Lethal dsrna of brown planthopper and application thereof
By screening the lethal gene Nlug001039.1 of brown planthopper and preparing dsRNA, and using microinjection technology to interfere with its lethal gene, the environmental pollution problem of chemical pesticide control of brown planthopper was solved, providing an efficient and safe pest control method.
Patent Information
- Application Number
- CN202510708588.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-29
- Publication Date
- 2026-01-23
- Estimated Expiration
- 2045-05-29
AI Technical Summary
Chemical pesticides lead to pesticide resistance, environmental pollution, and harm to non-target organisms in the control of brown planthoppers, affecting the sustainability of the agricultural ecological environment. RNAi technology has potential in pest control but lacks effective targeting strategies.
The lethal gene fragment Nlug001039.1 of brown planthopper was screened out, and the corresponding dsRNA was prepared. It was introduced into brown planthoppers by microinjection to interfere with the expression of the lethal gene and prepare a formulation for the control of brown planthoppers.
It effectively kills brown planthoppers, has good environmental and ecological safety and food safety, and provides a new strategy for the application of RNAi technology in pest control.
Smart Images

Figure SMS_1
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural pest control technology, and in particular to lethal dsRNA of brown planthopper and its application. Background Technology
[0002] Brown planthoppers are a common type of rice planthopper and are currently the leading pest of rice in many Asian countries. Outbreaks of brown planthoppers can cause severe losses to rice production. For a long time, chemical pesticides have been the primary means of controlling brown planthoppers. However, with the overuse of chemical pesticides, problems such as pesticide resistance, environmental pollution, and harm to non-target organisms have become increasingly prominent, seriously affecting the sustainability of the agricultural ecological environment. RNA interference (RNAi) technology, as an emerging molecular biology tool, has shown significant potential in agricultural pest control due to its high specificity, low toxicity, and broad application prospects. RNAi targets and degrades the mRNA of pest genes through specific short double-stranded RNA (dsRNA), thereby inhibiting the expression of specific genes and interfering with the physiological functions of pests to achieve pest control. Compared with traditional chemical control methods, RNAi has high targeting and can reduce negative impacts on the environment and non-target organisms. Therefore, finding targeted and sustainable brown planthopper control strategies is of great significance.
[0003] In view of this, the present invention is hereby proposed. Summary of the Invention
[0004] To address the aforementioned technical problems, this invention provides a lethal dsRNA for brown planthoppers and its application.
[0005] Specifically, the technical solution provided by this invention is as follows:
[0006] In a first aspect, the present invention provides dsRNA of the lethal gene fragment Nlug001039.1 of the brown planthopper, the nucleotide sequence of which is shown in SEQ ID NO.4.
[0007] Secondly, the present invention provides a method for preparing the dsRNA, which includes the following steps: reverse transcribing total RNA of brown planthopper into cDNA, using the cDNA as a template, performing PCR amplification using the primer pair shown in SEQ ID No. 2 and SEQ ID No. 3, and in vitro transcribing the PCR amplification product into the dsRNA.
[0008] Thirdly, the present invention provides another method for preparing the dsRNA, which includes the following steps: using the gene fragment shown in SEQ ID No. 1 as a template, performing PCR amplification using the primer pair shown in SEQ ID No. 5 and SEQ ID No. 6, and in vitro transcribing the PCR amplification product to synthesize the dsRNA.
[0009] Fourthly, the present invention provides a biological material containing dsRNA or its encoding gene as described in SEQ ID NO.4.
[0010] Preferably, the biological material is a nucleic acid sequence, a recombinant vector, or a host cell.
[0011] Fifthly, the present invention provides the application of the dsRNA or the biological material in the control of brown planthoppers or in the preparation of products for the control of brown planthoppers.
[0012] In a sixth aspect, the present invention provides a method for controlling brown planthoppers, which kills brown planthoppers by interfering with a lethal gene fragment of the brown planthopper, wherein the lethal gene fragment of the brown planthopper is Nlug001039.1, and its nucleotide sequence is shown in SEQ ID NO.1.
