys-HER). Finally, the CS bond is cleaved by the CS lyase EgtE, ultimately producing ergothionein.
[0004] Currently, the production of ergothioneine using biosynthesis has gradually become a research hotspot, but the production performance of recombinant engineered strains is generally low. Addressing the bottleneck in production performance of low-version chassis strains, improving cell activity and metabolic capacity under fermentation stress conditions in chassis cell factories by introducing artificially designed functional modules has become a current research focus in synthetic biology cell factories. Summary of the Invention
[0005] In view of this, the purpose of the present invention is to provide a method for constructing an engineered strain that increases the biosynthetic yield of ergothionein and its application.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0007] The present invention provides a functional module SyCcaR for increasing the biosynthetic yield of ergothionein, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0008] This invention provides a protein that increases the biosynthetic yield of ergothioneine, the protein comprising the aforementioned functional module.
[0009] Obtained through SyCcaR encoding;
[0010] The amino acid sequence of the protein is shown in SEQ ID NO.2.
[0011] This invention provides an engineered strain that increases the biosynthetic yield of ergothionein, the engineered strain containing the aforementioned functional module SyCcaR.
[0012] This invention provides a method for preparing the engineered strain, comprising the following steps:
[0013] 1) After introducing the gene-editing plasmid into competent cells, IPTG was used to induce competent cells containing the gene-editing plasmid.
[0014] 2) The gRNA expression vector and functional module fusion fragment were transferred into competent cells containing gene editing plasmid and incubated. The cells were then placed in a culture medium containing 0.1% to 0.5% arabinose at 25 to 35 °C for 8 to 16 h, and then placed in a culture medium at 35 to 40 °C for 12 to 24 h to obtain the engineered strain.
[0015] The gRNA expression vector is a plasmid with the N20 target sequence removed from it;
[0016] The functional module fusion fragment consists of, in sequence, the upstream homologous arm of the knock-in site carrying the gRNA expression vector, the functional module SyCcaR, and the downstream homologous arm of the knock-in site carrying the gRNA expression vector.
[0017] Preferably, the gene-editing plasmid includes pCas#62225.
[0018] Preferably, the gRNA expression vector in step 2) includes the pTargetF plasmid.
[0019] Preferably, the concentration of IPTG is 0.05~0.2 mM.
[0020] Preferably, the transfer method in step 1) or step 2) includes electrical conversion, wherein the electrical conversion procedure is 1800~2200 V, 23~27 µF, 180~220 Ω.
[0021] Application of the gene, the protein, or the engineered strain in increasing ergothionein synthesis yield.
[0022] The application of the gene, the protein, or the engineered strain in increasing the expression level of the EgtABCDE gene;
[0023] The nucleotide sequence of EgtABCDE is shown in SEQ ID NO.3.
[0024] Compared with the prior art, the present invention has the following beneficial effects:
[0025] This invention involves the artificial design and construction of a functional module, SyCcaR, which is used to optimize and modify engineered strains for the biosynthesis of ergothioneine. Studies have shown that the recombinant strains modified using this method exhibit a 4.68-fold increase in ergothioneine fermentation yield, demonstrating significant application value in the biosynthesis of the active product ergothioneine. Attached Figure Description
[0026] Figure 1 A schematic diagram of the functional module SyCcsR and the chassis strain modification;
[0027] Figure 2 The results of ergothioneine biosynthesis pathway and liquid chromatography-mass spectrometry (LC-MS) detection are shown. In this paper, A represents the ergothioneine synthesis principle, and B represents the comparison of peak times between the extracted sample and the ergothioneine standard.
[0028] Figure 3 Ergothionein yield analysis of the recombinant strain BWR-E with integrated functional module SyCcsR. Detailed Implementation
[0029] This invention provides a functional module SyCcaR for increasing ergothioneine biosynthesis yield, the nucleotide sequence of which is shown in SEQ ID NO.1:
[0030] SEQ ID NO.1:
[0031]
[0032] This invention provides a protein that increases the biosynthetic yield of ergothionein, the protein being encoded by the functional module SyCcaR;
[0033] The amino acid sequence of the protein is shown in SEQ ID NO.2:
[0034] SEQ ID NO.2:
[0035] .
[0036] This invention provides an engineered strain that increases the biosynthetic yield of ergothionein, the engineered strain containing the aforementioned functional module SyCcaR.
