A functional recombinant cas9 protein targeted to the oocyte of procambarus clarkii and application thereof

By targeting recombinant Cas9 proteins NLs-VgSP-Cas9-NLs in red swamp crayfish oocytes, the delivery challenge of gene editing in crustacean oocytes has been solved, achieving efficient and precise gene editing while avoiding cell damage and immune responses.

CN120536388BActive Publication Date: 2026-04-21ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
Filing Date
2025-07-25
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

In existing technologies, the delivery systems for gene editing of crustacean oocytes lack tissue specificity, making it difficult to accurately target oocytes and potentially triggering immune responses, resulting in low delivery efficiency and cell damage.

Method used

A functional recombinant Cas9 protein, NLs-VgSP-Cas9-NLs, targeting redclaw crayfish oocytes was designed. It binds to the VgR receptor on the surface of redclaw crayfish oocytes and has DNA cleavage activity and nuclear localization signaling, which can be used for efficient targeted delivery and editing of the IAG gene in oocytes.

Benefits of technology

It achieves efficient and precise oocyte editing, reduces the risk of exogenous gene integration and immune response, improves germ cell editing efficiency, and reduces microinjection mortality and off-target effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120536388B_ABST
    Figure CN120536388B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biology and particularly relates to a functional recombinant Cas9 protein targeted to an ovocyte of Procambarus clarkii and application thereof. The protein is NLs-VgSP-Cas9-NLs. The application directly delivers the recombinant Cas9 protein, thereby reducing the risk of integration of exogenous genes. By specifically targeting the ovocyte, off-target effects on somatic cells can be avoided, the efficiency of editing of germ cells is improved, and early development or genetic manipulation can be conveniently studied. The ovocyte of Procambarus clarkii is large, the recombinant Cas9 protein is efficiently delivered by receptor-mediated endocytosis on the surface of the ovocyte, and the problem that microinjection of zygotes cannot be implemented is solved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a functional recombinant Cas9 protein that targets red swamp crayfish oocytes and its applications. Background Technology

[0002] Gene editing refers to the process of modifying specific targets in an organism's genome using gene editing technology. It efficiently and precisely inserts, deletes, or replaces genes, thereby altering their genetic information and phenotypic traits. Gene editing technology is a revolutionary biotechnology used to modify the genome of organisms. It is based on a variety of tools that enable scientists to precisely edit and alter specific gene sequences.

[0003] Crustacean gene editing primarily relies on microinjection or electrotransfer of the Cas9 / sgRNA complex; however, the oocyte membrane barrier leads to low delivery efficiency and easily causes cell damage. Efficiently targeting and delivering gene-editing elements to oocytes remains a technological bottleneck in crustacean gene editing and reproductive regulation. Existing delivery systems (such as liposomes and viral vectors) lack tissue specificity, making precise targeting of oocytes difficult and potentially triggering immune responses. While VgR is known to be highly expressed on the oocyte surface and mediates endocytosis, no studies have yet explored its fusion with the Cas9 protein for crustacean gene editing.

[0004] Redclaw crayfish ( Cheraxquadricarinatus Also known as the Australian freshwater crayfish, it belongs to the genus *Pleurotus* of the family Pleurotus. It is native to Australia and Papua New Guinea. A valuable freshwater economic shrimp species, it is highly tolerant of environmental conditions and has a significantly higher meat yield than other species.

[0005] Patent CN119978074A provides a red swamp crayfish ( Cheraxquadricarinatus This invention discloses an oocyte-targeting penetration peptide and its in vivo delivery method. A VgR-specific binding peptide, VgSP, was screened and a live delivery method was established to specifically recognize oocytes for targeted delivery. However, this invention only provides the method of targeted penetration and delivery; it does not specifically investigate which protein can be delivered for effective editing in redclaw crayfish. It is known that VgR is highly expressed on the surface of oocytes and mediates endocytosis, but no studies have yet investigated its fusion with the Cas9 protein for crustacean gene editing. Summary of the Invention

[0006] To overcome the problems of poor targeting, low efficiency, insufficient research on delivery substances, and damage to oocytes during delivery in existing technologies, this invention selects a recombinant protein NLs-VgSP-Cas9-NLs with oocyte entry and base cleavage activity for research, and provides a functional recombinant Cas9 protein for oocyte targeting in red swamp crayfish and its application.

[0007] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows:

[0008] The first aspect of this invention provides a functional recombinant Cas9 protein that targets red swamp crayfish oocytes, specifically NLs-VgSP-Cas9-NLs, whose amino acid sequence is shown in SEQ ID NO.1.

[0009] Furthermore, the N-terminus of this recombinant protein has a targeting domain VgSP that specifically binds to receptors on the surface of red swamp crayfish oocytes, and its amino acid sequence is shown in SEQ ID NO.2.