[0013] Preferably, the present invention utilizes dsRNA to interfere with the lethal gene fragment of the brown planthopper, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.4.
[0014] Preferably, dsRNA is injected via microinjection at a concentration of 150-350 μg / mL.
[0015] In a seventh aspect, the present invention provides an agent for controlling brown planthoppers, which contains the aforementioned biological material and can effectively kill brown planthoppers through methods such as microinjection. Beneficial effects
[0016] This invention provides a lethal dsRNA for brown planthoppers and its application. The invention screened out a gene fragment Nlug001039.1 that, after interference, can cause death in brown planthoppers. Injecting brown planthoppers with the dsRNA (SEQ ID NO.4) of this gene fragment can effectively kill them, with good environmental and ecological safety and food safety. This invention establishes a new approach to control brown planthoppers using RNA interference technology. Detailed Implementation
[0017] This invention utilizes the transcriptome of the brown planthopper and screens target genes through gene co-expression network analysis. It has discovered an important target gene (the lethal gene fragment Nlug001039.1 of the brown planthopper) that can cause death after interference. At the same time, it provides the dsRNA of this lethal gene fragment Nlug001039.1 and its synthesis method, providing a sequence and data basis for establishing a new strategy for controlling pests using RNA interference technology.
[0018] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention are described clearly and completely below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.
[0019] The endpoints and any values of the ranges disclosed in this specification are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0020] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "specific implementation," or "some specific implementations," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.
[0021] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.
[0022] The sequences involved in the following embodiments include:
[0023] SEQ ID NO.1:
[0024]
[0025] SEQ ID NO.2:
[0026] TGGAACATGGTGCTCGAATA。
[0027] SEQ ID NO.3:
[0028] ACAGGTTAATGGCGTTCAGG。
[0029] SEQ ID NO.4:
[0030] GGATGGAACATGGTGCTCGAATACCTGATAGGTACGTCGGCGTGCGCATGCGCGTTGTCGGCCTGCTTTGATGCGTTGACCGACGGCGCCATCAGCAGTTTAGTCACCGAGTCCGTCGGAACTTTCTTTGGTCGGCCACCTGACTTTTTAGCGTTTGTGATAACGCTGCTGATGATGCTGTTGATGGCAGCCGGGGTGAAGAAGTCGCTGGTCTTCAACAACATCCTGAACGCCATTAACCTGTCAGCGTGGGTGTTCGTCATGACAGCTGGCATGTTCTACGTGAACACGGCCAACTGGTCAGAGCACAAGGGCTTCCTACCATACGGCTGGTCCGGGGTGTTCACGGGAGCAGCGACT。
[0031] SEQ ID NO.5:
[0032] TAATACGACTCACTATAGGGTGGAACATGGTGCTCGAATA。
[0033] SEQ ID NO.6:
[0034] TAATACGACTCACTATAGGGACAGGTTAATGGCGTTCAGG。 Example
[0035] Cloning of the Nlug001039.1 gene fragment:
[0036] Extract the total RNA of brown planthopper using the Trizol method.
[0037] RNA reverse transcription was performed using the Vazyme HiScript II Q Select RT SuperMix for qPCR kit.
[0038] The cDNA obtained by reverse transcription was diluted 10-fold with RNase-free H2O and used for subsequent PCR reactions. The PCR primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.
[0039] DNA fragments were recovered using the FastPure Gel DNA Extraction Mini Kit manufactured by Vazyme.
[0040] DNA clones were obtained by ligation using the pMD™19-T Vector Cloning Kit manufactured by Takara and by ligation transformation of competent E.coli DH5α Competent Cells. Example
[0041] dsRNA synthesis of the Nlug001039.1 gene fragment:
[0042] On the website https: / / www.flyrnai.org / cgi-bin / RNAi_find_primers.pl, input the target gene sequence to design primers, and try to control the product length to around 350bp. Add a T7 promoter sequence to the 5' end: 5'-TAATACGACTCACTATAGGG-3'. The primer sequences are shown in SEQ ID NO.5 and SEQ ID NO.6.
