Wheat fructokinase TaFRK2-7B1 molecular marker and application
By developing the molecular marker of wheat TaFRK2-7B1, using KASP technology and genetic transformation methods, the problem of grain weight improvement in wheat was solved, and the grain yield was increased during efficient screening and breeding.
Patent Information
- Application Number
- CN202510186933.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-17
- Publication Date
- 2025-08-26
AI Technical Summary
The prior art has not seen any molecular marker TaFRK2-7B1 related genes related to wheat grain weight and their applications, which has led to difficulties in increasing grain yield in wheat breeding.
Wet TaFRK2-7B1 molecular marker was developed, and the SNP variant sites in the promoter region were detected, and the AA and GG type haplotypes were distinguished using KASP molecular marker technology, combined with agarose gel electrophoresis and fluorescence signal detection, genotypes were identified, and gene function was verified through Agrobacterium-mediated genetic transformation method.
Efficient screening and tracking of TaFRK2-7B1 gene in wheat varieties/strains was achieved, which increased starch content, 100-grain weight, 100-grain length and grain width, enhanced fructose kinase activity, and promoted the increase in yield in wheat breeding.
Smart Images

Figure CN120536612A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and in particular relates to a molecular marker of a wheat grain weight-related gene TaFRK2-7B1 and an application thereof. Background Art
[0002] As one of the world's most important staple foods, wheat (Triticum aestivum L.) plays an essential role in ensuring food security. Due to a growing population, the impact of climate change, and limited land resources, increasing grain yields to achieve food security is imperative. Improving wheat size and weight has become a major goal of wheat breeding.
[0003] Researchers have expended considerable effort to identify and locate genes and QTLs associated with wheat grain weight. Compared to traditional selection, marker-assisted selection (MAS) offers greater accuracy, efficiency, lower overall costs, and a shorter breeding cycle. In the tide of modern agricultural technology, molecular marker-assisted breeding has become an important tool for improving crop yield and quality.
[0004] Grain filling, a decisive factor in wheat yield, involves the remobilization of photoassimilates, such as sucrose, into the developing grain. Sucrose, the primary carbon resource in the metabolic pathway, must be cleaved by sucrose synthase (SUS) into UDG-glucose and fructose, or alternatively, by invertase into glucose and fructose for further sugar metabolism. Before further metabolism, fructose must first be phosphorylated to fructose-6-phosphate by fructokinase (FRK) or hexokinase (HXK). FRKs have a much higher affinity for fructose than HXKs, suggesting that fructose in plants may be primarily phosphorylated by FRKs. Since fructose accounts for half of the hexoses produced by sucrose cleavage in sink tissues, FRKs are crucial for metabolic pathways and organic matter formation in sink tissues. Therefore, developing molecular markers for FRK, a gene associated with grain weight, and screening for superior haplotypes have important scientific value and broad application prospects for improving TGW and grain yield in future wheat breeding in my country. Currently, no molecular markers for the wheat grain weight-related gene TaFRK2-7B1 and their applications are known. Summary of the Invention
[0005] In view of the shortcomings of the existing technology, the present invention provides a molecular marker for the wheat grain weight-related gene TaFRK2-7B1 and its application. To achieve the above-mentioned purpose, the present invention adopts the following technical solutions:
[0006] 1. Application of the wheat TaFRK2-7B1 molecular marker in the selection of grain weight lines, wherein the molecular marker positions include the AA type as shown in SEQ ID No. 1, where position 201 is A; and the GG type as shown in SEQ ID No. 2, where position 201 is G. Selection is performed using the following method:
[0007] (1) Extracting wheat DNA: Extract the genomic DNA of the wheat to be tested, and perform PCR amplification using the following two pairs of specific primers to obtain the PCR amplification product;
[0008] (2) Detection of PCR amplification products by agarose gel electrophoresis;
[0009] (3) SNP detection: The genotype is determined by detecting the fluorescent signal of the PCR amplification product. If the PCR amplification product only shows the color of the fluorescent label connected to the 5' end of the DNA molecule as shown in the sequence list SEQ ID NO.1, the genotype of the wheat SNP marker to be tested is AA; if the PCR amplification product only shows the color of the fluorescent label connected to the 5' end of the DNA molecule as shown in the sequence list SEQ ID NO.2, the genotype of the wheat SNP marker to be tested is GG;
[0010] (4) Identify varieties or lines with genotype GG as wheat with high starch content, thousand-grain weight, grain length, and grain width.
