A PRX gene and its applications and a peroxidase protein

By cloning and overexpressing the citrus CgPRX gene, the synthesis of lignin in citrus peel was promoted, which solved the problem of softening of citrus peel after harvest, increased peel hardness and lignin content, and provided a gene target for improved breeding.

CN120519484BActive Publication Date: 2026-06-30SOUTHWEST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510248044.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-04
Publication Date
2026-06-30
Estimated Expiration
2045-03-04

AI Technical Summary

Technical Problem

The softening of the peel after citrus harvest makes the fruit susceptible to pathogen infection, affecting its edibility and marketability. The role of the PRX gene in the lignin synthesis pathway of citrus fruit is unclear in the current technology.

Method used

The CgPRX24, CgPRX41, and CgPRX65 genes of citrus were cloned, and overexpression vectors were constructed. Citrus peel cells were transiently transformed using Agrobacterium tumefaciens-mediated transformation technology to promote lignin synthesis and increase peel firmness.

Benefits of technology

By promoting lignin synthesis in citrus peel, the hardness and lignin content of the peel are significantly increased, thus improving the texture and quality of the fruit and providing a target for genetic engineering breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519484B_ABST
    Figure CN120519484B_ABST
Patent Text Reader

Abstract

This invention discloses a PRX gene and its application, as well as a peroxidase protein, relating to type III peroxidases and their applications. The peroxidase protein encoded by the PRX gene, screened through a dry season database transcriptome, can participate in the synthesis of lignin in citrus peel. The PRX genes CgPRX24 / CgPRX41 / CgPRX65 of this invention can participate in the synthesis of lignin in citrus peel, promoting the firmness of the citrus peel. Simultaneously, they can serve as gene targets for genetic engineering and biopreservation of citrus, aiming to improve the peel texture during postharvest storage.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to type III peroxidases and their applications, specifically to a PRX gene and its applications, and a peroxidase protein. Background Technology

[0002] Cellular changes during the ripening and senescence of citrus fruits mainly include cell wall relaxation and chloroplast degradation. In the young fruit stage, the primary cell walls and middle lamella of fruit cells contain abundant pectin, cellulose, and other polysaccharides. During post-harvest storage, under the catalysis of various enzymes, the cell walls undergo deesterification and depolymerization reactions, converting insoluble pectin, cellulose, and hemicellulose into soluble components. This leads to the relaxation of the tightly packed cell walls, causing softening of the peel. Simultaneously, citrus fruits become more susceptible to pathogen infection, severely impacting their edibility and marketability.

[0003] Lignin is the second largest phenolic polymer on Earth after cellulose, accounting for approximately 30% of the organic carbon in the biosphere. Lignin is mainly deposited in the secondary cell walls of certain plant tissues, including xylem, sclerenchyma, and bast fibers. Lignin, along with cellulose and hemicellulose, forms the main components of secondary cell walls. The presence of lignin significantly enhances the mechanical strength, hydrophobicity, and resistance to adverse environments of plant cell walls. Therefore, identifying key genes involved in lignin synthesis can alleviate the problem of postharvest softening of citrus peel. A typical characteristic of citrus dehydration is the abnormal accumulation of lignin. Using the dehydration transcriptome as a database, functional genes related to lignin can be effectively identified, providing biological targets for improving the postharvest texture of citrus.

[0004] In the model plant Arabidopsis thaliana, lignin synthesis involves both lignin monomer synthesis and monomer polymerization. The PRX family primarily participates in the lignin monomer polymerization pathway; nine PRX genes have been reported to participate in lignin synthesis in Arabidopsis, and three in poplar. Because the lignification of parenchyma cells in fleshy fruits differs from the regulatory mechanisms of vascular tissues, only FaPRX27 in strawberry and EjPRX12 in loquat have been studied and verified to participate in lignin polymerization pathways in fleshy fruits. Whether PRX genes participate in lignin synthesis pathways in other fruits remains unclear. Therefore, studying the role of PRX genes in citrus fruits could enrich our understanding of fruit lignin synthesis pathways. Summary of the Invention

[0005] The purpose of this invention is to provide a PRX gene and its application, and a peroxidase protein, to solve the problem of softening of citrus peel after harvest in the prior art.

[0006] Firstly, this embodiment of the invention provides a PRX gene, which encodes a peroxidase protein that can participate in the synthesis of lignin in citrus peel.

[0007] Optionally, the PRX gene includes at least one of the CgPRX24 gene, CgPRX41 gene, and CgPRX65 gene;

[0008] The nucleotide sequence of the CgPRX24 gene is SEQ ID No. 1;

[0009] The nucleotide sequence of the CgPRX41 gene is SEQ ID No. 2;

[0010] The nucleotide sequence of the CgPRX65 gene is SEQ ID No. 3.