[0037] This invention provides a method for preparing the engineered strain, comprising the following steps:
[0038] 1) After introducing the gene-editing plasmid into competent cells, IPTG was used to induce competent cells containing the gene-editing plasmid.
[0039] 2) The gRNA expression vector and the functional module fusion fragment were transferred into competent cells containing gene editing plasmids and incubated to obtain the engineered strain;
[0040] The gRNA expression vector is a plasmid in which the N20 target sequence has been replaced;
[0041] The functional module fusion fragment consists of, in sequence, the upstream homologous arm of the knock-in site carrying the gRNA expression vector, the functional module SyCcaR, and the downstream homologous arm of the knock-in site carrying the gRNA expression vector.
[0042] In this invention, the gene-editing plasmid preferably includes pCas#62225, and the introduction method is preferably electroporation, specifically:
[0043] Select E. coli, preferably E. coli Single colonies of BW25113 were cultured on a shaker, and the bacterial cells were collected by centrifugation. The cells were washed with glycerol and diluted to obtain competent cells.
[0044] In this invention, the preferred temperature for shaking culture is 35-40°C, more preferably 36-38°C, and even more preferably 37°C. The preferred rotation speed of the shaking culture is 180-260 rpm, more preferably 200-240 rpm, and even more preferably 220 rpm. Culture is carried out until the OD (October Expiratory Time) is reached. 600 =0.6~0.8, preferably OD 600 =0.7; The centrifugation temperature is preferably 0~6 ℃, more preferably 1~5 ℃, and even more preferably 4 ℃; the centrifugation speed is preferably 4000~12000 rpm, more preferably 6000~10000 rpm, and even more preferably 8000 ℃; the centrifugation time is preferably 1~5 min, more preferably 2~4 min, and even more preferably 3 min; the supernatant is discarded and the bacterial cells are collected; the glycerol washing is performed using pre-cooled glycerol with a mass concentration of preferably 8~16%, more preferably 10~14%, and even more preferably 12% under the same conditions, followed by washing twice, discarding the supernatant, and then diluting. The dilution is performed using a volume of preferably 80~120 μL, more preferably 90~110 μL, and even more preferably 100 μL of pre-cooled glycerol with a mass concentration of preferably 8~16%, more preferably 10~14%, and even more preferably 12% to resuspend the bacterial cells, thus obtaining competent cells.
[0045] Then, the gene-editing plasmid was added to the competent cells, and after electroporation and shaking culture, the cells were induced with IPTG to obtain competent cells containing the gene-editing plasmid.
[0046] In this invention, the preferred amount of gene-editing plasmid added is 200-600 ng, more preferably 300-500 ng, and even more preferably 400 ng. The preferred gene-editing plasmid is pCas#62225. The voltage of the electroporation program is 1800-2200 V, more preferably 1900-2100 V, and even more preferably 2000 V. The preferred capacitance of the electroporation program is 20-30 μF, more preferably 23-27 μF, and even more preferably 25 μF. The preferred resistance of the electroporation program is 180-220 Ω, more preferably 190-210 Ω, and even more preferably 200 Ω. The preferred temperature for shaking incubation is 25-35 ℃, more preferably 27-32 ℃, and even more preferably 30 ℃. The preferred rotation speed of the shaking incubator is 180-260 rpm, more preferably 200-240 rpm, and even more preferably 220 rpm. The preferred shaking incubation time is 2-4 hours. The culture time is preferably 2.5-3.5 h, and even more preferably 3 h. After the shaker culture is completed, the obtained bacterial solution is spread on LB (Kan) solid plates for culture. The culture temperature is preferably 25-35℃, more preferably 27-32℃, and even more preferably 30℃. The culture time is preferably 12-36 h, more preferably 18-28 h, and even more preferably 24 h. Then, a single colony is picked and inoculated into LB (Kan) liquid medium for culture. The culture temperature is preferably 25-35℃, more preferably 27-32℃, and even more preferably 30℃, and cultured until OD (Organic Degree) reaches 0.5℃. 600 =0.4, then add IPTG for induction. The final concentration of IPTG is preferably 0.05~0.2 mM, more preferably 0.07~0.15 mM, and even more preferably 0.1 mM. The induction time is preferably 0.5~2 h, more preferably 0.7~1.5 h, and even more preferably 1 h, to prepare competent cells containing gene editing plasmid.
[0047] In this invention, the gRNA expression vector in step 2) preferably includes the pTargetF plasmid.
