Short nucleic acid fragment sequencing method
By performing two rounds of amplification of the lengthened sequence at both ends of the short nucleic acid fragment primers, the accuracy and cost of the first-generation sequencing of short nucleic acid fragments are solved, and efficient and low-cost short nucleic acid fragment sequencing is achieved.
Patent Information
- Application Number
- CN202510753339.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-06
- Publication Date
- 2025-08-22
- Estimated Expiration
- 2045-06-06
AI Technical Summary
The prior art is difficult to efficiently and at low cost to perform first-generation sequencing of short nucleic acid fragments, especially fragments of 50-200 bp, and there are accuracy and reliability problems.
After one round of PCR amplification, a general short sequence of 20-25 bp was artificially added to both ends of the short nucleic acid fragment specific primer, and a general long sequence of 40-55 bp was added for two rounds of amplification, to obtain an extended sequencing fragment and directly perform first-generation sequencing.
The first-generation sequencing accuracy of short nucleic acid fragments is achieved, and the operation is simple and fast, reducing costs and cumbersome cloning and sequencing steps and time are reduced.
Smart Images

Figure CN120519559A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular biology, and in particular, relates to a universal method for first-generation sequencing of short nucleic acid fragments. Background Art
[0002] With the advancement of physical and chemical technologies, DNA sequencing has seen significant growth. Despite the rapid development of biotechnology, first-generation sequencing (NGS) continues to be used in a wide range of scenarios, including SNP and methylation detection. Sanger sequencing is a representative example of NGS technology. Using the DNA to be tested as a template, Sanger sequencing replicates a large number of DNA fragments while simultaneously interfering with the replication process by terminating the extension of the DNA chain using dideoxynucleotides (ddNTPs). ddNTPs randomly terminate this extension process, resulting in a large number of DNA fragments with the same starting point but different endpoints. Electrophoresis is used to separate the fragments, and the fluorescence generated by the ddNTPs varies depending on the end point they are cut off. The DNA nucleotide sequence can be deduced based on the color of the fluorescence and the length of the fragment.
[0003] Generally speaking, first-generation sequencing requires sequencing lengths of several hundred base pairs (bp) or more to ensure good accuracy and reliability. This is primarily due to residual dye monomers generating interference peaks that overlap with normal sequence peaks. Furthermore, the voltage stabilizes during the initial electrophoresis phase, preventing clear reading of the first 20-50 bp immediately following the primer, which can sometimes result in longer fragments being unable to be read clearly.
[0004] Therefore, short nucleic acid fragments (50-200bp) are difficult to directly read using first-generation sequencing. Cloning sequencing (TA cloning) is generally used. This involves ligating the short-fragment amplicon to a plasmid, transforming the plasmid into an engineered bacterium (E. coli), screening for successful plasmids, extracting the plasmid nucleic acid, and performing first-generation sequencing using universal primers on the plasmid. This method is time-consuming and expensive. Alternatively, a pair of primers can be designed outside the short-fragment amplicon to increase the amplification product to greater than 200bp. The short fragment is then placed inside the amplification product, and first-generation sequencing is performed using the outer primers. However, this method requires redesigning primers each time, making it less universal.
[0005] Therefore, it is very necessary to develop a simple, fast, and universal short-fragment sequencing method and make rational use of it, which will help improve sequencing efficiency and reduce sequencing costs. Summary of the Invention
[0006] In order to make up for the deficiencies of the prior art, the present invention aims to provide a method that can reduce the cost of sequencing short nucleic acid fragments and improve sequencing efficiency and accuracy.
[0007] In order to achieve the above object, the present invention adopts the following technical solutions:
[0008] A first aspect of the present invention provides a universal method for first-generation sequencing of short nucleic acid fragments.