[0043] This example uses the Novizan T7 RNAi Transcription Kit. Example
[0044] Brown planthopper microinjection of dsRNA experiment:
[0045] (1) Preparation of the microinjection platform: Prepare a 2% agarose gel and melt it completely at high temperature. Then, pour the melted agarose gel into a sterile petri dish, ensuring that its thickness is uniform and sufficient to cover the toothpicks and capillaries placed therein, so as to form grooves adapted to the specific instar of brown planthopper. After the agarose has completely cooled and solidified, gently remove the toothpicks and capillaries, leaving grooves on the platform that match the shape of the insect, providing stable support for subsequent microinjection.
[0046] (2) Drawing capillary needles for injection: The P-97 Micropipette Puller was used for drawing. The material used was a microelectrode glass capillary (B10024F) produced by Chengdu Weitan Scientific Instruments. The drawing program parameters were set according to the experimental requirements: heating temperature (Heat) was set to 650, tensile force (Pull) was set to 300, tensile speed (Vel) was set to 150, and heating time (Time) was set to 150ms.
[0047] (3) Microinjection: The dsRNA liquid is injected into a capillary needle and fixed on a microinjector. The needle tip is cut to an appropriate thickness and length according to the brown planthopper's instar. The robotic arm of the injector is operated with a joystick to insert the capillary needle into the ventral side of the brown planthopper's thorax between the hind legs, and then the dsRNA is injected. During the injection, the brown planthopper's abdomen will be seen to swell slightly. In addition to injecting the target gene dsRNA, dsGFP is also injected as a control group. Each group is repeated with 50 plants. The concentration of dsRNA injected is approximately 150–350 μg / ml.
[0048] (4) Phenotypic observation: The injected brown planthopper nymphs were immediately transferred to glass test tubes containing fresh rice plants for rearing, and the mortality rate within 8 days was counted. The results are shown in Table 1.
[0049]
[0050] As shown in Table 1, injection of Nlug001039.1 dsRNA has a significant lethal effect on brown planthoppers.
[0051] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. The application of the dsRNA of the brown planthopper lethal gene fragment Nlug001039.1 in the control of brown planthoppers or in the preparation of products for the control of brown planthoppers, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID NO.
4.
2. The application according to claim 1, characterized in that, The dsRNA was prepared using a method comprising the following steps: total RNA of brown planthopper was reverse transcribed into cDNA; the cDNA was used as a template for PCR amplification using the primer pair shown in SEQ ID No. 2 and SEQ ID No. 3; and the PCR amplification product was transcribed in vitro to synthesize the dsRNA.
3. The application according to claim 1, characterized in that, The dsRNA is prepared using a method comprising the following steps: using the gene fragment shown in SEQ ID No. 1 as a template, PCR amplification is performed using the primer pair shown in SEQ ID No. 5 and SEQ ID No. 6, and the PCR amplification product is transcribed in vitro to synthesize the dsRNA.
4. The application of biological materials in the control of brown planthoppers or in the preparation of products for the control of brown planthoppers, characterized in that, The biological material contains dsRNA as described in SEQ ID NO.
4.
5. The application according to claim 4, characterized in that, The biological material is a nucleic acid sequence as shown in SEQ ID NO.4, a recombinant vector containing the dsRNA coding sequence, or a host cell containing the recombinant vector.
6. A method for controlling brown planthoppers, characterized by killing brown planthoppers by interfering with lethal gene fragments of brown planthoppers, wherein... The lethal gene fragment Nlug001039.1 of the brown planthopper was interfered with using dsRNA. The nucleotide sequence of Nlug001039.1 is shown in SEQ ID NO.1, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.
4.
7. The method for controlling brown planthoppers according to claim 6, characterized in that, dsRNA interference is achieved through microinjection at a concentration of 150-350 μg / mL.