A method for sequencing short nucleic acid fragments

Abstract

This invention discloses a method for sequencing short nucleic acid fragments. The method involves artificially adding a 20-25 bp universal short sequence to both ends of a primer specifically for the target short nucleic acid fragment. After primer synthesis, a first round of PCR amplification is performed to obtain a first-round extended amplification product. Then, a universal long sequence is added to the 5' end of each of the aforementioned 20-25 bp universal short sequences to form universal long primers. After primer synthesis, the first-round extended amplification product is used as a template for a second round of PCR amplification, ultimately obtaining amplification products with 60-70 bp extensions at both ends of the target short nucleic acid fragment. This method eliminates the cumbersome steps of cloning and sequencing, as well as the time required for ligation, transformation, and screening, offering advantages such as high accuracy, shorter time, and lower cost. Furthermore, the two-round PCR amplification method used in this invention to extend the sequencing range is universal and applicable.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology. Specifically, this invention relates to a method for first-generation sequencing of universal short nucleic acid fragments. Background Technology

[0002] With the development of physical and chemical technologies, DNA sequencing has seen significant advancements. Even today, with the rapid advancements in biotechnology, first-generation sequencing remains widely used in numerous applications, such as SNP detection and methylation detection. Sanger sequencing is a representative first-generation sequencing technology. Sanger sequencing uses the target DNA as a template to replicate a large number of DNA fragments, while simultaneously using dideoxynucleotides (ddNTPs) to terminate the DNA strand extension, interfering with this replication process. ddNTPs randomly terminate this extension process, resulting in a large number of DNA fragments with the same starting point but different ending points. Electrophoresis is used to separate the fragments, and the different fluorescence emitted by ddNTPs based on their truncation points allows for the translation of the DNA nucleotide sequence.

[0003] Generally, first-generation sequencing requires a sequencing length of several hundred base pairs (bp) or more to ensure good accuracy and reliability. This is mainly because residual dye monomers generate interference peaks, which overlap with the normal sequence peaks. In addition, the voltage stabilizes at the beginning of sequencing electrophoresis, and the first 20-50 bp immediately following the primer cannot be clearly read, sometimes resulting in longer fragments that cannot be clearly read.

[0004] Therefore, short nucleic acid fragments (50-200 bp) are difficult to directly read using first-generation sequencing. A common approach is cloning sequencing (TA cloning), which involves ligating the short fragment amplicons to a plasmid, transforming the plasmid into an engineered bacterium (E. coli), screening for successful plasmids, extracting the plasmid nucleic acid, and performing first-generation sequencing using universal primers attached to the plasmid. This method is time-consuming and expensive. Alternatively, a pair of primers can be designed outside the short fragment amplicons to amplify the product beyond 200 bp, placing the short fragment within the amplification product, and then using the outer primers for first-generation sequencing. However, this method requires primer redesign each time, thus lacking universality.

[0005] Therefore, it is essential to develop a simple, fast, and universal short-fragment sequencing method and to make reasonable use of it, which will help improve sequencing efficiency and reduce sequencing costs. Summary of the Invention

[0006] To overcome the shortcomings of existing technologies, the purpose of this invention is to provide a method that can reduce the cost of sequencing short nucleic acid fragments and improve sequencing efficiency and accuracy.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] The first aspect of this invention provides a method for universal short nucleic acid fragment first-generation sequencing.

[0009] Furthermore, the method includes:

[0010] 1) Primers are synthesized after adding a universal short sequence to the 5' end of the upstream and downstream primers that are specific to the target short nucleic acid fragment;

[0011] 2) The target short nucleic acid fragment was amplified in the first round using the above primers to obtain a first-round amplification product with the above universal short sequence added to both ends of the target short nucleic acid fragment;

[0012] 3) Use universal long primers to perform a second round of amplification on the above-mentioned first-round amplification product to obtain the second-round amplification product;

[0013] 4) Perform first-generation sequencing on the second-round amplification products.

[0014] Furthermore, the length of the short nucleic acid fragment is 50bp~200bp.

[0015] Furthermore, the length of the general short sequence mentioned in step 1) is 20bp~25bp.

[0016] Preferably, the universal short sequence added to the 5' end of the upstream primer specific to the target short nucleic acid fragment in step 1) is as shown in SEQ ID NO:1.