[0011] Secondly, to better address the aforementioned problems, this invention also provides an application of the PRX gene, comprising the following steps:

[0012] S1: Cloning the coding sequences of citrus CgPRX24 and / or CgPRX41 and / or CgPRX65;

[0013] S2: The coding sequence is cloned into a vector capable of expression in plant cells to construct an overexpression vector;

[0014] S3: Transform the overexpression vector into citrus peel cells to obtain transiently transformed samples.

[0015] Optionally, the method for cloning the citrus CgPRX24 and / or CgPRX41 and / or CgPRX65 coding sequences described in S1 includes:

[0016] Total RNA was extracted from citrus fruits and reverse transcribed into cDNA as a template.

[0017] PCR amplification was performed using primer pairs OE-CgPRX24-F and OE-CgPRX24-R and / or OE-CgPRX41-F and OE-CgPRX41-R and / or OE-CgPRX65-F and OE-CgPRX65-R.

[0018] The PCR amplification products were recovered to obtain DNA fragments encoding CgPRX24 and / or CgPRX41 and / or CgPRX65.

[0019] Optionally, the method for constructing the overexpression vector described in S2 includes:

[0020] DNA fragments encoding the CgPRX24 and / or CgPRX41 and / or CgPRX65 sequences were recovered by digestion with the restriction enzymes KpnⅠ and PstI.

[0021] The enzyme-digested DNA fragments were ligated into the KpnI and PstI-digested and recovered vector pCAMBIA2300 to construct overexpression vectors pCAMBIA2300-CgPRX24 and / or pCAMBIA2300-CgPRX41 and / or pCAMBIA2300-CgPRX65.

[0022] Optionally, the method for transforming the overexpression vector into citrus peel cells in step S3 includes:

[0023] The overexpression vectors pCAMBIA2300-CgPRX24 and / or pCAMBIA2300-CgPRX41 and / or pCAMBIA2300-CgPRX65 were transformed into Agrobacterium tumefaciens by heat shock.

[0024] The overexpression vector was transformed into citrus peel cells using Agrobacterium tumefaciens-mediated transformation technology.

[0025] Optionally, the nucleotide sequence of primer OE-CgPRX24-F is SEQ ID No. 4;

[0026] The nucleotide sequence of primer OE-CgPRX41-F is SEQ ID No. 5;

[0027] The nucleotide sequence of primer OE-CgPRX65-F is SEQ ID No. 6;

[0028] The nucleotide sequence of primer OE-CgPRX24-R is SEQ ID No. 7;

[0029] The nucleotide sequence of primer OE-CgPRX41-R is SEQ ID No. 8;

[0030] The nucleotide sequence of primer OE-CgPRX65-R is SEQ ID No. 9.

[0031] Optionally, the transiently transformed samples are used to study the function of the CgPRX24 and / or CgPRX41 and / or CgPRX65 genes in lignin synthesis in citrus peel.

[0032] Optionally, the method for studying the function of CgPRX24 and / or CgPRX41 and / or CgPRX65 genes in lignin synthesis in citrus peel includes:

[0033] The overexpression levels of CgPRX24 and / or CgPRX41 and / or CgPRX65 genes were detected by qRT-PCR, using primer pairs RT-CgPRX24-F and RT-CgPRX24-R and / or RT-CgPRX41-F and RT-CgPRX41-R and / or RT-CgPRX65-F and RT-CgPRX65-R.

[0034] PRX enzyme activity assay was performed to verify the activity of peroxidase protein;

[0035] The hardness of citrus peel was measured and the lignin content of citrus peel was determined.

[0036] The nucleotide sequence of primer RT-CgPRX24-F is SEQ ID No. 10;

[0037] The nucleotide sequence of primer RT-CgPRX41-F is SEQ ID No. 11;

[0038] The nucleotide sequence of primer RT-CgPRX65-F is SEQ ID No. 12;

[0039] The nucleotide sequence of primer RT-CgPRX24-R is SEQ ID No. 13;

[0040] The nucleotide sequence of primer RT-CgPRX41-R is SEQ ID No. 14;

[0041] The nucleotide sequence of primer RT-CgPRX65-R is SEQ ID No. 15.

[0042] Finally, this embodiment of the invention also provides a peroxidase protein encoded by the aforementioned PRX gene, which is used to participate in the synthesis of lignin in citrus peel.

[0043] Compared with the prior art, the embodiments of the present invention have the following advantages and beneficial effects:

[0044] 1. The PRX gene provided in this embodiment of the invention encodes a peroxidase protein (CgPRX24 / CgPRX41 / CgPRX65) that can participate in the synthesis of lignin in citrus peel and increase the hardness of citrus peel.

