CAP primer probe group, kit and detection method for rapidly detecting Candidatus Liberibacter asiaticum on site and application

Abstract

The invention provides a CAP primer probe group, a kit and a detection method for rapidly detecting Candidatus Liberibacter asiaticum on site and application, and belongs to the technical field of molecular detection. The invention provides a CPA primer probe group for detecting Candidatus Liberibacter asiaticum. The CPA primer probe group comprises a primer group and a probe HLB-P, the primer group comprises an HLB-FB, an HLB-AP, an HLB-OP, an HLB-IP, an HLB-CPR and an HLB-RB of which the nucleotide sequences are sequentially as shown in SEQ ID NO: 1 to SEQ ID NO: 6; the nucleotide sequence of the probe HLB-P is as shown in SEQ ID NO: 7. The primer probe group provided by the invention provides a reliable technical means for diagnosis of different tissues of Candidatus Liberobacter asiaticum, and lays an important technical foundation for real-time monitoring of field diseases and formulation of prevention and control strategies.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular detection, and in particular relates to a CAP (Cross-priming Amplification) primer probe set, a kit, a detection method and an application thereof for on-site rapid detection of citrus Huanglongbing fungus. Background Art

[0002] The citrus Huanglongbing disease (Candidatus Liberibacter asiaticus) is extremely destructive and poses a serious threat to the healthy development of the citrus cultivation industry. To date, pure culture of the citrus Huanglongbing disease has not been achieved in vitro. It is primarily transmitted by the insect vectors citrus psyllids and citron psyllids over short distances and by seedlings and scions over long distances.

[0003] Currently, diagnostic methods for citrus Huanglongbing disease primarily include field symptom diagnosis, electron microscopy, and PCR. However, these methods are generally time-consuming, require complex equipment, and require specialized personnel. Therefore, they are unsuitable for rapid field testing, severely limiting the application and promotion of molecular detection technologies. Summary of the Invention

[0004] In view of this, the present invention provides a CPA primer probe set for detecting citrus Huanglongbing disease, which can be used to quickly detect citrus Huanglongbing disease in the field, is easy to operate, and has the characteristics of strong specificity and high sensitivity.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides a CPA primer probe set for detecting citrus Huanglongbing fungus, comprising a primer set and a probe HLB-P;

[0007] The primer set includes HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR and HLB-RB;

[0008] The nucleotide sequences of HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR and HLB-RB are shown in SEQ ID NO: 1 to SEQ ID NO: 6, respectively;

[0009] The nucleotide sequence of the probe HLB-P is shown in SEQ ID NO:7.

[0010] Preferably, the 5′ end of the probe HLB-P is labeled with a fluorescent group, and the 3′ end of the probe HLB-P is labeled with a quencher group.

[0011] Preferably, the fluorescent group includes FAM, and the quencher group includes BHQ1.

[0012] The invention provides a kit for detecting citrus Huanglongbing fungus, comprising the primer probe set, CPA reaction buffer, Bst DNA polymerase, dNTPs, betaine and magnesium ions.

[0013] Preferably, it also includes a crude DNA extract.

[0014] The invention provides a device for detecting citrus Huanglongbing fungus, comprising the reagent kit and a fluorescence detection device.

[0015] Preferably, the device further comprises a grinding device.

[0016] The present invention provides a method for detecting citrus Huanglongbing fungus based on a fluorescence detection device, comprising the following steps:

[0017] Using the genomic DNA of the sample to be detected as a template, performing a CPA reaction using the primer probe set, the kit or the device to obtain a CPA reaction product;

[0018] The fluorescence intensity of the CPA reaction product is measured, and whether the sample to be tested contains citrus Huanglongbing fungus is determined based on the presence or absence of the fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the sample to be tested is infected with citrus Huanglongbing fungus, otherwise it is not infected.