[0009] Furthermore, the method comprises:
[0010] 1) Primer synthesis is performed by adding a universal short sequence to the 5' end of the upstream and downstream primers specific for the target short nucleic acid fragment;
[0011] 2) performing a first round of amplification on the target short nucleic acid fragment using the above primers to obtain a one-round extended amplification product with the above universal short sequence added to both ends of the target short nucleic acid fragment;
[0012] 3) Performing a second round of amplification on the aforementioned extended amplification product using a universal long primer to obtain a second round of amplification product;
[0013] 4) Perform first-generation sequencing on the second-round amplification products.
[0014] Furthermore, the length of the short nucleic acid fragment is 50 bp to 200 bp.
[0015] Furthermore, the length of the universal short sequence in step 1) is 20 bp to 25 bp.
[0016] Preferably, the universal short sequence added to the 5' end of the target short nucleic acid fragment-specific upstream primer in step 1) is as shown in SEQ ID NO: 1.
[0017] Preferably, the universal short sequence added to the 5' end of the target short nucleic acid fragment-specific downstream primer in step 1) is as shown in SEQ ID NO: 2.
[0018] Furthermore, the universal long primers in step 3) include a universal upstream long primer and a universal downstream long primer.
[0019] Furthermore, the universal upstream long primer is composed of a universal upstream long sequence and the universal short sequence added to the 5' end of the target short nucleic acid fragment-specific upstream primer described in step 1).
[0020] Furthermore, the universal long downstream primer is composed of a universal long downstream sequence and the universal short sequence added to the 5' end of the target short nucleic acid fragment-specific downstream primer described in step 1).
[0021] Preferably, the universal upstream long sequence is shown as SEQ ID NO: 3.
[0022] Preferably, the universal downstream long sequence is shown as SEQ ID NO:4.
[0023] Preferably, the universal upstream long primer is shown as SEQ ID NO: 5.
[0024] Preferably, the universal downstream long primer is shown as SEQ ID NO: 6.
[0025] Furthermore, the sequencing primers for first-generation sequencing in step 4) are designed for the extended fragments at both ends of the second-round amplification product.
[0026] Preferably, the base sequence of the upstream primer for first-generation sequencing is shown in SEQ ID NO: 7;
[0027] Preferably, the base sequence of the downstream primer for first-generation sequencing is shown as SEQ ID NO:8.
[0028] In order to solve the problem of inaccurate first-generation sequencing results of short nucleic acid fragments, the present invention provides a method for first-generation sequencing of universal short nucleic acid fragments. The design idea is as follows: the present invention artificially adds a 20bp-25bp universal short sequence at both ends of the target short nucleic acid fragment-specific primer, synthesizes the primer, and then undergoes a round of PCR amplification to obtain a round of lengthened amplification products; again, a universal long sequence is added to both ends of the above-mentioned 20bp-25bp universal short sequence to form a universal long primer, and a second round of amplification is performed to obtain an amplification product with 60bp-70bp fragments extended at both ends of the target short nucleic acid fragment. The second-round amplification product is directly subjected to first-generation sequencing, and the lengthened fragment offsets the influence of 20bp-50bp before first-generation sequencing, thereby achieving accurate sequencing of the short nucleic acid fragment. Moreover, the usual long primers used in the second round of amplification and the sequencing primers for first-generation sequencing can be used multiple times, and can effectively amplify any short nucleic acid fragment, greatly reducing the economic cost.
[0029] In the present invention, a primer refers to a short nucleic acid molecule that can anneal to a complementary target nucleic acid molecule through nucleic acid hybridization, forming a hybrid between the primer and the target nucleic acid strand. The primer can be extended along the target nucleic acid molecule by a polymerase. Therefore, the primer can be used to amplify the target nucleic acid molecule. In the present invention, upstream and downstream primers specific for the target short nucleic acid fragment refer to primers whose sequences are specific for the target nucleic acid molecule.
[0030] In the present invention, the universal short sequences added to the 5' end of the upstream primer and the 5' end of the downstream primer specific for the target short nucleic acid fragment are preferably different sequences. The present invention does not limit the base composition of the universal short sequences added to the 5' end of the upstream and downstream primers specific for the target short nucleic acid fragment, as long as the length is between 20 bp and 25 bp.