[0045] 2. In this embodiment of the invention, the CgPRX24 / CgPRX41 / CgPRX65 coding sequences of cloned citrus were overexpressed into a vector, and then transiently transformed into citrus peel. By promoting the lignin content of the peel, the hardness of the citrus peel was increased. This shows that the CgPRX24 / CgPRX41 / CgPRX65 genes can be used as gene targets for genetic engineering and breeding of citrus to improve fruit texture and quality. Attached Figure Description

[0046] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0047] Figure 1 Chromosomal mapping of the PRX gene family in grapefruit;

[0048] Figure 2 The diagram shows the protein and gene structures of the PRX gene family in grapefruit. Figure 2 A is a protein structure diagram of the PRX gene family in citrus. Figure 2 B is the gene structure diagram of the PRX gene family in grapefruit;

[0049] Figure 3 A graph showing the gene expression levels of the PRX gene family in grapefruit during different growing seasons in dry seasons;

[0050] Figure 4 A schematic diagram of constructing CgPRX24 / CgPRX41 / CgPRX65 onto pCAMBIA2300;

[0051] Figure 5 The diagram shows the correlation between the gene CgPRX24 and other genes. Figure 5 A is a phenotypic diagram of transient overexpression of CgPRX24 in grapefruit fruits. Figure 5 B is a graph showing gene expression levels after transient overexpression of CgPRX24 in grapefruit fruits. Figure 5 C is a graph showing the change in PRX enzyme activity after transient overexpression of CgPRX24 in grapefruit fruits. Figure 5 D is a graph showing the change in firmness after transient overexpression of CgPRX24 in grapefruit. Figure 5 E is a graph showing the lignin content after transient overexpression of CgPRX24 in grapefruit fruits. Figure 5 F is the phenotypic diagram of transient overexpression of CgPRX24 in sweet orange fruit. Figure 5 G is a graph showing the gene expression level after transient overexpression of CgPRX24 in sweet orange fruit. Figure 5 H is a graph showing the change in PRX enzyme activity after transient overexpression of CgPRX24 on sweet orange fruit. Figure 5 Figure I shows the change in firmness after transient overexpression of CgPRX24 on sweet orange fruit. Figure 5 J represents the lignin content after transient overexpression of CgPRX24 in sweet orange fruit;

[0052] Figure 6 The diagram shows the correlation between the gene CgPRX41 and other genes. Figure 6 A is a phenotypic diagram of transient overexpression of CgPRX41 in grapefruit fruits. Figure 6 B is a graph showing gene expression levels after transient overexpression of CgPRX41 in grapefruit fruits. Figure 6 C is a graph showing the changes in PRX enzyme activity after transient overexpression of CgPRX41 in grapefruit fruits. Figure 6 D shows the change in firmness in grapefruit after transient overexpression of CgPRX41. Figure 6 E is a graph showing the lignin content after transient overexpression of CgPRX41 in grapefruit fruits. Figure 6 F is the phenotypic diagram of transient overexpression of CgPRX41 in sweet orange fruit. Figure 6 G is a graph showing the gene expression level after transient overexpression of CgPRX41 in sweet orange fruit. Figure 6 H is a graph showing the change in PRX enzyme activity after transient overexpression of CgPRX41 on sweet orange fruit. Figure 6 Figure I shows the change in firmness after transient overexpression of CgPRX41 on sweet orange fruit. Figure 6 J is a graph showing the lignin content after transient overexpression of CgPRX41 on sweet orange fruit;

[0053] Figure 7 The diagram shows the correlation between the gene CgPRX65 and other genes. Figure 7 A is a phenotypic diagram of transient overexpression of CgPRX65 in grapefruit fruits. Figure 7 B is a graph showing gene expression levels after transient overexpression of CgPRX65 in grapefruit fruits. Figure 7 C is a graph showing the change in PRX enzyme activity after transient overexpression of CgPRX65 in grapefruit fruits. Figure 7 D is a graph showing the change in firmness after transient overexpression of CgPRX65 in grapefruit. Figure 7 E is a graph showing the lignin content after transient overexpression of CgPRX65 in grapefruit fruits. Figure 7 F is the phenotypic diagram of transient overexpression of CgPRX65 in sweet orange fruit. Figure 7 G is a graph showing the gene expression level after transient overexpression of CgPRX65 in sweet orange fruit. Figure 7 H is a graph showing the change in PRX enzyme activity after transient overexpression of CgPRX65 on sweet orange fruit. Figure 7 Figure I shows the change in firmness after transient overexpression of CgPRX65 on sweet orange fruit. Figure 7 J is a graph showing the lignin content after transient overexpression of CgPRX65 on sweet orange fruit. Detailed Implementation

[0054] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. The components of the embodiments of the present invention described and shown in the accompanying drawings can generally be arranged and designed in various different configurations.