[0019] Preferably, the reaction system of the CPA reaction is 500 μL, and the reaction system of the CPA reaction contains the following components at the following concentrations: HLB-FB 0.2 μM, HLB-AP 2 μM, HLB-OP 2 μM, HLB-IP 1 μM, HLB-CPR 2 μM, HLB-RB 0.2 μM, HLB-P 0.3 μM, 1×CPA reaction buffer, BstDNA polymerase 6U, dNTPs 0.3 mM, magnesium ions 6 mM and betaine 1 M.

[0020] Preferably, the reaction procedure of the CPA reaction is: maintaining at 63° C. for 15 to 30 minutes.

[0021] Compared with the prior art, the present invention has the following advantages:

[0022] The present invention provides a CPA primer-probe set for detecting citrus Huanglongbing disease, comprising a primer set and a probe HLB-P; the primer set comprises HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR, and HLB-RB, the nucleotide sequences of which are sequentially shown in SEQ ID NOs: 1 to 6; the nucleotide sequence of the probe HLB-P is shown in SEQ ID NO: 7. The CPA primer-probe set is designed based on the conserved region sequence of the outer membrane protein of citrus Huanglongbing disease, has high specificity, and can specifically identify citrus Huanglongbing disease, but does not recognize common citrus pathogens, such as Xanthomonas campestris pv. citri, Colletotrichum gloeosporioides Cg-14, Bacillus subtilis, and four viruses (citrus tristeza virus, citrus yellow vein virus, citrus crisp leaf virus, and citrus bark viroid). The CPA primer probe set has high sensitivity, with the minimum detection plasmid copy number being 4 copies / μL and the minimum positive DNA concentration detection limit being 160 fg / μL.

[0023] The present invention provides a method for detecting citrus Huanglongbing disease based on a fluorescence base, comprising the following steps: using the genomic DNA of the sample to be detected as a template, performing a CPA reaction with the primer probe set, the kit or the device to obtain a CPA reaction product; measuring the fluorescence intensity of the CPA reaction product, and judging whether the sample to be tested contains citrus Huanglongbing disease based on the presence or absence of the fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the sample to be tested is infected with citrus Huanglongbing disease, otherwise it is not infected. The present invention has developed a new on-site detection technology for citrus Huanglongbing disease pathogens. This technology innovatively integrates cross-primer amplification (CPA) technology with molecular beacon probes, combined with a pocket-type fluorescence detection base, to establish a set of simple, fast and accurate citrus field rapid pathogen detection system. The method has the following advantages: first, it achieves specific and highly sensitive identification of target pathogens, with a minimum detection limit of 4 copies / μL and a minimum positive DNA concentration detection limit of 160 fg / μL; second, the detection process is simple and fast, with a two-step operation and a full reaction time of 30 minutes (20 minutes if the pathogen content is high). The matching rate between field samples and standard detection technology results is as high as 95.65%, making it suitable for field operations and of great practical significance for ensuring the healthy development of the citrus industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Figure 1 is the specificity detection result of CPA primer probe set;

[0025] Figure 2This is the result of citrus Huanglongbing disease detection in different leaf parts;

[0026] Figure 3 The results of citrus Huanglongbing test in phloem tissues at different locations;

[0027] Figure 4 This is the result of the citrus Huanglongbing test on the fruit stalk tissue;

[0028] Figure 5 This is the result of citrus Huanglongbing test on peel tissue;

[0029] Figure 6 This is the test result of citrus Huanglongbing disease for samples E1 to E10 from the Citrus Testing Center;

[0030] Figure 7 This is the test result of citrus Huanglongbing disease on samples E11, E12, E17, E19 and E26 from the Citrus Testing Center;

[0031] Figure 8 This is the result of citrus Huanglongbing test in Nanfeng, Fuzhou (NF-A1~NF-A9);

[0032] Figure 9 This is the result of citrus Huanglongbing testing in Nanfeng, Fuzhou (NF-B1~NF-C9);

[0033] Figure 10 This is the test result of citrus Huanglongbing from samples P062 to P107 outside the testing center;

[0034] Figure 11 This is the result of the Huanglongbing test for citrus fruits in Xinfeng Anyuan;

[0035] Figure 12 Results of citrus Huanglongbing testing on long-term negative materials (nursery). DETAILED DESCRIPTION

[0036] The present invention provides a CPA primer-probe set for detecting citrus Huanglongbing fungus, comprising a primer set and a probe HLB-P; the primer set comprises HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR and HLB-RB;

[0037] The nucleotide sequences of HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR and HLB-RB are shown in SEQ ID NO: 1 to SEQ ID NO: 6, respectively; the nucleotide sequence of the probe HLB-P is shown in SEQ ID NO: 7.