[0031] In the present invention, the universal long primer is composed of a universal long sequence and the universal short sequence described in step 1). In the second round of amplification, the universal short sequence is equivalent to a specific primer for a round of lengthened amplification products. The purpose of adding the universal long sequence is to continue to lengthen the fragments at both ends of a round of lengthened amplification products, thereby reducing the deviation of sequencing of short nucleic acid fragments. In the present invention, the universal long primer includes a universal upstream long primer and a universal downstream long primer. The universal upstream long primer is equivalent to the upstream primer F2 described in the present invention, and the universal downstream long primer is equivalent to the downstream primer R2 described in the present invention. The present invention does not limit the base composition of the universal long sequence, as long as its length is between 40bp and 55bp. Because the universal long primer described in the present invention contains the specific primer for the first round of amplification of the lengthened fragment, the universal primer described in the present invention is suitable for the second round of amplification for any target short nucleic acid fragment.
[0032] Furthermore, the amplification system for the first round of amplification is: 10 μL amplification mix, 1 μL upstream primer, 1 μL downstream primer, and 8 μL nucleic acid.
[0033] Furthermore, the reaction procedure of the first round of amplification is: 95°C for 5 min; 95°C for 30 s → 60°C for 30 s → 72°C for 15 s, cycled 20-25 times; 72°C for 5 min; and stored at 4°C.
[0034] Furthermore, the amplification system for the second round of amplification is: 25 μL amplification mix, 2.5 μL upstream primer F2, 2.5 μL downstream primer R2, and 20 μL first round amplification product.
[0035] Furthermore, the reaction procedure of the second round of amplification is: 95°C for 5 min; 98°C for 30 s → 60°C for 30 s → 72°C for 30 s, cycled 10-15 times, 72°C for 5 min, and stored at 4°C.
[0036] In the present invention, the amplification mix includes DNA Polymerase, dNTP and a buffer system.
[0037] In some embodiments, the DNA polymerase includes but is not limited to Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4 DNA polymerase, and Klenow fragment.
[0038] In some embodiments, dNTPs are nucleoside sources for PCR-based DNA amplification, and dATP, dGTP, dCTP, and dTTP are essential. Furthermore, dNTPs that have been chemically modified for use in hot start methods can be used, such as CleanAmp™ dNTPs manufactured by TriLink BioTechnologies, Inc.
[0039] A second aspect of the present invention provides a product.
[0040] Furthermore, the product includes the universal short sequence described in the first aspect of the present invention.
[0041] Preferably, the product includes the universal long primer described in the first aspect of the present invention.
[0042] Preferably, the product further comprises the sequencing primers described in the first aspect of the present invention.
[0043] Preferably, the product comprises the primer sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2.
[0044] Preferably, the product comprises the primer sequences shown in SEQ ID NO:5 and SEQ ID NO:6.
[0045] More preferably, the product comprises the primer sequences shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8.
[0046] Furthermore, the product also includes PCR amplification buffer, amplification enzyme, dNTP, and nuclease-free pure water.
[0047] Furthermore, the amplification enzyme includes DNA polymerase and / or RNA polymerase.
[0048] Preferably, the amplification enzyme is DNA polymerase.
[0049] Furthermore, the kit also includes instructions.
[0050] In the present invention, a suitable amount of one or more primers is provided in one or more containers, or immobilized on a substrate. The primers can be provided suspended in an aqueous solution, or, for example, as a freeze-dried or lyophilized powder. The container in which the nucleic acid is provided can be any conventional container capable of accommodating the provided form, such as a microcentrifuge tube, ampoule, or bottle.
[0051] In some applications, one or more primers (as described above) can be provided in pre-measured, single-use amounts in separate, typically disposable tubes or equivalent containers. Using such a setup, a sample to be tested for the presence of a gastrointestinal virus can be added to the separate tube and amplified directly.