[0011] 2. Application of wheat TaFRK2-7B1 molecular marker in grain weight variety selection. The TaFRK2-7B1 molecular marker is a SNP variation site located at -1344bp from the start codon in the promoter region of the wheat gene TaFRK2-7B1 (TraesCS7B02G219800.1), which can be divided into two different haplotypes: AA and GG.
[0012] 3. Application of the wheat TaFRK2-7B1 molecular marker in the selection of grain weight lines, the agarose gel electrophoresis primers are: KASP-TaFRK2-7B1-F1: 5'-GAAGGTCGGAGTCAACGGATTGACCTAATACGCCATGTG GACT-3'; KASP-TaFRK2-7B1-F2: 5'-GAAGGTGACCAAGTTCATGCTACCTAATACGCCATG TGGACC-3'; KASP-TaFRK2-7B1-R: 5'-GACGATGACGGAGGAGCC-3'.
[0013] 4. Functional verification of the wheat grain weight-related gene TaFRK2-7B1: The specific method is as follows:
[0014] (1) Clone the TaFRK2-7B1 gene and construct a transgenic overexpression recombinant vector;
[0015] (2) Using Agrobacterium-mediated genetic transformation, the recombinant vector was introduced into the recipient material 11; a TaFRK2-7B1 overexpression homozygous strain was obtained by screening;
[0016] (3) The fructokinase activity of the grains of the recipient rice Zhonghua 11 and the transgenic homozygous rice at the middle stage of grain filling was determined, the mature grains were photographed, and the thousand-grain weight, grain length, and grain width were measured and statistically analyzed.
[0017] 5. Application of overexpression of wheat TaFRK2-7B1 gene to improve 1000-grain weight, grain length, grain width and grain thickness of rice. The CDS sequence of wheat TaFRK2-7B1 gene is shown in SEQ ID NO.3.
[0018] Compared with existing technologies, the present invention has the following advantages: It provides a molecular marker for the wheat grain weight-related gene TaFRK2-7B1. This molecular marker, developed using the KASP molecular marker targeting a single nucleotide polymorphism (SNP) in the promoter region of the weight-measuring gene TaFRK2-7B1, was used to perform genotyping and phenotypic association analysis on 247 wheat germplasm samples from different ecological regions in my country. The results showed that the KASP-TaFRK2-7B1 molecular marker could classify different wheat varieties into two haplotypes: haplotype TaFRK2-7B1a and haplotype TaFRK2-7B1b. Wheat materials with the A / A genotype of the TaFRK2-7B1a and TaFRK2-7B1b genotypes had significantly greater starch content, 1000-grain weight, grain length, and grain width than those with the A / A genotype. This indicates that the G / G genotype is a superior allele that positively regulates starch content, grain weight, and grain width in wheat. Furthermore, TaFRK2-7B1b exhibited higher TGW and stronger fructokinase activity than TaFRK2-7B1a, and its fructokinase activity was correlated with TGW and fructose content. During the breeding process, the aggregation of favorable mutant alleles is consistent with the results of increased yield in crop breeding. Therefore, the KASP-TaFRK2-7B1 molecular marker provided by this invention can efficiently detect and track the TaFRK2-7B1 gene in wheat varieties and lines, providing technical support for improving high-yield wheat breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 This is the qRT-PCR analysis of the expression pattern of TaFRK2-7B1 in different organs in the present invention.
[0020] Figure 2These are the detection results of the two haplotype wheat materials in the present invention; A. The promoter regions of the two haplotypes of the TaFRK2-7B1 gene both contain SNP sites; B. A TaFRK2-7B1-KSAP marker developed based on -1344bp (A / G). Red circles represent alleles (A); blue circles represent alleles (G), green circles represent heterozygous A / G alleles, and pink and black circles represent missing values; C. Amplification of 1091bp sequence based on -1344bp (A / G) and 553bp sequence in the CDS region; 1-6 represent varieties with the first haplotype, including Jinmai 68, Hanxuan 12, Qingnong 3, Chang 6452, Longyuan 964, and Lantian 9; 7-12 represent varieties with the second haplotype, including Nongda 311, Chang 6878, Nongda 183, Yuandong 834, Longjian 4, and Lude 1; D. Verification of 4 SNPs in 12 wheat germplasms containing 2 haplotypes.