[0038] In the present invention, the CPA primer-probe set is designed based on the conserved region sequence of the outer membrane protein of the citrus Huanglongbing disease fungus. It has high specificity and can specifically identify the citrus Huanglongbing disease fungus, while ignoring common citrus pathogens such as Xanthomonas aeruginosa, anthrax, Bacillus subtilis, and four viruses (Citrus tristeza virus, Citrus yellow vein virus, Citrus crisp leaf virus, and Citrus bark viroid). The CPA primer-probe set has high sensitivity, with a minimum detection limit of 4 copies / μL and a minimum detection concentration of 160 fg / μL.

[0039] In the present invention, the 5' end of the HLB-P probe is preferably labeled with a fluorescent group, and the 3' end of the HLB-P probe is preferably labeled with a quencher group. The fluorescent group preferably includes FAM, and the quencher preferably includes BHQ1. The present invention does not impose any particular restrictions on the source of the CPA primer-probe set. In the present embodiment, the CPA primer-probe set was synthesized by Sangon Biotechnology Co., Ltd.

[0040] The invention provides a kit for detecting citrus Huanglongbing fungus, comprising the primer probe set and a CPA reaction buffer.

[0041] In the present invention, the kit further comprises Bst DNA polymerase, dNTPs, betaine, and magnesium ions. The magnesium ions preferably comprise magnesium sulfate. The kit further comprises a crude DNA extract. In an embodiment of the present invention, the crude nucleic acid extract is AMP1 nucleic acid lysate, purchased from Agdia (Cat. No. 00117 / 0020).

[0042] The invention provides a device for detecting citrus Huanglongbing fungus, comprising the reagent kit and a fluorescence detection device.

[0043] In the present invention, the device preferably further comprises a grinding device, wherein the grinding device comprises a grinding bag.

[0044] The present invention provides a method for detecting citrus Huanglongbing fungus based on a fluorescent base, comprising the following steps:

[0045] Using the genomic DNA of the sample to be detected as a template, performing a CPA reaction using the primer probe set, the kit or the device to obtain a CPA reaction product;

[0046] The fluorescence intensity of the CPA reaction product is measured, and whether the sample to be tested contains citrus Huanglongbing fungus is determined based on the presence or absence of the fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the sample to be tested is infected with citrus Huanglongbing fungus, otherwise it is not infected.

[0047] In the present invention, the genomic DNA of the sample to be tested is used as a template. The genomic DNA is preferably extracted using the CTAB method or a commercial DNA crude extract.

[0048] After extracting genomic DNA from the sample to be tested, a CPA reaction is performed using the primer probe set or the kit to obtain a CPA reaction product. In the present invention, the CPA reaction system is preferably 500 μL and contains the following components at the following concentrations: HLB-FB 0.2 μM, HLB-AP 2 μM, HLB-OP 2 μM, HLB-IP 1 μM, HLB-CPR 2 μM, HLB-RB 0.2 μM, probe HLB-P 0.3 μM, 1× CPA reaction buffer, Bst DNA polymerase 6 U, dNTPs 0.3 mM, magnesium ions 6 mM, and betaine 1 M. The CPA reaction procedure is: maintain at 63°C for 15-30 minutes.

[0049] The fluorescence intensity of the CPA reaction product is measured, and whether the sample to be tested contains citrus Huanglongbing fungus is determined based on the presence or absence of the fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the sample to be tested is infected with citrus Huanglongbing fungus, otherwise it is not infected.