[0055] Therefore, the following detailed description of the embodiments of the invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the invention without inventive effort are within the scope of protection of the invention.

[0056] It should be noted that similar labels and letters in the following figures indicate similar items. Therefore, once an item is defined in one figure, it does not need to be further defined and explained in subsequent figures.

[0057] In the description of this invention, it should be noted that the terms "first," "second," "third," etc., are used only for distinguishing descriptions and should not be construed as indicating or implying relative importance.

[0058] Example

[0059] The purpose of this invention is to identify key PRX genes involved in lignin synthesis during periods of low water levels, enrich the molecular mechanisms of citrus lignification, provide targeted gene targets for citrus variety texture improvement, and offer an application of PRX genes. Specific experimental methods are as follows:

[0060] 1. Genome-wide bioinformatics identification of the PRX gene family

[0061] Members of the type III PRX gene family in the citrus genome were identified. First, the amino acid sequences of all type III PRX genes were obtained from the Arabidopsis gene database TAIR11 (https: / / www.arabidopsis.org) as queries. Using the protein sequences of the grapefruit (Citrus grandis Osbeck.cv.'Wanbaiyou'v1.0) genome as a database, local Blasp analysis was performed. Sequences with an e-value > 1e-4 were considered potential PRX genes. Further Pfam analysis confirmed the presence of a conserved RPX domain (Pfam ID: PF00141). The resulting citrus PRX sequences were then used as queries, and the Arabidopsis database was Blaspinated. The identification of the genes was confirmed by checking if the Arabidopsis gene with the highest homology belonged to the type III PRX family. Based on the type III PRX gene family identification results, TBtools was used to display the chromosomal location, protein structure, and gene structure of the citrus gene family members. Figure 1 and Figure 2 As shown, a total of 88 PRX were identified in grapefruit, all of which have conserved peroxidase structures.

[0062] 2. Sampling of citrus fruits and dried juice vesicles

[0063] Red-fleshed pomelo (Citrus grandis) fruits used for citrus juice sac dehydration data analysis: Sampling was conducted in 2018, 2021, and 2022. Fruits were harvested after full ripeness (TSS > 10%), treated with prochloraz for sterilization, air-dried, and then individually bagged and placed in a cold storage at 8-10℃ and 80-85% relative humidity for 70 days. Afterward, at least 50 fruits were selected, and samples of normal and dehydrated juice sacs were taken and frozen at -80℃. Normal and dehydrated juice sacs from pomelo fruits with similar sugar and acid content, and uniform size and shape were sampled and subsequently stored at -80℃ for RNA-Seq analysis. Figure 3 As shown, the expression levels of CgPRX24 and CgPRX41 increased over the three growth seasons, while the expression level of CgPRX65 was significantly upregulated over one growth season.

[0064] 3. RNA extraction and cDNA synthesis

[0065] Total RNA was extracted from citrus juice cells using a plant total RNA extraction kit (Akerui, CAT: AG21101). RNA quality was verified by agarose gel electrophoresis, and its concentration was determined using a micro-nucleic acid quantification instrument. cDNA was synthesized using the EvoM-MLV Reverse Transcription Kit (Akerui, CAT: AG11734).

[0066] 4. PCR amplification of the coding sequences of CgPRX24 / CgPRX41 / CgPRX65

[0067] Using primers OE-CgPRX24-F (SEQ ID No. 4) / OE-CgPRX41-F (SEQ ID No. 5) /

[0068] OE-CgPRX65-F (SEQ ID No. 6), OE-CgPRX24-R (SEQ ID No. 7), OE-CgPRX41-R (SEQ ID No. 8), and OE-CgPRX65-R (SEQ ID No. 9) and high-fidelity enzymes

[0069] PhantaMax Super-Fidelity DNA Polymerase (Novozymes, CAT: P505) amplified DNA fragments encoding the CgPRX24 / CgPRX41 / CgPRX65 sequences from citrus cDNA. The fragment lengths were 1047 bp, 1008 bp, and 939 bp (containing restriction enzyme sites), respectively (see reference). Figure 4 The amplified DNA fragment was sequenced and identified as citrus.

[0070] The coding sequences of the CgPRX24 / CgPRX41 / CgPRX65 genes are (SEQ ID No. 1) / (SEQ ID No. 2) / (SEQ ID No. 3). Under UV light, agarose gel blocks containing the target fragments were cut off with a clean blade, and the DNA fragments were recovered using a kit (Akerui, CAT: AG21005).