[0048] In this invention, a gRNA expression vector and a functional module fusion fragment are transferred into competent cells containing a gene-editing plasmid and incubated. The cells are then cultured in a medium containing arabinose, followed by further culture in a culture medium to obtain the engineered strain. The preferred amount of the gRNA expression vector is 150-250 ng, more preferably 180-220 ng, and even more preferably 200 ng. The preferred amount of the functional module fusion fragment is 300-500 ng, more preferably 350-450 ng, and even more preferably 400 ng. The transfer is electrotransfer, with the voltage of the electrotherapy program being 1800-2200 V, more preferably 1900-2100 V, and even more preferably 2000 V. The capacitance of the electrotherapy program is preferably 20-30 μF, more preferably 23-27 μF, and even more preferably 25 μF. The resistance of the electrotherapy program is preferably 180-220 Ω, more preferably 190-210 Ω, and even more preferably 200 Ω. Ω; the incubation is performed using a shaker, with the incubation temperature preferably 25~35℃, more preferably 27~32℃, and even more preferably 30℃; the incubation speed preferably 200~240 rpm, more preferably 210~230 rpm, and even more preferably 220 rpm; the incubation time preferably 2~4 h, more preferably 2.5~3.5 h, and even more preferably 3 h; the culture medium containing arabinose is preferably LB (Kan) liquid culture medium containing arabinose, with the arabinose mass concentration being 0.1%~0.5%, preferably 0.2%~0.4%, and even more preferably 0.3%; the culture temperature of the arabinose culture medium is 25~35℃, preferably 27~32℃, and even more preferably 30℃; the culture time is preferably 8~16 h, more preferably 10~14 h, and even more preferably 12 h. h; then place in a culture medium, preferably LB liquid medium, with a culture temperature of 35~40℃, preferably 36~38℃, more preferably 37℃, and a culture time of 12~24 h, preferably 14~22 h, more preferably 18 h.
[0049] This invention provides the application of the gene, the protein, or the engineered strain in increasing ergothioneine synthesis yield.
[0050] This invention provides the application of the gene, the protein, or the engineered strain in increasing the expression level of the EgtABCDE gene;
[0051] The nucleotide sequence of EgtABCDE is shown in SEQ ID NO.3:
[0052] SEQ ID NO.3:
[0053]
[0054] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0055] Example 1
[0056] (1.1) Functional Module SyCcaR
[0057] Using synthetic biology design modules, the full-length nucleic acid sequence of the functional module SyCcaR was obtained through artificial chemical synthesis. The sequence is 2782 bp in length and includes a promoter (742 bp) and a coding region (2040 bp). The specific nucleotide sequence is shown in SEQ ID NO.1. The amino acid sequence of the protein transcribed from the functional module SyCcaR is shown in SEQ ID NO.2, and is 679 amino acids in length.
[0058] (1.2) Construction of gRNA expression vector
[0059] Design primers:
[0060] pTargetF-yjiP_yjiR-F, the sequence is shown in SEQ ID NO.4:
[0061] SEQ ID NO.4:
[0062] gtcctaggtataatactagtGCTTAATTCAGGCTGGAACGgttttagagctagaaatag;
[0063] pTargetF-yjiP_yjiR-R, the sequence is shown in SEQ ID NO.5:
[0064] SEQ ID NO.5:
[0065] ctatttctagctctaaaacCGTTCCAGCCTGAATTAAGCactagtattatacctaggac.
[0066] The pTargetF plasmid with the N20 target sequence removed was synthesized using reverse PCR: The pTargetF plasmid was amplified by reverse PCR, and the reaction system was as follows:
[0067] 10 μM Primer pTargetF-yjiP_yjiRF 2 μL, 10 μM Primer pTargetF-yjiP_yjiRR 2 μL, pTargetF plasmid 200 ng, 2×Phanta Master Mix 25 μL, ddH2O Up to 50 μL.
[0068] PCR products were recovered by agarose gel electrophoresis. The recovered products were ligated using the ClonExpress Seamless Cloning Kit. The ligation system was as follows:
[0069] 400 ng of the recovered product, 5 μL of 2×ClonExpress Mix, and up to 10 μL of ddH2O.
[0070] The ligation product was transformed into *E. coli* DH5α competent cells, and subsequently validated by single-clone colony PCR and sequencing. The primers were then used for verification.
[0071] TF (SEQ ID NO.6): ACGGTGAGCAGCACAATGACGCT;
[0072] TR (SEQ ID NO. 7): GTAGGGATAACAGGGTAATAGA.