[0050] In an embodiment of the present invention, genomic DNA is extracted using a commercial crude DNA extract method. This commercial crude DNA extract method includes adding the crude extract to the tissue of the sample to be tested, grinding it to obtain a nucleic acid extract, and then adding the nucleic acid extract to a CPA reaction buffer to undergo a lysis reaction to obtain genomic DNA. The lysis reaction temperature is preferably 92-97°C, more preferably 93-96°C, and most preferably 95°C. The lysis reaction time is preferably 2-10 minutes, more preferably 3-7 minutes, and most preferably 5 minutes. The lysis reaction apparatus preferably includes a fluorescent base. The fluorescent base is purchased from Hangzhou Yousida Company. The crude nucleic acid extract is AMP1 crude extract, purchased from Agdia Company. The grinding apparatus preferably includes a grinding bag. The grinding bag is purchased from Wangnuo Company (model 30 wire; size 4×7 cm). In an embodiment of the present invention, the crude extraction method is to take four leaf main veins (each main vein is approximately 1 cm), place them in the grinding bag, add approximately 250 μL of the crude extract, grind them thoroughly with a pestle, and then use a pipette to remove approximately 5 μL of the crude extract as a template for the subsequent reaction. After obtaining genomic DNA using the crude extraction method, the primer probe set is added to the CPA reaction buffer containing the genomic DNA and placed on a fluorescent base for CPA reaction. After the reaction is completed at 63°C for 15 to 30 minutes, when the fluorescence intensity signal of the CPA reaction product is higher than the threshold value (1000 fluorescence), the fluorescent base shows positive, indicating that the sample to be tested is infected with citrus Huanglongbing fungus; when the fluorescence intensity signal of the CPA reaction product is lower than the threshold value, the fluorescent base shows negative, indicating that the sample to be tested is not infected with citrus Huanglongbing fungus. When the reaction is completed, if the fluorescent base shows invalid (no fluorescence), it indicates that there is a problem with the sample processing or the reagent, and re-reaction is required.

[0051] The present invention constructs a novel CPA platform for rapid nucleic acid detection, which integrates the advantages of cross-primer amplification technology and molecular beacon system. By combining the efficient amplification ability of CPA with the real-time detection characteristics of molecular beacons, a one-step rapid detection of target nucleic acid sequences is achieved. First, CPA-specific primers are designed for the outer membrane protein omp-specific gene sequence, and a corresponding nucleic acid amplification detection system is constructed. The sensitivity of the detection system is evaluated by gradient dilution of plasmid standards and known positive DNA samples to determine its minimum detection limit. In order to verify the applicability of the method, genomic DNA extracted by CTAB method and nucleic acids extracted from different materials such as grapefruit and navel orange by rapid crude extraction are used as templates for methodological validation to investigate its detection efficiency and stability. After the method validation is completed, the detection system is directly used to detect samples in the field to evaluate its field application value.

[0052] The method of the present invention has a simple and fast detection process, good specificity, high field matching rate, and diverse detection materials. The method of the present invention is divided into two steps: genomic DNA extraction and CAP reaction, and the whole reaction process is 30 minutes (20 minutes if the pathogen content is high). In the embodiment of the present invention, a systematic field verification test was carried out in the main citrus producing areas such as Ganzhou and Fuzhou in Jiangxi Province. The results showed that the detection accuracy of the method of the present invention for strong positive samples with a Ct value below 30 reached 100%, and the overall detection matching rate was 95.65% (154 / 161, see Table 8). It can be seen that the method of the present invention provides a reliable technical means for the diagnosis of different tissues of citrus Huanglongbing, and at the same time lays an important technical foundation for the real-time monitoring of field diseases and the formulation of prevention and control strategies, which has important practical significance for ensuring the healthy development of the citrus industry.

[0053] In order to further illustrate the present invention, the solutions provided by the present invention are described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0054] Example 1

[0055] Design of CPA primer probe set and establishment of reaction system

[0056] Through a comprehensive search and systematic analysis of relevant genomic literature on the citrus Huanglongbing pathogen (Candidatus Liberibacter asiaticus), the outer membrane protein gene omp was identified as a specific detection target. Based on the conserved sequence region of this target gene, a primer set for the CPA reaction was designed. After optimizing reaction conditions and verifying specificity, the optimal primer combination and its sequence information were obtained, as detailed in Table 1. Following systematic optimization and condition screening, the final CPA reaction system components and corresponding concentration parameters were determined, as detailed in Table 2.