[0052] The amount of nucleic acid primers provided in the product can be any suitable amount and can depend on the target market for the product. For example, if the kit is suitable for research or clinical applications, the amount of each nucleic acid primer provided can be an amount sufficient to initiate several PCR amplification reactions. General guidance on determining suitable amounts can be found in the literature of Innis et al., Sambrook et al., and Ausubel et al.
[0053] In some embodiments, the kit may contain the necessary reagents for performing a PCR amplification reaction, including DNA sample preparation reagents, enzymes for PCR, buffers, Mg 2+ and deoxyribonucleotides (dNTPs).
[0054] In PCR-based DNA amplification, Mg 2+ It is necessary as Mg 2+ Sources include but are not limited to MgCl2, MgSO4, etc.
[0055] In the present invention, the product further comprises instructions, which may include guidance on obtaining samples and processing samples.
[0056] When implementing the present invention, other necessary instruments include pipettes, pipette tips, 1.5 ml microtubes, and other instruments widely used in molecular biology experiments. Other equipment include PCR equipment, clean benches, centrifuges, and other instruments widely used in molecular biology experiments.
[0057] In a third aspect, the present invention provides the use of primer sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8 for first-generation sequencing of short nucleic acid fragments.
[0058] The terms "preferably," "more preferably," and the like, used herein refer to embodiments of the present invention that may provide certain benefits under certain circumstances. However, other embodiments may also be preferred under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are unsuitable, nor is it intended to exclude other embodiments from the scope of the present invention.
[0059] In the description of the present invention, the terms "one embodiment," "some embodiments," "illustrative embodiments," "examples," "specific examples," or "some examples" mean that the specific features, structures, materials, or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the exemplary expressions of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.
[0060] Advantages and beneficial effects of the present invention:
[0061] (1) The method of the present invention is more accurate in the first-generation sequencing of short nucleic acid fragments. Compared with direct first-generation sequencing, the extended fragments eliminate the negative impact of the inability to clearly read 20bp-50bp or even longer fragments before Sanger sequencing.
[0062] (2) The method of the present invention is simpler and faster to operate, and accurate results can be obtained in 1-2 days, reducing the tedious operation steps of cloning and sequencing and the time for connection, transformation and screening.
[0063] (3) The method of the present invention has certain versatility and universality, and can significantly reduce the cost required for sequencing. BRIEF DESCRIPTION OF THE DRAWINGS
[0064] Figure 1 The figure shows the comparison results of 68bp amplification products; the yellow-marked sequence indicates a 2-base duplication among the 3 sequences compared, and the green-marked sequence indicates a 3-base duplication among the 3 sequences compared;
[0065] Figure 2 The figure shows the comparison results of 99bp amplification products; the yellow-marked sequence indicates a 2-base duplication among the 3 sequences compared, and the green-marked sequence indicates a 3-base duplication among the 3 sequences compared;
[0066] Figure 3 The figure shows the comparison results of 174bp amplification products; the yellow-marked sequence indicates a 2-base duplication among the 3 sequences compared, and the green-marked sequence indicates a 3-base duplication among the 3 sequences compared;
[0067] Figure 4 Schematic diagram of the universal short nucleic acid fragment first-generation sequencing method of the present invention. DETAILED DESCRIPTION
[0068] Below with reference to embodiment, embodiment of the present invention is described in detail, the following description is only used as example to illustrate the present invention, and should not be regarded as limiting the scope of the present invention. In the embodiment, if specific conditions are not specified, it is carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased from the market.
[0069] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Instruments used in the following examples include a clean bench, a shaker, a centrifuge, a Qubit 4.0, a PCR instrument, and pipettes. The primers used in the following examples were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0070] The design concept of this invention involves artificially adding a 20-25bp fragment to each end of a primer fragment. After synthesis, it undergoes one round of PCR amplification. Primers are then designed around the artificially extended fragment and a second round of amplification is performed to produce a fragment approximately 60-70bp longer. This fragment is then directly subjected to first-generation sequencing, where the extended fragment offsets the effect of the first 20-50bp fragment, thereby enabling accurate sequencing of short nucleic acid fragments.