[0010] Furthermore, this recombinant protein possesses DNA cleavage activity in Cas9 of Streptococcus pyogenes.

[0011] Furthermore, the recombinant protein has three NLS nuclear localization signals, located at the N-terminus and C-terminus of the Cas9 protein, and between the VgSP peptide and the Cas9 protein, respectively.

[0012] Furthermore, the recombinant protein has a 6His tag for visually tracking protein expression, which is fused at the N-terminus.

[0013] The second aspect of this invention provides the application of the above-mentioned functional recombinant Cas9 protein targeting red swamp crayfish oocytes in specifically entering red swamp crayfish oocytes and targeting the IAG gene for cleavage.

[0014] The third aspect of this invention provides the application of the above-mentioned functional recombinant Cas9 protein targeting red swamp crayfish oocytes in the in vitro targeted cleavage of the IAG gene.

[0015] The fourth aspect of the present invention provides an sgRNA that guides the recombinant Cas9 protein to target and cleave the IAG gene, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0016] The fifth aspect of the present invention provides a complex formed by the above-mentioned sgRNA and the above-mentioned recombinant Cas9 protein.

[0017] The sixth aspect of the present invention provides the application of the above-mentioned complex in in vitro targeted cleavage of the IAG gene, which shows cleavage activity against the target sequence of the IAG gene in in vitro experiments, with a cleavage efficiency greater than 90%.

[0018] The beneficial effects of this invention are mainly reflected in:

[0019] (1) Direct delivery of recombinant Cas9 protein reduces the risk of foreign gene integration and is faster than transcription-translation-dependent delivery methods. By specifically targeting oocytes (e.g., using oocyte-specific promoters or ligand-receptor delivery systems), off-target effects on somatic cells can be avoided, improving germ cell editing efficiency and facilitating research on early development or genetic manipulation.

[0020] (2) Targeted editing of reproduction-related genes (such as vitellogenin, hormone receptors, etc.) in oocytes can help to understand their reproductive mechanisms and provide tools for artificial breeding;

[0021] (3) The membrane of the fertilized egg of the red swamp crayfish is thick and opaque, making it difficult to determine the microinjection site. Moreover, the mortality rate after microinjection is high. The recombinant Cas9 protein can be efficiently delivered through endocytosis mediated by the oocyte surface receptor, which solves the problem that microinjection of fertilized eggs cannot be carried out.

[0022] (4) The protein degrades rapidly within the cell, reducing off-target effects caused by long-term expression. It also contains no exogenous DNA, avoiding immune responses or genomic insertion mutations that may be triggered by plasmids or viral vectors. Attached Figure Description

[0023] Figure 1 The SDS-PAGE electrophoresis results for the NLs-VgSP-Cas9-NLs recombinant protein.

[0024] Figure 2 This is a sensing map of the binding of the NLs-VgSP-Cas9-NLs recombinant protein to VgR.

[0025] Figure 3 The binding sensing map of the NLs-VgSP-Cas9-NLs recombinant protein to VgR is shown in Table 2. Note: Lane 1 is the marker, and the components of lanes 2-5 are shown in Table 2.

[0026] Figure 4 This is a His immunofluorescence analysis image of female shrimp ovarian tissue after injection of NLs-VgSP-Cas9-NLs recombinant protein. Note: Blue signal represents cell nuclei, and red signal represents NLs-VgSP-Cas9-NLs recombinant protein. Detailed Implementation

[0027] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, unless otherwise specified, the following embodiments and features can be combined with each other. Unless otherwise specified, the methods used in the embodiments of the present invention are conventional methods, and the reagents used are commercially available.

[0028] Example 1: Obtaining functional recombinant Cas9 protein NLs-VgSP-Cas9-NLs from red swamp crayfish oocytes

[0029] After optimizing the amino acid sequence according to the *E. coli* codon, it was cloned into the multiple cloning site of the prokaryotic expression vector pET-28a(+) to construct the recombinant expression vector pET-28a-NLs-VgSP-Cas9-NLs. The recombinant plasmid was transformed into *E. coli* BL21(DE3) competent cells, plated on LB agar plates containing kanamycin, and cultured at 37°C for 12 hours. Single colonies were picked and inoculated into 5 mL of LB medium and cultured at 37°C with shaking until OD (out of control). 600 Approximately 0.6 mg / L of IPTG was added to a final concentration of 0.5 mM and expression was induced at 16°C for 20 hours. After collecting the bacterial cells, they were resuspended in PBS buffer, sonicated, centrifuged, and the supernatant was purified by nickel affinity chromatography. The expression and size of the recombinant protein were verified using SDS-PAGE. The protein was stored at -80°C for later use, ultimately yielding a Cas9 recombinant protein with oocyte targeting function, which can be used for subsequent gene editing experiments. Figure 1 The SDS-PAGE electrophoresis results of the NLs-VgSP-Cas9-NLs recombinant protein are shown in Figure 1. Lane 1 is the protein marker (Bio-rad, Cat. No. 1610374S), Lane 2 is BSA (2.00 µg), and Lane 3 is the NLs-VgSP-Cas9-NLs recombinant protein.