[0057] Table 1 CPA specific primer sequences

[0058]

[0059] Table 2 Optimized CPA reaction system

[0060]

[0061]

[0062] Example 2

[0063] CPA primer probe set specificity assessment method

[0064] Specific amplification detection was performed on pathogens and leaf microorganisms that are prone to citrus for a long time, including carpet bacillus), anthrax, Bacillus subtilis, and four viruses (citrus tristeza virus, citrus yellow vein virus, citrus crisp leaf virus, and citrus bark virus).

[0065] 1. CTAB method was used to extract the total DNA of citrus Huanglongbing disease. The specific steps are as follows:

[0066] 1) Take one fresh, clean leaf from each of the upper, middle, and lower branches and chop the main veins. Place the leaves in a grinding tube and add six appropriately sized steel balls. Soak the tube in liquid nitrogen for approximately 5 minutes. Then, fix the tube in a tissue grinder and grind rapidly.

[0067] 2) Use a toothpick to pick up an appropriate amount of tissue powder and place it in a 2.0 mL centrifuge tube containing 1 mL of CTAB solution (containing proteinase K). Place the tube on a vortex shaker and shake vigorously. Then, insert the tube into a floating plate and incubate in a 65°C water bath for 2 hours, shaking 2-3 times during the process.

[0068] 3) Remove the centrifuge tube and centrifuge at 12900 rpm at room temperature for 1 min;

[0069] 4) Take 600 μL of the supernatant and place it in a 1.5 mL centrifuge tube. Add 600 μL of phenol:chloroform:isoamyl alcohol (25:24:1). Place the tube on a vortex shaker and shake vigorously until it becomes milky. Let it stand at room temperature for 3 minutes and then centrifuge at 12900 rpm for 5 minutes at room temperature.

[0070] 5) After centrifugation, take 300 μL of the supernatant and place it in a 1.5 mL centrifuge tube. Add an equal volume of isopropanol solution and 1 / 10 volume of sodium acetate. Mix by gently inverting the tube upside down and let it stand at -20°C for 1 hour.

[0071] 6) Centrifuge at 4000 rpm for 7 min at room temperature; discard the supernatant and rinse twice with 75% ethanol, centrifuging at 4000 rpm and 7000 rpm for 2 min and 1 min respectively;

[0072] 7) After the final wash, centrifuge at 7000 rpm for 30 seconds at room temperature to remove excess alcohol, dry in a 65°C metal bath until transparent, add 50 μL of ddH2O to dissolve, and centrifuge at low speed to obtain the nucleic acid sample to be used in subsequent experiments.

[0073] The extraction method for carpet Xanthomonas, anthrax bacteria, Bacillus subtilis and four viruses is the CTAB method.

[0074] 2. Specificity of the CPA Primer Probe Set

[0075] Detection tube A contains 500 μL of CPA reaction buffer containing betaine. After adding 5 μL of the nucleic acid sample to be tested, the final concentration of betaine is 1 M.

[0076] Tube B contains a vitrified powdered substance. After dissolving in the CPA reaction buffer containing betaine and the nucleic acid sample mixture in tube A, the final concentrations of the components are: HLB-FB 0.2μM, HLB-AP 2μM, HLB-OP 2μM, HLB-IP 1μM, HLB-CPR2μM, HLB-RB 0.2μM, HLB-P 0.3μM, dNTP 0.3mM, BST Enzyme 6U, MgSO4 6 mM.

[0077] The components in tubes A and B are processed and installed in the tubes by Ustar Company.