[0071] Example
[0072] 1. Experimental Methods
[0073] 1. One round of amplification to artificially lengthen the amplicon
[0074] (1) Take out the nucleic acid to be tested (the present invention uses three short nucleic acid fragments of different lengths, which are 68 bp, 99 bp and 174 bp respectively), melt them into liquid at room temperature, vortex mix them, and centrifuge them for 1-3 seconds to collect the liquid on the inner wall of the tube cap. Then, dilute the nucleic acid to be tested to 0.1 ng / μL.
[0075] (2) Add 10 μL amplification mix, 1 μL upstream primer F1, 1 μL downstream primer R1, and 8 μL of the nucleic acid to be tested to the PCR tube, vortex to mix, and centrifuge for 1-3 seconds to collect the liquid on the inner wall of the tube cap;
[0076] Primer sequence information:
[0077] The sequence of the upstream primer F1 of the 68 bp nucleic acid to be tested is TGAAGTAGCCATCAGCGAGGTAATGGCGGCGAATTACGA (SEQ ID NO: 9); it is composed of a specific upstream primer AATGGCGGCGAATTACGA and the universal short sequence TGAAGTAGCCATCAGCGAGGT (SEQ ID NO: 1) added to the 5' end of the specific upstream primer;
[0078] The sequence of the upstream primer R1 of the 68 bp nucleic acid to be tested is TTGGTTTTGTCAGGGTATCTTCCCGGATCCCTTTGCGAATAAC (SEQ ID NO: 10); it is composed of a specific downstream primer CGGATCCCTTTGCGAATAAC and the universal short sequence TTGGTTTTGTCAGGGTATCTTCC (SEQ ID NO: 2) added to the 5' end of the specific downstream primer;
[0079] The sequence of the 99 bp upstream primer F1 for the nucleic acid to be tested is TGAAGTAGCCATCAGCGAGGTCGGCAGGGTAATGATTTCGTA (SEQ ID NO: 11); it is composed of a specific upstream primer CGGCAGGGTAATGATTTCGTA and the universal short sequence TGAAGTAGCCATCAGCGAGGT (SEQ ID NO: 1) added to the 5' end of the specific upstream primer;
[0080] The sequence of the 99 bp upstream primer R1 for the nucleic acid to be tested is TTGGTTTTGTCAGGGTATCTTCCCTCTATCGCCGTTCACCTGACT (SEQ ID NO: 12); it is composed of a specific downstream primer CTCTATCGCCCGTTCACCTGACT and the universal short sequence TTGGTTTTGTCAGGGTATCTTCC (SEQ ID NO: 2) added to the 5' end of the specific downstream primer;
[0081] The sequence of the upstream primer F1 of the 174 bp nucleic acid to be tested is TGAAGTAGCCATCAGCGAGGTCGGATCACGCAGTGAAGAT (SEQ ID NO: 13); it is composed of a specific upstream primer CGGATCACGCAGTGAAGAT and the universal short sequence TGAAGTAGCCATCAGCGAGGT (SEQ ID NO: 1) added to the 5' end of the specific upstream primer;
[0082] The sequence of the upstream primer R1 of the 174 bp nucleic acid to be tested is TTGGTTTTGTCAGGGTATCTTCCCCAATAACGCCTGTTTTCTGA (SEQ ID NO: 14); it is composed of a specific downstream primer CCAATAACGCCTGTTTTCTGA and the universal short sequence TTGGTTTTGTCAGGGTATCTTCC (SEQ ID NO: 2) added to the 5' end of the specific downstream primer;
[0083] (3) Place the PCR tube in a PCR instrument and perform the following reaction: 95°C for 5 min; 95°C for 30 s → 60°C for 30 s → 72°C for 15 s, 20 cycles; 72°C for 5 min; store at 4°C.
[0084] (4) After the reaction, remove the PCR tube and centrifuge it for 1-3 seconds to collect the liquid on the inner wall of the tube cap.