[0071] PCR amplification program: 98℃, 30s; 98℃, 10s, 64℃, 30s, 72℃, 1min, 35 cycles; extension at 72℃ for 5min.

[0072] The nucleotide coding sequences of the citrus CgPRX24, CgPRX41, and CgPRX65 genes, SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3, are shown below:

[0073] SEQ ID No. 1:

[0074]

[0075] SEQ ID No.2:

[0076]

[0077] SEQ ID No.3:

[0078] ATGGCTGTGACATCAGTTCATTGCCAAGCAGGGACTCGTGTTGGATTTTATTCAAGGTCATGTCCTCGAGCTGAGTCCATAGTTAAGTCTACGGTTCAGGCTCATTTCAGGTCTGATCCCACAGTTGCTCCTGGGTTACTGAGGATGCATTTTCATGACTGTTTTGTCCACGGCTGTGATGCTTCCATTCTCATTAATGGCCCCAACACTGAGAAAACTGCACCACCCAACCGTCTGTTGAGAGGATATGATGTAATTGATGATGCCAAATCCCAGATTGAGGCTGCATGTCCTGGCATCGTCTCTTGCGCTGACATTCTTGCCCTCGCCGCCCGTGATTCTGTCGTCGTGACAAGAGGAATAAGTTGGCAAGTGCCCACAGGACGCAGAGATGGCAGGATATCATTGGCATCCGATACTGCCAATCTTCCAGGTTTCACCGAGTCTGTTGAAGCGCAAAAGCAAAAGTTTCTTGACAAGGGTTTGAACACTCAGGATCTTGTTACTCTTGTTGGAGCACATACAATCGGTACTACAGCTTGCCAAATATTTAAGTACAGACTTTATAACTTCACTACAACAACAGCAACAGGAGCTGATCCAACCATAGACGCTACGTTCATTCCTCAACTCCGTGCACTCTGTCCGGAGAACGGTGACGGAGCAAGGCGCGTTGCACTTGACACCGGTAGCCCTAATCGATTCGACACGTCCTTCTTCTCGAATTTGAGAAACGGGCGGGGAGTGCTAGAGTCTGATCAGAAGCTATGGAGTGATGCTTCTACTAAAGCGGTCGTGCAAAGGTTCTTGGGTGTGAGAGGATTGCTAGGGCTGACCTTCAATGTGGAGTTTGGAAGATCCATGGTTAAAATGAGTAACATTGGCGTCAAGACTGGCACTGATGGTGAAATTCGCAAAATATGTTCCGCAATTAACTAA

[0079] The nucleotide sequences of primers OE-CgPRX24-F, OE-CgPRX41-F, and OE-CgPRX65-F, SEQ ID No. 4, SEQ ID No. 5, and SEQ ID No. 6, are shown below:

[0080] SEQ ID No.4: actattctagggtaccATGGCTTCACTTCGTTATCTTCTTG

[0081] SEQ ID No.5: actattctagggtaccATGGGTACGAAAGCTGTCTTCTT

[0082] SEQ ID No.6: actattctagggtaccATGGAGGGTGCTTTTGCAGTAC

[0083] The nucleotide sequences of primers OE-CgPRX24-R, OE-CgPRX41-R, and OE-CgPRX65-R, SEQ ID No. 7, SEQ ID No. 8, and SEQ ID No. 9, are shown below:

[0084] SEQ ID No.7: ggtatctagactgcagGAAAGAGCTGACCAAATCACCC

[0085] SEQ ID No.8: ggtatctagactgcagGGACTTGTCGTGGAGCTTGTT

[0086] SEQ ID No.9: ggtatctagactgcagGTTAATTGCGGAACATATTTTGCGA

[0087] 5. Construction of CgPRX24 / CgPRX41 / CgPRX65 overexpression vectors

[0088] The CgPRX24 / CgPRX41 / CgPRX65 coding sequence DNA fragment and the overexpression vector pCAMBIA2300 were digested with restriction endonucleases KpnⅠ and PstⅠ, and then... The recombinant vector was ligated according to the instructions of the Basic Seamless Cloning and Assembly Kit (Trugen, CAT: CU201-02). The ligation product was transformed into E. coli DH5α, and plasmid extraction was performed using a plasmid extraction kit. PlasmidMiniPrepKit (Truly Gold, CAT:EM101-02) was used to extract plasmids from positive clones to obtain overexpression vectors of CgPRX24 / CgPRX41 / CgPRX65.

[0089] pCAMBIA2300-CgPRX24 / pCAMBIA2300-CgPRX41 / pCAMBIA2300-CgPRX65, etc. Figure 4 As shown.