[0073] After picking a single colony, place it in a PCR tube as a PCR template. The colony PCR reaction system is as follows:
[0074] 10 μM Forward Primer 1 μL, 10 μM Resverse Primer 1 μL, 2×Rapid TaqMaster Mix 10 μL, ddH2O Up to 20 μL.
[0075] Denaturation at 95℃ for 3 min → (denaturation at 95℃ for 30 s → annealing at 60℃ for 30 s → extension at 72℃ for 1 min) × 35 cycles → extension at 72℃ for 5 min → storage at 4℃.
[0076] The nucleotide sequence of the Forward Primer 1 is shown in SEQ ID NO.8:
[0077] SEQ ID NO.8: aggggggcggagcctatggaaaaac;
[0078] The nucleotide sequence of the Resverse Primer 1 is shown in SEQ ID NO.9:
[0079] SEQ ID NO.9: gacattgcactccaccgctgatgac.
[0080] Finally, E. coli containing the gRNA expression vector were obtained, and the gRNA expression vector was extracted using a kit (commercially available product #MF076-01 from Beijing Polymer Biotechnology Co., Ltd.).
[0081] (1.3) Construction of DNA fragments through gene recombination and fusion
[0082] Design primers to amplify the upstream and downstream homologous arm sequences of the genome-inserted gRNA expression vector. These upstream and downstream homologous arm sequences correspond to the break points in the pTargetF plasmid after removing the N20 target sequence (see details for specific ligation methods). Figure 1 ):
[0083] The upstream homologous arm amplification primers are UP-F and UP-R, respectively. The nucleotide sequence of UP-F is shown in SEQ ID NO.10, and the nucleotide sequence of UP-R is shown in SEQ ID NO.11.
[0084] SEQ ID NO.10: tgatggggcttatcgatcaactggtagtat;
[0085] SEQ ID NO. 11: AACGTTCAGCGCGTATGaaagtacgctttgttcatgc.
[0086] The downstream homologous arm amplification primers are DOWN-F and DOWN-R, respectively. The nucleotide sequence of DOWN-F is shown in SEQ ID NO. 12, and the nucleotide sequence of DOWN-R is shown in SEQ ID NO. 13.
[0087] SEQ ID NO.12: gcaggacgctgcacagtgatggcgatgacccagcaaaga;
[0088] SEQ ID NO. 13: taaactgatgcatatgaaatacgccatcag.
[0089] The activator amplification primers are CcaR-F and CcaR-R, respectively. The nucleotide sequence of CcaR-F is shown in SEQ ID NO. 14, and the nucleotide sequence of CcaR-R is shown in SEQ ID NO. 15.
[0090] SEQ ID NO.14: gcatgaacaaagcgtactttCATACGCGCTGAACGTT;
[0091] SEQ ID NO.15: tctttgctgggtcatcgccatcactgtgcagcgtcctgc
[0092] The functional module fusion fragment was obtained by ligating three fragments using a homologous recombination kit. The functional module fusion fragment consists of the upstream homologous arm of the knock-in site of the gRNA expression vector, the functional module SyCcaR, and the downstream homologous arm of the knock-in site of the gRNA expression vector, with a length of 3782 bp.
[0093] (1.4) Obtaining engineered strains with integrated functional gene modules by electroconversion
[0094] Single colonies of Escherichia coli BW25113 were picked and cultured at 37 ℃ and 220 rpm on a shaker until OD reached. 600 Collect bacterial cells by centrifugation at 0.6-0.8 °C, 4 °C, and 8000 rpm for 3 min. Wash twice with pre-chilled 12% glycerol on ice under the same conditions. Finally, resuspend the bacterial cells in 100 μL of pre-chilled 12% glycerol. Competent cells can then be obtained.
[0095] 400 ng of pCas#62225 plasmid was added to competent cells, and the cells were incubated at 2000 V, 25 μF, 200 Ω with programmed electroporation at 30 ℃ and 220 rpm for 3 h. The cells were then plated onto LB (Kan) agar plates to obtain E. coli BW25113 strain BW-pCas containing pCas#62225 plasmid. Single colonies were picked and inoculated into LB (Kan) liquid medium and cultured at 30 ℃ until OD200. 600 =0.4, and then induced with 0.1 mM IPTG for 1 h to prepare BW-pCas competent cells.