[0030] The amino acid sequence of NLs-VgSP-Cas9-NLs of the present invention is shown in SEQ ID NO.1.

[0031] The NLs-VgSP-Cas9-NLs protein of this invention has a targeting-binding domain VgSP at its N-terminus that specifically binds to the receptor on the surface of red swamp crayfish oocytes. The amino acid sequence of VgSP is SEQ ID NO.2. It contains Streptococcus pyogenes Cas9 (SpCas9) with DNA cleavage activity. It has three NLS nuclear localization signals, located at the N-terminus and C-terminus of the Cas9 protein, and between the VgSP peptide and the Cas9 protein, respectively, to improve the efficiency of protein nuclear entry (SV40 NLSPKKKRKV). It has a 6His tag for visually tracking protein expression, which is fused at the N-terminus for visually tracking protein expression.

[0032] Example 2: Interaction analysis of functional recombinant Cas9 proteins NLs-VgSP-Cas9-NLs with VgR targeting red swamp crayfish oocytes

[0033] Biomembrane interferometry (BLI) analysis showed that the recombinant protein of this invention exhibited a binding rate constant Ka of 3.118E+03 and an affinity constant KD of 4.363E-11 with the VgR receptor, indicating rapid binding and high stability. Figure 2 This is a sensing map of the binding of the NLs-VgSP-Cas9-NLs recombinant protein to VgR in BLi analysis. Table 1 shows the results of local fitting of BLi kinetics (1:1 binding).

[0034] Table 1. Results of Local Fitting of BLi Dynamics (1:1 Combination)

[0035]

[0036] Example 3: In vitro transcription and purification of SgRNA

[0037] The upstream primer for the IAG gene target used in this embodiment is:

[0038] GATCACTAATACGACTCACTATAGGGGTCATACATGGAGACACGTTTTAGAGCTAGAAATAGC (SEQ ID NO.4);

[0039] The downstream primer for the IAG gene target is:

[0040] AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (SEQ ID NO. 5).

[0041] The target sequence for the sgRNA guiding the Cas9 protein is the red swamp crayfish (Calamus spp.). CheraxquadricarinatusThe 20nt specific region of the IAG gene is GGGGTCATACATGGAGACAC (SEQ ID NO.6), and the nucleotide sequence of the sgRNA is GATCACTAATACGACTCACTATAGGGGTCATACATGGAGACACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT (SEQ ID NO.3).

[0042] Primer powder was diluted to a concentration of 10 mM for PCR. The reaction mixture consisted of 1.5 μL of upstream primer, 1.5 μL of downstream primer, 10 μL of NEBNext® High-Fidelity 2X PCR Master Mix, and 7 μL of DEPC water. The PCR amplification conditions were as follows: pre-denaturation at 94 °C for 3 min, followed by 24 cycles: 94 °C for 30 s, 65 °C for 30 s, and 72 °C for 1 min; a final extension at 72 °C for 5 min, and a final extension at 4 °C. The product was confirmed as a single band, slightly larger than 100 bp, by agarose gel electrophoresis. The product was recovered using an Axygen PCR clean kit and used as a template for in vitro transcription. In vitro transcription was performed using the Promega P1300 T7 in vitro transcription kit. A 20 μL system was prepared according to the kit instructions and transcribed at 37°C for 4 h. 1 μL of DNase was added, and the mixture was treated at 37°C for 20 min. Afterward, the mixture was placed on ice. 1 μL was taken for agarose gel electrophoresis to confirm a single band. Then, 115 μL of LDPPC-treated water, 15 μL of 0.5 M EDTA, and 300 μL of anhydrous ethanol were added. The mixture was thoroughly mixed and incubated overnight at -20°C. Afterward, the mixture was centrifuged at 13000 rpm at 4°C for 20 min. The mixture was washed twice with cold ethanol prepared with 75% DEPC, and centrifuged again at 13000 rpm at 4°C to remove residual ethanol. 40 μL of LDPPC-treated water was added. Agarose gel electrophoresis confirmed a single band, and the concentration was determined. The mixture was stored at -80°C.