[0090] 6. Transformation of Agrobacterium with overexpression vector

[0091] Remove competent GV3101 cells from the -80℃ freezer, gently thaw them by pinching them with your fingertips, and then place them on ice to thaw. Add approximately 0.01 μg of plasmid to 30 μl of the thawed competent cells (in an ice-water mixture), mix gently, and then perform the following steps: incubate on ice for 5 min, in liquid nitrogen for 5 min, incubate in a 37℃ water bath for 5 min, incubate on ice for 5 min, add 700 μL of LB medium (containing kanamycin and rifampin antibiotics), and incubate at 28℃ and 200 rpm for 2-3 h. Spread the culture on LB agar plates containing kanamycin and rifampin antibiotics and incubate upside down at 28℃ for 48-72 h. Verify positive single clones by colony PCR.

[0092] PCR reaction conditions: 95℃ for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 2 min, 35 cycles; 72℃ for 5 min.

[0093] 7. Preparation of Agrobacterium tumefaciens bacterial culture

[0094] Positive monoclonal antibodies were inoculated at a ratio of 1:100 into antibiotic-free medium (Kana, Rif) and incubated at 28°C and 220 rpm for 10-12 hours. The OD value was then calculated. 600 Bacterial culture was collected at 1.0-1.2°C, resuspended in extract (5 mM MES, 2 mM Na3PO4, 100 μL Macetosyringoned and 0.5% glucose) and its OD was adjusted. 600 The concentration should be between 0.8 and 0.9. After incubation at 28°C in the dark for 2 hours, injection can be performed.

[0095] 8. Instantaneous transformation of citrus peel

[0096] After harvesting, the fruits were immediately transported back to the laboratory for transient transfection. Fruits with uniform growth, free from disease and obvious mechanical damage were selected for the procedure. The fruits were pre-washed and soaked in 2% NaClO. Before injection, the fruit surface was disinfected with 75% alcohol. Each fruit was longitudinally divided into two parts, and four holes (2mm-5mm deep) were made at equal intervals along the equator using a sterile syringe tip. At least 1ml of bacterial suspension was injected into each hole. One side served as a control, injected with an empty vector, while the other side was injected with the target gene (e.g., [missing information]). Figure 5 A; Figure 5 F; Figure 6 A; Figure 6 F; Figure 6 A; Figure 6 F). After the bacterial solution is absorbed, wipe off any remaining marks on the fruit peel, and individually bag each fruit using a plastic bag. Store the fruit in the dark at 22-25℃ and 40-50% relative humidity. After 6-9 days of storage, take samples, peel off the peel according to the infected area of ​​the fruit, quickly chop the samples, freeze them in liquid nitrogen, and store them at -80℃.

[0097] 9. qRT-PCR analysis of fruits with overexpressed genes

[0098] Total RNA was extracted from the pericarp of the transgenic line (Aikerui, CAT: AG21101), and cDNA was synthesized using a reverse transcription kit. The expression level of the target gene was detected by qRT-PCR. The primer pairs used were RT-CgPRX24-F and RT-CgPRX24-R, RT-CgPRX41-F and RT-CgPRX41-R, and RT-CgPRX65-F and RT-CgPRX65-R. -△△Ct The relative expression levels of CgPRX24 / CgPRX41 / CgPRX65 genes in transgenic lines were calculated as follows: The empty vector-treated sample was defined as the reference factor, i.e., its CgPRX24 / CgPRX41 / CgPRX65 expression level was 1. Then, the fold increase in gene expression relative to the reference factor in transiently transgenic citrus was calculated. -△△Ct The relative expression levels were calculated, and the results showed that the CgPRX24 / CgPRX41 / CgPRX65 genes were expressed at higher levels in transiently transfected pericarps compared to untransfected pericarps, and were more than 1.5 times higher than the control (reference). Figure 5 B; Figure 5 G; Figure 6 B; Figure 6 G; Figure 7 B; Figure 7 G)

[0099] qRT-PCR reaction conditions: 95℃ for 30s; 95℃ for 5s; 60℃ for 30s, 40 cycles.

[0100] The nucleotide sequences of primers RT-CgPRX24-F, RT-CgPRX41-F, and RT-CgPRX65-F, SEQ ID No. 10, SEQ ID No. 11, and SEQ ID No. 12, are shown below:

[0101] SEQ ID No.10: AGGCATGTCGAAGGGTTGTTTCC

[0102] SEQ ID No.11: GCCGAGGACATTATCAGGGAACAAG

[0103] SEQ ID No.12:GCATGTCCTGGCATCGTCTCTTG

[0104] The nucleotide sequences of primers RT-CgPRX24-R, RT-CgPRX41-R, and RT-CgPRX65-R, SEQ ID No. 13, SEQ ID No. 14, and SEQ ID No. 15, are shown below:

[0105] SEQ ID No.13: GCCGTTCTGCTGTCTCTCTTCC

[0106] SEQ ID No.14: AAGCATCACAAGACTGGACAGCAC

[0107] SEQ ID No.15: CCTGGAAGATTGGCAGTATCGGATG

[0108] 10. PRX enzyme activity assay

[0109] 0.2g of sample was thoroughly ground with liquid nitrogen and then added to 5ml of acetate-sodium acetate buffer (pH 5.5, containing 1mmol PEG, 4% PVPP, and 1% Triton X-100). The mixture was centrifuged at 12000g at 4℃ for 30min. The supernatant was the crude enzyme solution. The volume was estimated before proceeding with subsequent reactions. The reaction system consisted of 3ml guaiacol solution, 0.5ml enzyme solution, and 0.2ml hydrogen peroxide solution. Timing was started immediately after mixing. The absorbance at 470nm was measured at 30s as the initial value. Absorbance changes were recorded every 30s for 3 minutes. Distilled water was used as a control. Results are expressed as protein content in Umin. -1 mg - 1 Protein expression was used. Results showed that overexpression of CgPRX24 / CgPRX41 / CgPRX65 resulted in at least a 1.3-fold increase in PRX enzyme activity compared to the control group. (Reference) Figure 5 C; Figure 5 H; Figure 6 C; Figure 6 H; Figure 7 C; Figure 7 H).

[0110] 11. Determination of pericarp hardness

[0111] Fruit firmness was determined using an FTA fruit texture analyzer. For fruit with a navel-shaped opening, a 1mm probe was used with measurement parameters set to a test speed of 30mm / s and a test distance of 3.5mm. Firmness was measured around the injection hole. For pomelo peel, the yellow layer was removed, leaving a 1.5-2cm thick white layer with bacterial residue. A 2.5mm probe was used with a test distance of 2mm for firmness measurement. Results showed that overexpression of CgPRX24 / CgPRX41 / CgPRX65 increased peel firmness by 8%-28%. (Reference) Figure 5 D; 5I; 6D; 6I; 7D; 7I).

[0112] 12. Determination of lignin content

[0113] Weigh 0.2g of sample and grind it into powder using an automatic grinder. Add 5ml of 100% ethanol to the sample, vortex to mix, and centrifuge at 12000g for 10min at 4℃. Discard the supernatant. Add 3ml of 95% ethanol solution to the sample, vortex to mix, and centrifuge at 12000g for 5min at 4℃. Discard the supernatant. Repeat 3 times. Add 3ml of ethanol:n-hexane (v / v 1:2) to the precipitate, vortex to mix, and centrifuge at 12000g for 5min at 4℃. Discard the supernatant. Repeat 3 times. Dry the precipitate overnight at 70℃. Add 25% bromoacetyl (soluble in acetic acid) to the dried precipitate, heat in a 70°C water bath for 30 min, cool to 25°C, add 0.9 ml of 2 mol / L NaOH to terminate the reaction, vortex to mix, and centrifuge at 12000 g for 15 min at 4°C. The blank is the added reagent solution. Dilute the supernatant after centrifugation and measure the absorbance at 280 nm using an ELISA reader. The results are expressed as 10⁻⁶. 3 OD 280 kg -1 FreshWeight (FW) stated that the results showed that overexpression of CgPRX24 / CgPRX41 / CgPRX61 could increase lignin content by 12%-50%, indicating that CgPRX24 / CgPRX41 / CgPRX61 mainly improves fruit peel firmness by increasing fruit lignin content. (Reference) Figure 5 E; 5J; 6E; 6J; 7E; 7J).

[0114] Test results

[0115] Overall, compared with the control fruit, the peel firmness of pomelo and sweet orange fruits increased and the lignin content increased after successful transient overexpression of CgPRX24 / CgPRX41 / CgPRX65. Therefore, CgPRX24 / CgPRX41 / CgPRX65 can be a potential target for improving the texture of citrus fruits.

[0116] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the invention should be included within the scope of protection of the invention. It should be noted that the structures or components illustrated in the accompanying drawings are not necessarily drawn to scale, and descriptions of well-known components, processing techniques, and processes have been omitted to avoid unnecessarily limiting the invention.

Claims

1. The application of a PRX gene in promoting lignin synthesis in citrus peel, characterized in that, The peroxidase protein encoded by the PRX gene can participate in the synthesis of lignin in citrus peel; the PRX gene is at least one of the CgPRX24 gene, CgPRX41 gene and CgPRX65 gene. The nucleotide sequence of the CgPRX24 gene is SEQ ID No. 1; The nucleotide sequence of the CgPRX41 gene is SEQ ID No. 2; The nucleotide sequence of the CgPRX65 gene is SEQ ID No.