[0078] Using a fluorescent base (purchased from Hangzhou Ustar Company, model PN0102) as the detection device, CPA primer probe sets were used to perform CPA amplification on different pathogens to verify the specificity of the CPA primer probe set. The CPA amplification method is as follows:

[0079] A. Take out test tube A and test tube B and place them on a stable surface;

[0080] B. Open the lid of test tube A and add 5 μL of the nucleic acid sample to be tested using a pipette;

[0081] C. Insert test tube A into the lysis hole (the two vertical lines on the wall of tube A are aligned with the hole). Press and hold the power button for 5 seconds. The lysis indicator light will turn from green to flashing blue, indicating that lysis has begun (lysis temperature is 95°C and lysis time is 5 minutes).

[0082] D. After lysis, the blue light turns green and a warning tone sounds. Remove test tube A and cool it at room temperature for 2 minutes.

[0083] E. After cooling, transfer the liquid in tube A to tube B and mix the liquid in tube A with the reagent in tube B.

[0084] F. Insert the soft plastic part of test tube B into the thermostat hole of the fluorescent base for isothermal amplification. Press and hold the power button for 5 seconds. The reaction indicator light will flash from green to blue, indicating that the reaction has started (the temperature for isothermal amplification is 65°C).

[0085] G. Wait for 15 to 30 minutes (depending on the content of citrus Huanglongbing disease. If the sample to be tested is citrus Huanglongbing disease, wait for 15 minutes, and wait for other pathogens for 30 minutes). The prompt sound and indicator light will display the result.

[0086] The test results showed that when the sample was tested for citrus Huanglongbing, the test result was positive. When the sample was tested for carpet Xanthomonas, anthrax, Bacillus subtilis, and four viruses, the test results were negative. This shows that the CPA primer probe set has a high specificity for the detection of citrus Huanglongbing.

[0087] Example 3

[0088] CPA primer probe set sensitivity detection method

[0089] The recombinant plasmid was constructed using the coding gene of the target outer membrane protein fragment, and was used as a standard for detection sensitivity analysis.

[0090] 1. The recombinant plasmid uses the cloning T vector pMD TM The recombinant plasmid was constructed using the 19-T Vector Cloning Kit (Code No. 6013, Takara). The ligation system of the recombinant plasmid is shown in Table 3.

[0091] Table 3 Ligation system of recombinant plasmids

[0092] Components volume Target gene fragment (gel recovery product) 4.5 μL pMD19-T vector 0.5μL SolutionI 5μL Total volume 10 μL

[0093]

[0094] 2. Sensitivity Determination Method for CPA Primer Probe Set Detection of Plasmid Samples

[0095] The recombinant plasmid sample containing the omp fragment was placed in tube A as a positive test sample for reaction to a final concentration of 20 copies / μL, 10 copies / μL, 4 copies / μL, and 2 copies / μL. CPA amplification was performed using the method of Example 2 using a fluorescent base as the detection device.

[0096] Table 4 Results of plasmid amplification using the CPA primer-probe set

[0097] Plasmid concentration (copy number / μL) 20 copies / μL 10 copies / μL 4 copies / μL 2 copies / μL Positive samples / total samples 10 / 10 10 / 10 9 / 10 7 / 10

[0098] The results of plasmid CPA amplification (Table 4) showed that the detection rate was 100% when the plasmid concentration was 10 copies / μL.

[0099] Based on a laboratory-established method for quantitative detection of Huanglongbing pathogen-specific copy number (Xie L, Zeng X, Amir MB, et al. Clathrin heavy chain is involved in infection of Candidatus Liberibacter asiaticus in the host vector Diaphorina citri [J]. Insect Science, 2024, 31(4): 1326-1332.), the detection sensitivity of the system was evaluated using real-time fluorescence quantitative PCR. First, the positive sample DNA was accurately quantified, and then the positive DNA was graded diluted with water to determine the minimum detection limit of the method.