[0096] BW-pCas competent cells were incubated with 400 ng of the functional module fusion fragment and 200 ng of gRNA expression vector. The cells were then incubated at 2000 V, 25 μF, 200 Ω, 30 ℃, 220 rpm for 3 h using a programmed electroporation method. The incubated culture was then plated on LB (Kan+Spec) agar plates to further identify positive clones. Single colonies were picked and cultured in LB (Kan) liquid medium supplemented with 0.2% arabinose to eliminate the pTargetF plasmid. The bacterial culture was then transferred to LB liquid medium at a 1% inoculum and cultured for 18 h to eliminate the pCas#62225 plasmid, resulting in the strain BW-CcaR, which integrates the gene module. (For a detailed schematic diagram of the functional module SyCcsR and the chassis strain modification, see [link to schematic diagram]). Figure 1 ).
[0097] The pTargetF plasmid primarily expresses gRNA to guide Cas9 protein targeting and cleaving the BW25113 genome; the pCas#62225 plasmid primarily expresses Cas9 protein and the λ-RED homologous recombination system for targeted cleavage and subsequent fusion fragment homologous recombination knock-in. A recombinant *E. coli* strain expressing the functional module SyCcaR was successfully constructed by integrating the chassis strain genes. The inserted sequence was verified to be correct by PCR, enzyme digestion, and sequencing, and this strain was named BW-CcaR. A control chassis strain, BW25113, was prepared using the same method as BW-CcaR, the difference being that the control chassis strain BW25113 did not contain the SyCcaR functional module.
[0098] Example 2: Biosynthesis of ergothionein in the chassis of Escherichia coli
[0099] I. Experimental Methods
[0100] 1. Construction of ergothionein-synthesizing strains
[0101] The ergothionein synthesis pathway gene EgtABCDE (gene ID: MSMEG_6250-MSMEG_6249-MSMEG_6248-MSMEG_6247-MSMEG_6246) was synthesized by chemical synthesis method, and its sequence is shown in SEQ ID NO.3.
[0102] The target gene sequence is amplified from the target DNA using PCR.
[0103] PCR reaction procedure: 95℃ denaturation for 5 min → (95℃ denaturation for 30 s → 60℃ annealing for 30 s → 72℃ extension for 1 min) × 35 cycles → 72℃ extension for 5 min → store at 4℃.
[0104] The S1 fragment of the PCR product was recovered from the gel and ligated into the pBAD-hisA vector containing sticky ends, obtained by double digestion with NcoI / Hind III, using recombinase to construct the plasmid pBAD-EgtABCDE.
[0105] The PCR primers are EGT-F and EGT-R, respectively. The nucleotide sequence of EGT-F is shown in SEQ ID NO.16, and the nucleotide sequence of EGT-R is shown in SEQ ID NO.17.
[0106] SEQ ID NO.16:
[0107] GCTAACAGGAGGAATTAACCATGGATGGCCTTACCCGCCAGAAGTG
[0108] SEQ ID NO.17:
[0109] TCATCCGCCAAAACAGCCAAGCTTTCAGGGCGCCTCACGCAACGCT
[0110] The constructed expression vector pBAD-EgtABCDE was transformed into chassis-optimized BW-CcaR and control Escherichia coli BW25113, and the strains were named BWR-E and BW-E.
[0111] 2. Induction and yield detection of ergothionein engineered strains
[0112] Recombinant bacteria BWR-E and BW-E were activated, and single colonies were picked and inoculated into LB liquid medium containing ampicillin. Seed culture was prepared by shaking at 37°C and 220 rpm for 12 h. The seed culture was then transferred to 50 mL of antibiotic-free M9Y liquid medium (10 g / L glucose, 1 g / L yeast extract, 1 g / L NH4Cl, 8 g / L Na2HPO4, 5 g / L KH2PO4, 0.5 g / L NaCl, 1.5 g / L MgSO4·7H2O, 0.02 g / L CaCl2·2H2O) at OD600=0.1 and cultured at 37°C and 220 rpm. During the culture period, when the OD600 absorbance of the bacterial culture reached 0.8, L-arabinose was added to a final concentration of 3‰ and induced at 30℃ and 220 rpm for 24 h. Then, L-arabinose was added again to a final concentration of 3‰ and induced for another 24 h.
[0113] Centrifuge at 8,000 ×g for 10 min and collect the bacterial cells. Resuspend the bacterial cells in 2.5 mL of Bugbuster solution, add 0.3 μL of nuclease, and incubate at 26 °C and 80 rpm for 20 min. Centrifuge at 8,000 ×g for 30 min, filter the supernatant through a 0.22 μm filter membrane, transfer to a 5 mL centrifuge tube, and store at -80 °C for later use.