3.

2. The application of the PRX gene in promoting lignin synthesis in citrus peel according to claim 1, characterized in that, Includes the following steps: S1: Cloning the coding sequences of citrus CgPRX24 and / or CgPRX41 and / or CgPRX65; S2: The coding sequence is cloned into a vector capable of being expressed in plant cells to construct an overexpression vector; S3: Transform the overexpression vector into citrus peel cells to obtain transiently transformed samples.

3. The application of the PRX gene in promoting lignin synthesis in citrus peel according to claim 2, characterized in that, The method for cloning the citrus CgPRX24 and / or CgPRX41 and / or CgPRX65 coding sequences described in S1 includes: Total RNA was extracted from citrus fruits and reverse transcribed into cDNA as a template. PCR amplification was performed using primer pairs OE-CgPRX24-F and OE-CgPRX24-R and / or OE-CgPRX41-F and OE-CgPRX41-R and / or OE-CgPRX65-F and OE-CgPRX65-R. The PCR amplification products were recovered to obtain DNA fragments encoding CgPRX24 and / or CgPRX41 and / or CgPRX65.

4. The application of the PRX gene in promoting lignin synthesis in citrus peel according to claim 2, characterized in that, The method for constructing the overexpression vector described in S2 includes: DNA fragments encoding the CgPRX24 and / or CgPRX41 and / or CgPRX65 sequences were recovered by digestion with the restriction enzymes KpnⅠ and PstI. The enzyme-digested DNA fragments were ligated into the KpnI and PstI-digested and recovered vector pCAMBIA2300 to construct overexpression vectors pCAMBIA2300-CgPRX24 and / or pCAMBIA2300-CgPRX41 and / or pCAMBIA2300-CgPRX65.

5. The application of the PRX gene in promoting lignin synthesis in citrus peel according to claim 2, characterized in that, The method in S3 for converting the overexpression vector into citrus peel cells includes: The overexpression vectors pCAMBIA2300-CgPRX24 and / or pCAMBIA2300-CgPRX41 and / or pCAMBIA2300-CgPRX65 were transformed into Agrobacterium tumefaciens by heat shock. The overexpression vector was transformed into citrus peel cells using Agrobacterium tumefaciens-mediated transformation technology.

6. The application of the PRX gene according to claim 3 in promoting the synthesis of lignin in citrus peel, characterized in that, The nucleotide sequence of primer OE-CgPRX24-F is SEQ ID No. 4; The nucleotide sequence of primer OE-CgPRX41-F is SEQ ID No. 5; The nucleotide sequence of primer OE-CgPRX65-F is SEQ ID No. 6; The nucleotide sequence of primer OE-CgPRX24-R is SEQ ID No. 7; The nucleotide sequence of primer OE-CgPRX41-R is SEQ ID No. 8; The nucleotide sequence of primer OE-CgPRX65-R is SEQ ID No.

9.

7. The application of the PRX gene in promoting lignin synthesis in citrus peel according to claim 2, characterized in that, The transient transformation samples were used to study the function of the CgPRX24 and / or CgPRX41 and / or CgPRX65 genes in lignin synthesis in citrus peel.

8. The application of the PRX gene according to claim 7 in promoting the synthesis of lignin in citrus peel, characterized in that, The methods for studying the function of CgPRX24 and / or CgPRX41 and / or CgPRX65 genes in lignin synthesis in citrus peel include: The overexpression levels of CgPRX24 and / or CgPRX41 and / or CgPRX65 genes were detected by qRT-PCR. The primer pairs for detection were RT-CgPRX24-F and RT-CgPRX24-R and / or RT-CgPRX41-F and RT-CgPRX41-R and / or RT-CgPRX65-F and RT-CgPRX65-R. PRX enzyme activity assay was performed to verify the activity of peroxidase protein; The hardness of citrus peel was measured and the lignin content of citrus peel was determined. The nucleotide sequence of primer RT-CgPRX24-F is SEQ ID No. 10; The nucleotide sequence of primer RT-CgPRX41-F is SEQ ID No. 11; The nucleotide sequence of primer RT-CgPRX65-F is SEQ ID No. 12; The nucleotide sequence of primer RT-CgPRX24-R is SEQ ID No. 13; The nucleotide sequence of primer RT-CgPRX41-R is SEQ ID No. 14; The nucleotide sequence of primer RT-CgPRX65-R is SEQ ID No.

15.

9. The application of the PRX gene according to claim 1 in promoting the synthesis of lignin in citrus peel, characterized in that, The PRX gene encodes a peroxidase protein, which is used to participate in the synthesis of lignin in citrus peel.