[0100] Table 5 Results of amplification of positive DNA by CPA primer probe set (reaction system: 505 μL)

[0101] Positive DNA concentration 1.6 ng / μL 160 pg / μL 16 pg / μL 1.6 pg / μL 160 fg / μL 16 fg / μL Positive samples / total samples 5 / 5 5 / 5 5 / 5 5 / 5 5 / 5 0 / 5

[0102] The results of positive DNA amplification using the CPA primer-probe set (Table 5) showed that the lowest detectable positive DNA concentration was 160 fg / μL. These results demonstrate that this technique has high sensitivity for the detection of citrus Huanglongbing disease.

[0103] Example 4

[0104] Method for rapid detection of crude nucleic acid in the field using CPA primer probe set

[0105] 1. Conduct conventional PCR testing for citrus Huanglongbing disease on leaf samples from citrus fruits 1-5. The specific method is as follows.

[0106] The total DNA of the pathogen in the samples was extracted according to the CTAB method in Example 2, and then the PCR detection method for citrus Huanglongbing fungus recommended by the national standard GB / T 28062-2011 "Real-time fluorescence PCR detection method for citrus Huanglongbing fungus" was used to perform conventional PCR detection on samples 1-5.

[0107] Common PCR detection primers:

[0108] HLB-OI1: GGCCGTATGCAATACGAGCGGCA (SEQ ID NO: 9);

[0109] HLB-OI2: GCGTCGCGACTTCGCAACCCAT (SEQ ID NO: 10);

[0110] The common PCR reaction system is shown in Table 6, and the reaction procedure is shown in Table 7.

[0111] Table 6 Common PCR reaction system

[0112] Element Volume (μL) 2×Taq Master Mix (Dye Plus) (Novozymes) 12.5 HLB-OI1 1 HLB-OI2 1 DNA template 2 <![CDATA[ddH2O]]> 8.5

[0113] Table 7 Common PCR detection procedures

[0114]

[0115] After the conventional PCR reaction is completed, the amplified product is detected by electrophoresis.

[0116] 2. CPA primer probe set for rapid detection of crude leaf nucleic acid

[0117] Leaf samples of citrus trees No. 1-5 were rapidly crudely extracted in the field. 4-6 leaves were randomly selected for each sample, and the leaves were divided into the left mesophyll, main vein, and right mesophyll for testing. DNA from the leaves of sample No. 1-5 was extracted using AMP1 crude extract (the crude extraction method was as follows: 250 μL of crude extract was added to each milligram of sample, and the leaves were ground in a grinding bag to obtain a nucleic acid extract). CPA amplification detection was then performed using a fluorescent base as the detection device using the method of Example 2.

[0118] Conventional PCR test results ( Figure 2 ) showed that samples 1, 3, and 5 were positive, while samples 2 and 4 were negative. The CPA primer probe group test results were consistent with the ordinary PCR test results. The CPA primer probe group test results for samples 1, 3, and 5 are shown in Figure 2 In addition, the mesophyll tissue and vein tissue of all tested samples showed positive reactions, confirming that the citrus Huanglongbing fungus was distributed systemically in the leaf tissue.

[0119] 3. Rapid detection of citrus phloem regions

[0120] Using No. 1 positive citrus tree as the experimental material, phloem tissue was collected from different parts of the tree for citrus Huanglongbing testing. Rapid testing was performed using the CPA primer probe set, using the same method as described above for leaf testing.

[0121] The experimental results showed that the results of conventional PCR detection and rapid detection by CPA primer probe group were consistent. The detection result of phloem No. 1 was negative, and the detection results of phloem No. 2, phloem No. 3 and phloem No. 4 were positive, indicating that the distribution of citrus Huanglongbing fungus in the host tree showed significant spatial heterogeneity.

[0122] Citrus peel and pedicle tissues were collected for citrus Huanglongbing detection, and the results of conventional PCR detection and CPA primer probe set were rapid detection ( Figure 4 and Figure 5 ), indicating that the method of the present invention can detect different sample objects.

[0123] Example 5

[0124] Detection methods of citrus Huanglongbing in different citrus producing areas

[0125] To ensure the reliability and practical value of the detection technology, systematic field verification tests were carried out in major citrus producing areas such as Ganzhou and Fuzhou in Jiangxi Province.