[0114] UPLC-MS / MS detection conditions
[0115] Chromatographic column: HypersilGOLD aQ column (100×2.1 mm, 1.9 μm, Thermo Scientific, USA); column temperature: 30 ℃; injector temperature: 4 ℃; mobile phase ratio: water / methanol = 99 / 1; flow rate: 0.3 mL / min; detection time: 20 min; injection volume: 5 μL.
[0116] Mass spectrometry conditions: Electrospray ionization (ESI) was used in positive ion mode; ion source temperature: 250 ℃, nebulizer flow rate: 11 L / min, nebulizer gas pressure: 35 psi, sheath gas temperature: 250 ℃, sheath gas flow rate: 11 L / min, capillary voltage: 4000 V; ergothionein in the recombinant strain was quantitatively analyzed using multiple reaction detection (MRM) mode.
[0117] Recombinant strains BWR-E and BW-E, expressing the Mycobacterium smegmatis ergothioneine synthesis gene EgtABCDE, were successfully constructed using an Escherichia coli expression system. Strains BWR-E and BW-E were cultured in shake flasks, and gene expression was promoted by adding the inducer L-arabinose. The ergothioneine synthesis capacity of the strains was verified using LC-MS.
[0118] The results are as follows Figure 2 As shown, the elution times of the extracted sample and the ergothioneine standard were the same, and the mass-to-charge ratio (m / z=230) of the tested sample was consistent with that of the standard. This result indicates that the recombinant strain BW-E successfully synthesized ergothioneine. Calculations based on the standard curve showed that the ergothioneine yield of strain BW-E after 48 hours of induction was 1.51 mg / L. In contrast, the recombinant strain BWR-E integrated into the chassis cell functional module SyCcaR showed an ergothioneine yield of 7.07 mg / L after 48 hours of induction, which was 4.68 times lower than the control strain BW-E. (See details...) Figure 3 .
[0119] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A functional module SyCcaR for increasing ergothioneine biosynthesis yield, characterized in that, The nucleotide sequence of the functional module SyCcaR is shown in SEQ ID NO.
1.
2. A protein that enhances the biosynthetic yield of ergothionein, characterized in that, The protein is encoded by the functional module SyCcaR as described in claim 1; The amino acid sequence of the protein is shown in SEQ ID NO.
2.
3. An engineered strain that enhances the biosynthetic yield of ergothionein, characterized in that, The engineered strain contains the functional module SyCcaR as described in claim 1; The method for preparing the engineered strain includes the following steps: 1) After introducing the gene-editing plasmid into competent cells, IPTG was used to induce competent cells containing the gene-editing plasmid. 2) The gRNA expression vector and functional module fusion fragment were transferred into competent cells containing gene editing plasmid and incubated. The cells were then placed in a culture medium containing 0.1% to 0.5% arabinose at 25 to 35°C for 8 to 16 hours, and then placed in a culture medium at 35 to 40°C for 12 to 24 hours to obtain the engineered strain. The gRNA expression vector is a plasmid with the N20 target sequence removed from it; The functional module fusion fragment is, in sequence, a fusion fragment of the upstream homologous arm of the knock-in site with a gRNA expression vector, the functional module SyCcaR of claim 1, and the downstream homologous arm of the knock-in site with a gRNA expression vector. The gene-editing plasmid includes pCas#62225; The competent cells were competent cells of Escherichia coli BW25113; The engineered strain also contains the ergothioneine synthesis pathway gene EgtABCDE, the sequence of which is shown in SEQ ID NO.
3.
4. The engineered strain according to claim 3, characterized in that, Step 2) The gRNA expression vector includes the pTargetF plasmid.
5. The engineered strain according to claim 3, characterized in that, The concentration of IPTG is 0.05~0.2 mM.
6. The engineered strain according to claim 3, characterized in that, The transfer method described in step 1) or step 2) includes electrical conversion, wherein the electrical conversion procedure is 1800~2200 V, 23~27 µF, 180~220 Ω.
7. The application of the functional module SyCcaR of claim 1, the protein of claim 2, or the engineered strain of claim 3 in improving ergothioneine synthesis yield.
Citation Information
Patent Citations
Production process and application of ergothioneine
CN114854659A
High-yield ergothioneine engineering strain and method for producing ergothioneine by using same
CN116355820A