[0085] 2. Second round of amplification to artificially lengthen the amplicon
[0086] (5) Add 25 μL amplification mix, 2.5 μL upstream primer F2, 2.5 μL downstream primer R2, and 20 μL of the reaction product from the previous step to a new PCR tube, vortex to mix, and centrifuge for 1-3 seconds to collect the liquid on the inner wall of the tube cap;
[0087] The sequence of the upstream primer F2 is GGTCACTATCTCCGTAACAAAATCGAAGGAAACACTAGCCGCGACGTTGAAGTAGCCATCAGCGAGGT (SEQ ID NO: 5); it consists of a universal upstream long sequence GGTCACTATCTCCGTAACAAAATCGAAGGAAACACTAGCCGCGACGT (SEQ ID NO: 3) and the universal short sequence TGAAGTAGCCATCAGCGAGGT (SEQ ID NO: 1) added to the 5' end of the target short nucleic acid fragment-specific upstream primer;
[0088] The sequence of the downstream primer R2 is CTGATGTTCTGGTAAGAGGTCGTAGTGGAACTCGTGGATAACCCAATCAGATTTGGTTTTGTCAGGGTATCTTCC (SEQ ID NO: 6); it consists of a universal downstream long sequence CTGATGTTCTGGTAAGAGGTCGTAGTGGAACTCGTGGATAACCCAATCAGAT (SEQ ID NO: 4) and the universal short sequence TTGGTTTTGTCAGGGTATCTTCC (SEQ ID NO: 2) added to the 5' end of the target short nucleic acid fragment-specific downstream primer;
[0089] (6) Place the PCR tube in a PCR instrument and perform the following reaction: 95°C for 5 min; 95°C for 30 s → 60°C for 30 s → 72°C for 30 s, 10 cycles; 72°C for 5 min, and store at 4°C.
[0090] (7) After the reaction, remove the PCR tube and centrifuge for 1-3 seconds to collect the liquid on the inner wall of the tube cap;
[0091] 3. First-generation sequencing
[0092] (8) The products of the second-round amplification reaction were sent for sequencing. The company selected was Sangon Biotech (Shanghai) Co., Ltd., the sequencing primers were F3 and R3, and the sequencing method was Sanger sequencing, with bidirectional sequencing.
[0093] The sequence of the sequencing primer F3 is GGTCACTATCTCCGTAACAAAATCG (SEQ ID NO: 7); the sequence of the sequencing primer R3 is CTGATGTTCTGGTAAGAGGTCGTAGT (SEQ ID NO: 8).
[0094] 2. Test Results
[0095] The comparison results of the amplified products of the 68 bp nucleic acid fragment, the 99 bp nucleic acid fragment and the 174 bp nucleic acid fragment are as follows: Figure 1 、 Figure 2 and Figure 3 "Example" represents the sequencing results of the method described in the present invention; "TA" represents the sequencing results of TA cloning of PCR products; and "Direct Sequencing" represents the results of direct sequencing of PCR products. All sequencing work was performed at Sangon Biotech (Shanghai) Co., Ltd.
[0096] Comparative sequencing analysis shows that the Example achieves comparable accuracy to TA cloning sequencing, while reducing the time required by 2-5 days compared to cloning sequencing. This reduces the tedious steps involved in cloning sequencing, the time required for ligation, transformation, and screening, and significantly reduces costs. Compared to direct sequencing, the Example significantly improves accuracy and mitigates the impact of inaccurate sequencing of the first 20-50 bp. In the comparison results for a 99 bp nucleic acid fragment in Figure 2, it is found that the Example also eliminates the negative impact of inaccurate reads at the end of sequencing.
[0097] In summary, the method of the present invention eliminates the tedious steps of cloning and sequencing, as well as the time required for ligation, transformation, and screening, for first-generation sequencing of short nucleic acid fragments, offering advantages such as high accuracy, reduced time, and lower costs. Furthermore, the method of expanding the sequencing range through a second round of PCR employed in the present invention is versatile and universal.