[0126] 1. The qPCR method was used to detect citrus Huanglongbing disease. The specific method is as follows.

[0127] The total DNA of the pathogen in the samples was extracted according to the CTAB method in Example 2, and then qPCR detection was performed on samples 1-5 using the method recommended by the national standard GB / T28062-2011 "Real-time fluorescence PCR detection method for citrus Huanglongbing fungus".

[0128] Details of qPCR detection primers and reaction system refer to national standards.

[0129] 2. CPA primer probe set for rapid detection of crude leaf nucleic acid

[0130] The method for rapid detection of crude leaf nucleic acid using the CPA primer probe set is the same as that in Example 4.

[0131] Results of qPCR and CPA primer probe set rapid detection (Table 8 and Figures 6 to 12) showed that the CPA primer-probe set rapid test had a 100% detection accuracy rate for strongly positive samples with Ct values ​​below 30, with an overall match rate of 95.65% (154 / 161). This included detection rates of 89.7% (26 / 29) in the Nanfeng region, 100% (5 / 5) in the Anyuan region, and 100% (40 / 40) of long-term negative samples in the nursery. See Table 8 for details. These empirical data strongly demonstrate that the CPA primer-probe set rapid test method not only has absolute detection capabilities for highly infected samples but also accurately discriminates samples with varying degrees of infection, demonstrating excellent sensitivity and reliability.

[0132] Table 8 Results of qPCR and CPA primer probe set rapid detection

[0133]

[0134]

[0135]

[0136]

[0137] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments can be obtained based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A CPA primer probe set for detecting citrus Huanglongbing fungus, characterized in that: Includes primer set and probe HLB-P; The primer set includes HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR and HLB-RB; The nucleotide sequences of HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR and HLB-RB are shown in SEQ ID NO: 1 to SEQ ID NO: 6, respectively; The nucleotide sequence of the probe HLB-P is shown in SEQ ID NO:

7.

2. The CPA primer probe set according to claim 1, characterized in that The probe HLB-P 5 ′ The 3 end of the probe HLB-P is labeled with a fluorescent group. ′ The end is labeled with a quencher group.

3. The primer probe set according to claim 2, characterized in that: The fluorescent group includes FAM, and the quencher group includes BHQ1.

4. A kit for detecting citrus Huanglongbing fungus, characterized in that: The method comprises the primer probe set according to any one of claims 1 to 3, a CPA reaction buffer, Bst DNA polymerase, dNTPs, betaine and magnesium ions.

5. The kit according to claim 4, characterized in that Also includes crude DNA extract.

6. A device for detecting citrus Huanglongbing fungus, characterized in that: The method comprises the kit according to claim 4 or 5 and a fluorescence detection device.

7. The device according to claim 6, characterized in that The device also includes a grinding device.

8. A method for detecting citrus Huanglongbing fungus based on a fluorescence detection device, characterized in that: The following steps are involved: Using the genomic DNA of the sample to be tested as a template, a CPA reaction is performed using the primer probe set according to any one of claims 1 to 3, the kit according to claim 4 or 5, or the device according to claim 6 or 7 to obtain a CPA reaction product; The fluorescence intensity of the CPA reaction product is measured, and whether the sample to be tested contains citrus Huanglongbing fungus is determined based on the presence or absence of the fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the sample to be tested is infected with citrus Huanglongbing fungus, otherwise it is not infected.

9. The method according to claim 8, characterized in that The reaction system of the CPA reaction is 500 μL, and the reaction system of the CPA reaction contains the following components at the following concentrations: HLB-FB 0.2 μM, HLB-AP 2 μM, HLB-OP 2 μM, HLB-IP 1 μM, HLB-CPR 2 μM, HLB-RB 0.2 μM, probe HLB-P 0.3 μM, 1× CPA reaction buffer, Bst DNA polymerase 6 U, dNTPs 0.3 mM, magnesium ions 6 mM and betaine 1 M.

10. The method according to claim 8 or 9, characterized in that: The reaction procedure of the CPA reaction is: maintaining at 63° C. for 15 to 30 minutes.

Images