[0043] Example 4: Detection of in vitro cleavage efficiency of functional recombinant Cas9 protein NLs-VgSP-Cas9-NLs targeted by red swamp crayfish oocytes

[0044] The in vitro cleavage efficiency of recombinant Cas9 protein NLs-VgSP-Cas9-NLs was detected using the IAG gene fragment from redclaw crayfish as the target sequence. Using redclaw crayfish genomic DNA as a template, PCR amplification was performed using primer pairs IAG-ex3F1: TGATTGGTGTCGTGGGTACG (SEQ ID NO.7) and IAG-ex3R1: ATATACGGCTCTGTGGGCGA (SEQ ID NO.8). The product length was 750 bp, and the target fragment was recovered using the EasyPure® PCR Purification Kit. Neb EnGen Spy Cas9 NLS protein (NEB #M0646M), containing nuclear localization sequences (NLS) at both the N-terminus and C-terminus, and spCas9 from Beijing Weishang Lide Biotechnology Co., Ltd., without NLS, were used as positive controls. A negative control group without any Cas9 protein was also included. Mixtures were prepared according to the groupings in Table 2, and the bands were detected by agarose gel electrophoresis after incubation at 37°C for 1 h. Figure 3 ).

[0045] The results showed that only two fragments of 500bp and 250bp were observed in the NLs-VgSP-Cas9-NLs recombinant protein experimental group and the EnGen Spy Cas9 NLS positive control group. Three fragments of 750bp, 500bp and 250bp were observed in the DNA to be digested in the spCas9 positive control group. The negative control group without Cas9 protein only had one 750bp band. This indicates that the cleavage efficiency of the target fragment in the NLs-VgSP-Cas9-NLs recombinant protein experimental group and the EnGen Spy Cas9 NLS positive control group is close to 100%, which is significantly better than that of spCas9 protein.

[0046] Table 2 Enzyme digestion reaction system

[0047]

[0048] Example 5: Detection of oocyte-targeting activity of functional recombinant Cas9 protein NLs-VgSP-Cas9-NLs from red swamp crayfish.

[0049] Mix 80 μL (200 μg) of NLs-VgSP-Cas9-NLs protein and 12.5 μL (30 μg) of sgRNA thoroughly. Add 92.5 μL of 1X NEBuffer™ r3.1, mix well, and incubate on ice for 5 min. Using a microsyringe with a needle bevel angle of 45°C, draw 18.5 μL of the mixture and inject it into the ovary through the genital pore of the third walking leg of the female shrimp, inserting the needle to a depth of approximately 5 mm. Inject half of the mixture into each of the left and right genital pores. 48 h after injection, euthanize the injected individuals under cold shock. The ovarian tissue is collected and preserved in 4% paraformaldehyde for at least 24 h. Paraffin sections are prepared, and the sections are stained with DAPI and analyzed by immunofluorescence. The primary antibody used is Abways' His-tag (AB0002mou) at a dilution of 1:200, and the secondary antibody used is Pinofi Biotechnology's Cy3-labeled goat anti-mouse IgG (PN0086) at a dilution of 1:500. The blue fluorescent signal indicates the location of the cell nucleus, and the red fluorescent signal indicates the location of the NLs-VgSP-Cas9-NLs recombinant protein.

[0050] like Figure 4 As shown, the results indicate that a large number of positive signal vesicles can be observed near the inner membrane of the oocytes of red swamp crayfish, indicating that the NLs-VgSP-Cas9-NLs recombinant protein can successfully enter the oocytes of red swamp crayfish.

Claims

1. A functionally recombinant Cas9 protein targeted to Procambarus clarkia oocyte, characterized in that, The protein is specifically NLs-VgSP-Cas9-NLs, and its amino acid sequence is shown in SEQ ID NO.

1. The N-terminus of this recombinant protein has a targeting-binding domain VgSP that specifically binds to the receptor on the surface of red swamp crayfish oocytes, and its amino acid sequence is shown in SEQ ID NO.

2. This recombinant protein has DNA-cutting activity of Streptococcus pyogenes Cas9. This recombinant protein has three NLS nuclear localization signals, located at the N-terminus and C-terminus of the Cas9 protein, and between the VgSP peptide and the Cas9 protein, respectively. This recombinant protein has a 6His tag for visually tracking protein expression, and the 6His tag is fused at the N-terminus.

2. The application of the functional recombinant Cas9 protein targeting redclaw crayfish oocytes as described in claim 1 in specifically entering redclaw crayfish oocytes to target and cleave the IAG gene, and in in vitro targeted cleavage of the IAG gene.

3. A complex formed by an sgRNA and the recombinant protein of claim 1, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO.

3.

4. The application of the complex as described in claim 3 in in vitro targeted cleavage of the IAG gene.

Citation Information

Patent Citations

  • PDA (at) CRISPR / Cas9 / sgHMGA2 NPs complex, preparation method and application

    CN114426960A

  • DsRNA nucleic acid liposome targeting IAG gene and preparation method and application thereof

    CN116240210A

  • Cherax quadricarinatus oocyte targeted penetrating peptide VgSP and in-vivo delivery method thereof

    CN119978074A