[0098] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. A universal method for first-generation sequencing of short nucleic acid fragments, characterized in that: The method comprises: 1) Primer synthesis is performed by adding a universal short sequence to the 5' end of the upstream and downstream primers specific for the target short nucleic acid fragment; 2) performing a first round of amplification on the target short nucleic acid fragment using the above primers to obtain a one-round extended amplification product with the above universal short sequence added to both ends of the target short nucleic acid fragment; 3) Performing a second round of amplification on the aforementioned extended amplification product using a universal long primer to obtain a second round of amplification product; 4) Perform first-generation sequencing on the second-round amplification products.
2. The method according to claim 1, characterized in that The length of the short nucleic acid fragment is 50 bp to 200 bp.
3. The method according to claim 1, characterized in that The length of the universal short sequence in step 1) is 20 bp to 25 bp; Preferably, the universal short sequence added to the 5' end of the target short nucleic acid fragment specific upstream primer in step 1) is as shown in SEQ ID NO: 1; Preferably, the universal short sequence added to the 5' end of the target short nucleic acid fragment-specific downstream primer in step 1) is as shown in SEQ ID NO:
2.
4. The method according to claim 1, wherein The universal long primers described in step 3) include a universal upstream long primer and a universal downstream long primer; Preferably, the universal upstream long primer consists of a universal upstream long sequence and the universal short sequence added to the 5' end of the target short nucleic acid fragment specific upstream primer in step 1); Preferably, the universal downstream long primer consists of a universal downstream long sequence and the universal short sequence added to the 5' end of the target short nucleic acid fragment-specific downstream primer described in step 1); Preferably, the universal upstream long sequence is shown in SEQ ID NO: 3; Preferably, the universal downstream long sequence is shown in SEQ ID NO: 4; Preferably, the universal upstream long primer is shown in SEQ ID NO: 5; Preferably, the universal downstream long primer is shown as SEQ ID NO:
6.
5. The method according to claim 1, wherein The sequencing primers for first-generation sequencing in step 4) are designed for the extended fragments at both ends of the second-round amplification product; Preferably, the base sequence of the upstream primer for first-generation sequencing is shown in SEQ ID NO: 7; Preferably, the base sequence of the downstream primer for first-generation sequencing is shown as SEQ ID NO:
8.
6. The method according to claim 1, characterized in that The amplification system for the first round of amplification was: 10 μL amplification mix, 1 μL upstream primer, 1 μL downstream primer, and 8 μL nucleic acid; Preferably, the reaction procedure for the first round of amplification is: 95°C for 5 min; 95°C for 30 s → 60°C for 30 s → 72°C for 15 s, for 20-25 cycles; 72°C for 5 min; and storage at 4°C.
7. The method according to claim 1, characterized in that The amplification system for the second round of amplification was: 25 μL amplification mix, 2.5 μL upstream primer, 2.5 μL downstream primer, and 20 μL first round amplification product; Preferably, the reaction procedure of the second round of amplification is: 95°C for 5 min; 98°C for 30 s → 60°C for 30 s → 72°C for 30 s, cycled 10-15 times, 72°C for 5 min, and stored at 4°C.
8. A product, characterized in that The product comprises the universal short sequence according to claim 3, Preferably, the product further comprises the universal long primer according to claim 4; Preferably, the product further comprises the sequencing primer according to claim 5; Preferably, the product comprises the primer sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2; Preferably, the product comprises the primer sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6; Preferably, the product comprises the primer sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO:
8.
9. The product according to claim 7, characterized in that The product also includes PCR amplification buffer, amplification enzyme, dNTP, and nuclease-free pure water; Preferably, the amplification enzyme is DNA polymerase; Preferably, the kit further comprises instructions.
10. Use of the primer sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8 for first-generation sequencing of short nucleic acid fragments.
Citation Information
Patent Citations
Plant resistance related protein ANAC001, its encoding gene and application thereof
CN102367272A
Short fragment nucleic acid chain detection method and pre-amplification method
CN108004300A
Isothermal nucleic acid amplification method and applications
CN112239754A