[0017] Preferably, the universal short sequence added to the 5' end of the downstream primer specific to the target short nucleic acid fragment in step 1) is as shown in SEQ ID NO:2.

[0018] Furthermore, the universal long primers mentioned in step 3) include universal upstream long primers and universal downstream long primers.

[0019] Furthermore, the universal upstream long primer consists of a universal upstream long sequence and the universal short sequence added to the 5' end of the target short nucleic acid fragment specific upstream primer as described in step 1).

[0020] Furthermore, the universal downstream long primer consists of a universal downstream long sequence and the universal short sequence added to the 5' end of the target short nucleic acid fragment specific downstream primer as described in step 1).

[0021] Preferably, the general upstream long sequence is as shown in SEQ ID NO:3.

[0022] Preferably, the general downstream long sequence is as shown in SEQ ID NO:4.

[0023] Preferably, the universal upstream long primer is shown in SEQ ID NO:5.

[0024] Preferably, the universal downstream long primer is shown in SEQ ID NO:6.

[0025] Furthermore, in step 4), the sequencing primers used for first-generation sequencing are designed to target the extended fragments at both ends of the second-round amplification product.

[0026] Preferably, the base sequence of the upstream primer for the first-generation sequencing is shown in SEQ ID NO:7;

[0027] Preferably, the base sequence of the downstream primer for the first-generation sequencing is shown in SEQ ID NO:8.

[0028] To address the inaccuracy of first-generation sequencing results for short nucleic acid fragments, this invention provides a universal first-generation sequencing method for short nucleic acid fragments. The method involves artificially adding a 20-25 bp universal short sequence to both ends of a primer specific to the target short nucleic acid fragment. After primer synthesis, a first-round PCR amplification yields an extended amplification product. A second round of amplification is then performed by adding a universal long sequence to both ends of the 20-25 bp universal short sequence to create universal long primers, resulting in a 60-70 bp extended fragment at both ends of the target short nucleic acid fragment. The second-round amplification product is then directly subjected to first-generation sequencing. The extended fragments offset the influence of the initial 20-50 bp in the first-round sequencing, thus achieving accurate sequencing of short nucleic acid fragments. Furthermore, the commonly used long primers for the second-round amplification and the sequencing primers for the first-round sequencing can be reused multiple times, effectively amplifying any short nucleic acid fragment and significantly reducing economic costs.

[0029] In this invention, primers refer to short nucleic acid molecules that can anneal to complementary target nucleic acid molecules through nucleic acid hybridization, forming a hybrid between the primer and the target nucleic acid strand. Primers can be extended along the target nucleic acid molecule using polymerase. Therefore, primers can be used to amplify target nucleic acid molecules. In this invention, the target short nucleic acid fragment-specific upstream and downstream primers are those whose sequence is specific to the target nucleic acid molecule.

[0030] In this invention, the universal short sequences added to the 5' ends of the upstream and downstream primers specific to the target short nucleic acid fragment are preferably different sequences. This invention does not limit the base composition of the universal short sequences added to the 5' ends of the upstream and downstream primers specific to the target short nucleic acid fragment, as long as their length is between 20bp and 25bp.

[0031] In this invention, the universal long primer consists of a universal long sequence and the universal short sequence described in step 1). In the second round of amplification, the universal short sequence acts as a specific primer for the first round of amplification product lengthening. The purpose of adding the universal long sequence is to further lengthen the fragments at both ends of the first round of amplification product, thereby reducing the bias in sequencing short nucleic acid fragments. In this invention, the universal long primer includes a universal upstream long primer and a universal downstream long primer. The universal upstream long primer is equivalent to the upstream primer F2 described in this invention, and the universal downstream long primer is equivalent to the downstream primer R2 described in this invention. This invention does not limit the base composition of the universal long sequence, as long as its length is between 40bp and 55bp. Because the universal long primer described in this invention contains a specific primer for the first round of amplification lengthening fragment, the universal primer described in this invention is suitable for the second round of amplification for any target short nucleic acid fragment.

[0032] Furthermore, the amplification system for the first round of amplification consisted of: 10 μL amplification mix, 1 μL upstream primer, 1 μL downstream primer, and 8 μL nucleic acid.

[0033] Furthermore, the reaction program for the first round of amplification was as follows: 95℃ for 5 min; 95℃ for 30 s → 60℃ for 30 s → 72℃ for 15 s, repeated 20-25 times; 72℃ for 5 min; stored at 4℃.

[0034] Furthermore, the amplification system for the second round of amplification is as follows: 25 μL amplification mix, 2.5 μL upstream primer F2, 2.5 μL downstream primer R2, and 20 μL of the first round amplification product.

[0035] Furthermore, the reaction program for the second round of amplification is as follows: 95℃ for 5 min; 98℃ for 30 s → 60℃ for 30 s → 72℃ for 30 s, cycled 10-15 times, 72℃ for 5 min, and stored at 4℃.

[0036] In this invention, the amplification mix includes DNA polymerase, dNTPs, and a buffer system.

[0037] In some embodiments, the DNA polymerase includes, but is not limited to, Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4 DNA polymerase, and the Klenow fragment.

[0038] In some implementations, dNTPs are nucleoside sources for PCR-based DNA amplification; dATP, dGTP, dCTP, and dTTP are all necessary. Additionally, dNTPs can be chemically modified for hot-start methods, such as CleanAmp™ dNTPs manufactured by TriLink BioTechnologies, Inc.

[0039] A second aspect of the present invention provides a product.

[0040] Furthermore, the product includes the universal short sequence described in the first aspect of the present invention.

[0041] Preferably, the product comprises the universal long primers described in the first aspect of the present invention.

[0042] Preferably, the product further includes the sequencing primers described in the first aspect of the present invention.

[0043] Preferably, the product comprises the primer sequences shown in SEQ ID NO:1 and SEQ ID NO:2.

[0044] Preferably, the product includes the primer sequences shown in SEQ ID NO:5 and SEQ ID NO:6.

[0045] More preferably, the product includes the primer sequences shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8.

[0046] Furthermore, the product also includes PCR amplification buffer, amplification enzyme, dNTPs, and nuclease-free purified water.

[0047] Furthermore, the amplification enzyme includes DNA polymerase and / or RNA polymerase.

[0048] Preferably, the amplification enzyme is a DNA polymerase.

[0049] Furthermore, the kit also includes instructions.

[0050] In this invention, suitable amounts of one or more primers are provided in one or more containers or immobilized on a matrix. The primers may be provided as a suspension in an aqueous solution or, for example, as a freeze-dried or lyophilized powder. The container providing the nucleic acid can be any conventional container capable of containing the provided form, such as a microcentrifuge tube, ampoule, or bottle.

[0051] In some applications, one or more primers (as described above) can be provided in pre-measured, single-use amounts in separate, typically disposable tubes or equivalent containers. Using such a setup, samples for testing the presence of gastrointestinal viruses can be added to separate tubes for direct amplification.

[0052] The amount of nucleic acid primers provided in the product can be any suitable amount, depending on the target market for which the product is intended. For example, if the kit is intended for research or clinical use, the amount of each nucleic acid primer provided can be sufficient to initiate several PCR amplification reactions. General guidelines for determining suitable amounts can be found in the literature of Innis et al., Sambrook et al., and Ausubel et al.

[0053] In some implementations, the kit may contain reaction reagents necessary for performing PCR amplification, including DNA sample preparation reagents, enzymes for PCR, buffers, and Mg2+. 2+ and deoxyribonucleotides (dNTPs).

[0054] In PCR-based DNA amplification, Mg 2+ It is necessary. As Mg 2+ Sources, including but not limited to MgCl2, MgSO4, etc.

[0055] In this invention, the product also includes an instruction manual, which may include instructions on obtaining and processing samples.

[0056] When implementing this invention, other necessary equipment can include pipettes, pipette tips, 1.5ml microtubes, and other instruments widely used in molecular biology experiments. As for devices, PCR machines, clean benches, tube centrifuges, and other instruments widely used in molecular biology experiments can be cited.

[0057] A third aspect of the present invention provides the application of the primer sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8 in first-generation sequencing of short nucleic acid fragments.

[0058] The terms "preferred," "more preferably," etc., used in this invention refer to embodiments of the invention that provide certain beneficial effects under certain circumstances. However, other embodiments may also be preferred under the same or other circumstances. Furthermore, the description of one or more preferred embodiments does not imply that other embodiments are unavailable, nor is it intended to exclude other embodiments from the scope of this invention.

[0059] In the description of this invention, the terms "one embodiment," "some embodiments," "illustrative embodiment," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0060] Advantages and beneficial effects of the present invention:

[0061] (1) The method of the present invention provides more accurate first-generation sequencing results for short nucleic acid fragments. Compared with direct first-generation sequencing, the extended fragments eliminate the negative impact of the inability to clearly read fragments of 20bp-50bp or even longer in the first generation of Sanger sequencing.

[0062] (2) The method of the present invention is simpler and faster to operate, and accurate results can be obtained in 1-2 days, reducing the cumbersome operation steps of cloning sequencing and the time for ligation transformation and screening.

[0063] (3) The method of the present invention has certain universality and applicability, and can significantly reduce the cost of sequencing. Attached Figure Description

[0064] Figure 1 This is a comparison result of the 68bp amplification product; the yellow-marked sequence indicates a 2-base repeat in the 3 comparison sequences, and the green-marked sequence indicates a 3-base repeat in the 3 comparison sequences.

[0065] Figure 2 The image shows the comparison results of the 99bp amplification product; the yellow-marked sequence indicates a 2-base repeat in the 3 comparison sequences, and the green-marked sequence indicates a 3-base repeat in the 3 comparison sequences.

[0066] Figure 3 This is a comparison result of the 174bp amplification product; the yellow-marked sequence indicates a 2-base repeat in the 3 comparison sequences, and the green-marked sequence indicates a 3-base repeat in the 3 comparison sequences.

[0067] Figure 4 This is a schematic diagram of the universal short nucleic acid fragment first-generation sequencing method of the present invention. Detailed Implementation

[0068] The embodiments of the present invention will be described in detail below with reference to examples. These descriptions are for illustrative purposes only and should not be construed as limiting the scope of the invention. Unless otherwise specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0069] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. The instruments involved in the following examples include: a clean bench, shaker, centrifuge, Qubit 4.0, PCR instrument, pipettes, etc. The primers used in the following examples were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0070] The design concept of this invention is as follows: By artificially adding a 20-25 bp fragment to both ends of a primer fragment, after synthesis and a first round of PCR amplification, primers are designed again for the artificially lengthened fragment for a second round of amplification, resulting in a fragment that is 60-70 bp longer on both sides. This fragment is then directly subjected to first-generation sequencing. The lengthened fragment offsets the influence of the first 20-50 bp fragment in the first-generation sequencing, thereby enabling accurate sequencing of short nucleic acid fragments.

[0071] Example

[0072] I. Experimental Methods

[0073] 1. One-round amplification of artificially lengthened amplicon

[0074] (1) Take out the nucleic acid to be tested (the present invention uses three short nucleic acid fragments of different lengths, namely 68bp, 99bp and 174bp), melt them into liquid at room temperature, vortex mix them, and centrifuge them for 1-3 seconds to collect the liquid on the inner wall of the tube cap. Dilute the nucleic acid to be tested to 0.1ng / μL.

[0075] (2) Add 10 μL of amplification mix, 1 μL of upstream primer F1, 1 μL of downstream primer R1 and 8 μL of nucleic acid to be tested to the PCR tube, vortex to mix, and centrifuge briefly for 1-3 seconds to collect the liquid on the inner wall of the tube cap;

[0076] Primer sequence information:

[0077] The sequence of the upstream primer F1 of the 68bp nucleic acid to be tested is TGAAGTAGCCATCAGCGAGGTAATGGCGGCGAATTACGA (SEQ ID NO:9); it consists of a specific upstream primer AATGGCGGCGAATTACGA and the universal short sequence TGAAGTAGCCATCAGCGAGGT (SEQ ID NO:1) added to the 5' end of the specific upstream primer.

[0078] The sequence of the upstream primer R1 of the 68bp nucleic acid to be tested is TTGGTTTTGTCAGGGTATCTTCCCGGATCCCTTTGCGAATAAC (SEQ ID NO:10); it consists of a specific downstream primer CGGATCCCTTTGCGAATAAC and the universal short sequence TTGGTTTTGTCAGGGTATCTTCC (SEQ ID NO:2) added to the 5' end of the specific downstream primer.

[0079] The sequence of the upstream primer F1 of the 99bp nucleic acid to be tested is TGAAGTAGCCATCAGCGAGGTCGGCAGGGTAATGATTTCGTA (SEQ ID NO:11); it consists of a specific upstream primer CGGCAGGGTAATGATTTCGTA and the universal short sequence TGAAGTAGCCATCAGCGAGGT (SEQ ID NO:1) added to the 5' end of the specific upstream primer.

[0080] The sequence of the upstream primer R1 of the 99bp nucleic acid to be tested is TTGGTTTTGTCAGGGTATCTTCCCTCTATCGCCGTTCACCTGACT (SEQ ID NO:12); it consists of a specific downstream primer CTCTATCGCCGTTCACCTGACT and the universal short sequence TTGGTTTTGTCAGGGTATCTTCC (SEQ ID NO:2) added to the 5' end of the specific downstream primer.

[0081] The sequence of the upstream primer F1 of the 174bp nucleic acid to be tested is TGAAGTAGCCATCAGCGAGGTCGGATCACGCAGTGAAGAT (SEQ ID NO:13); it consists of a specific upstream primer CGGATCACGCAGTGAAGAT and the universal short sequence TGAAGTAGCCATCAGCGAGGT (SEQ ID NO:1) added to the 5' end of the specific upstream primer.

[0082] The sequence of the upstream primer R1 of the 174bp nucleic acid to be tested is TTGGTTTTGTCAGGGTATCTTCCCCAATAACGCCTGTTTTCTGA (SEQ ID NO:14); it consists of a specific downstream primer CCAATAACGCCTGTTTTCTGA and the universal short sequence TTGGTTTTGTCAGGGTATCTTCC (SEQ ID NO:2) added to the 5' end of the specific downstream primer.

[0083] (3) Place the PCR tube in the PCR instrument and perform the following reaction: 95℃ for 5 min; 95℃ for 30 s → 60℃ for 30 s → 72℃ for 15 s, repeat 20 times, 72℃ for 5 min, and store at 4℃;

[0084] (4) After the reaction, remove the PCR tube and centrifuge briefly for 1-3 seconds to collect the liquid on the inner wall of the tube cap.

[0085] 2. Second-round amplification with artificially lengthened amplicon

[0086] (5) Add 25 μL of amplification mix, 2.5 μL of upstream primer F2, 2.5 μL of downstream primer R2, and 20 μL of the reaction product from the previous step to a new PCR tube. Vortex to mix and centrifuge briefly for 1-3 seconds to collect the liquid on the inner wall of the tube cap.

[0087] The sequence of the upstream primer F2 is GGTCACTATCTCCGTAACAAAATCGAAGGAAACACTAGCCGCGACGTTGAAGTAGCCATCAGCGAGGT (SEQ ID NO:5); it consists of a universal upstream long sequence GGTCACTATCTCCGTAACAAAATCGAAGGAAACACTAGCCGCGACGT (SEQ ID NO:3) and the universal short sequence TGAAGTAGCCATCAGCGAGGT (SEQ ID NO:1) added to the 5' end of the target short nucleic acid fragment specific upstream primer;

[0088] The sequence of the downstream primer R2 is CTGATGTTCTGGTAAGAGGTCGTAGTGGAACTCGTGGATAACCCAATCAGATTTGGTTTTGTCAGGGTATCTTCC (SEQ ID NO:6); it consists of a universal downstream long sequence CTGATGTTCTGGTAAGAGGTCGTAGTGGAACTCGTGGATAACCCAATCAGAT (SEQ ID NO:4) and the universal short sequence TTGGTTTTGTCAGGGTATCTTCC (SEQ ID NO:2) added to the 5' end of the target short nucleic acid fragment specific downstream primer.

[0089] (6) Place the PCR tube in the PCR instrument and perform the following reaction: 95℃ for 5 min; 95℃ for 30 s → 60℃ for 30 s → 72℃ for 30 s, repeat 10 times; 72℃ for 5 min, store at 4℃;

[0090] (7) After the reaction, remove the PCR tube and centrifuge briefly for 1-3 seconds to collect the liquid on the inner wall of the tube cap;

[0091] 3. First-generation sequencing

[0092] (8) The product of the second round of amplification reaction in the above step is sent for sequencing. The selected company is Sangon Biotech (Shanghai) Co., Ltd., the sequencing primers are F3 and R3, and the selected sequencing method is Sanger sequencing, bidirectional sequencing.

[0093] The sequence of sequencing primer F3 is GGTCACTATCTCCGTAACAAAATCG (SEQ ID NO:7); the sequence of sequencing primer R3 is CTGATGTTCTGGTAAGAGGTCGTAGT (SEQ ID NO:8).

[0094] II. Test Results

[0095] The amplification products of the 68bp, 99bp, and 174bp nucleic acid fragments were compared as follows: Figure 1 , Figure 2 and Figure 3 As shown. "Examples" represent sequencing results of the method described in this invention; "TA" represents sequencing results of TA cloning of PCR products; "Direct Sequencing" represents experimental results of direct sequencing of PCR products. All sequencing work was performed at Sangon Biotech (Shanghai) Co., Ltd.

[0096] Comparative sequencing results showed that the accuracy of the example sequencing was consistent with TA cloning sequencing, but it took 2-5 days less time, reducing the time spent on cumbersome cloning, transformation, and screening steps, and significantly lowering costs. Compared with direct sequencing, the example sequencing significantly improved accuracy and reduced the impact of inaccurate sequencing of the first 20-50 bp. In the comparison of the 99 bp nucleic acid fragment in Figure 2, it was found that the example sequencing also eliminated the negative impact of inaccurate sequencing end readings.

[0097] In summary, the method of this invention for first-generation sequencing of short nucleic acid fragments eliminates the cumbersome steps of cloning and sequencing, as well as the time required for ligation, transformation, and screening. It offers advantages such as high accuracy, shorter processing time, and lower cost. Furthermore, the two-round PCR amplification method used in this invention to extend the sequencing range is versatile and applicable.

[0098] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A method for universal first-generation sequencing of short nucleic acid fragments, characterized in that, The method includes: 1) Primers are synthesized after adding a universal short sequence to the 5' end of the upstream and downstream primers that are specific to the target short nucleic acid fragment; the universal short sequence added to the 5' end of the upstream primer that is specific to the target short nucleic acid fragment is shown in SEQ ID NO:1; the universal short sequence added to the 5' end of the downstream primer that is specific to the target short nucleic acid fragment is shown in SEQ ID NO:2; 2) The target short nucleic acid fragment was amplified in the first round using the above primers to obtain a first-round amplification product with the above universal short sequence added to both ends of the target short nucleic acid fragment; 3) The amplified product from the first round of amplification was amplified in a second round using universal long primers to obtain the amplified product from the second round; the universal long primers include a universal upstream long primer and a universal downstream long primer; the universal upstream long primer is shown in SEQ ID NO:5; the universal downstream long primer is shown in SEQ ID NO:6; 4) Perform first-generation sequencing on the second-round amplification products; the base sequence of the upstream primer for the first-generation sequencing is shown in SEQ ID NO:7; the base sequence of the downstream primer for the first-generation sequencing is shown in SEQ ID NO:8; The short nucleic acid fragments are 50bp to 200bp in length.

2. The method according to claim 1, characterized in that, The amplification system for the first round of amplification consisted of 10 μL amplification mix, 1 μL upstream primer, 1 μL downstream primer, and 8 μL nucleic acid.

3. The method according to claim 1, characterized in that, The reaction program for the first round of amplification was: 95℃ for 5 min; 95℃ for 30 s → 60℃ for 30 s → 72℃ for 15 s, for 20 cycles. 25 times; 72℃ for 5 minutes; store at 4℃.

4. The method according to claim 1, characterized in that, The amplification system for the second round of amplification was: 25 μL amplification mix, 2.5 μL upstream primer, 2.5 μL downstream primer, and 20 μL of the first round amplification product.

5. The method according to claim 1, characterized in that, The reaction program for the second round of amplification was as follows: 95℃ for 5 min; 95℃ for 30 s → 60℃ for 30 s → 72℃ for 30 s, repeated 10-15 times, 72℃ for 5 min, and stored at 4℃.

6. The application of the primer sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8 in first-generation sequencing of short nucleic acid fragments, characterized in that, The short nucleic acid fragments are 50bp to 200bp in length.

Images