[0021] Figure 3 TaFRK2-7B1a and TaFRK2-7B1b were associated with SC, TGW, GL, and GW in 247 wheat accessions from five environmental alleles of the present invention. E1-E5 were collected from Tongwei, Gansu (35°11′N, 105°19′E, 1750 m above sea level) in 2021, Zhuanglang (35°21′N, 105°58′E, 2110 m above sea level) in 2022, and Zhuanglang (34°34′N, 105°53′E, 1550 m above sea level) in 2023. *P < 0.05; **P < 0.01.
[0022] Figure 4 To determine the fructokinase activity and the contents of TGW, SC, fructose, etc.
[0023] Figure 5 is the spatiotemporal distribution of the TaFRK2-7B1 haplotype in the present invention; A. is the geographical distribution of TaFRK2-7B1 haplotype varieties in my country; B is the frequency of TaFRK2-7B1 allele variation in wheat breeding projects in China in different decades.
[0024] Figure 6Analysis of fructokinase activity of TaFRK2-7B1 in 12 wheat accessions containing either TaFRK2-7B1a or TaFRK2-7B1b, in relation to fructose content (FC), starch content (SC), and 1000-grain weight (TGW). FC (A), SC (B), and TGW (C) are associated with fructokinase activity in two haplotypes of TaFRK2-7B1. JM68 (Jinmai 68); HX12 (Hanxuan 12); QN3 (Qingnong 3); C6452 (Chang 6452); LY964 (Longyuan 964); LT9 (Lantian 9); ND311 (Nongda 311); C6878 (Chang 6878); ND183 (Nongda 183); YD834 (Yuandong 834); LJ4 (Longjian 4); and LD1 (Lude 1) are shown. D. Scatter plot of fructokinase activity and FC. E. Scatter plot of fructokinase activity and SC. F. Scatter plot of fructokinase activity and TGW. R was calculated using linear regression. 2 value.
[0025] Figure 7 This is the TaFRK2-7B1 molecular marker sequence of the present invention, wherein the boxes are SNP sites.
[0026] Figure 8 is the CDS sequence of the TaFRK2-7B1 gene, where the underlined sequences are the start and stop codons. DETAILED DESCRIPTION
[0027] In order to make the purpose, technical solution and advantages of the invention clearer, the specific embodiments of the present invention are described in detail below with reference to the accompanying drawings. Examples of these preferred embodiments are illustrated in the accompanying drawings. The embodiments of the present invention shown in the accompanying drawings and described with reference to the accompanying drawings are merely exemplary, and the present invention is not limited to these embodiments. It should also be noted that in order to avoid obscuring the technical solution of the present invention due to unnecessary details, only the structures and / or processing steps closely related to the solution according to the present invention are shown in the accompanying drawings, and other details that are not very relevant are omitted.
[0028] Example 1
[0029] This example provides a TaFRK2-7B1 molecular marker and a method for obtaining the same, as follows:
[0030] 1. qRT-PCR Analysis of TaFRK2-7B1 Gene
[0031] The wheat roots, stems, leaves, young ears at the booting stage, and grains at 5, 10, 15, 20, 25, and 30 days after anthesis (DPA) were collected to obtain samples. Total RNA was extracted from the collected samples using a plant tissue RNA rapid extraction kit, and RNA concentration was determined using an ultramicrophotometer. First-strand cDNA was synthesized using the FastKing gDNA isolation method (Beijing). qRT-PCR analysis was performed using FastReal qPCR PreMix (SYBR Green) to determine the relative expression of the TaFRK2-7B1 gene in different tissues. Wheat tissue development expression analysis was performed using wheat GADPH as an internal reference gene (see L. Guo et al., 2022).
[0032] The PCR reaction volume was 20 μL, consisting of 10 μL FastReal qPCR PreMix (SYBR Green), 0.6 μL each of the forward and reverse primers, 2 μL cDNA, and 6.8 μL ddH₂O. PCR conditions were 95°C for 2 min, followed by 40 cycles of 95°C for 5 s, 60°C for 10 s, and 72°C for 15 s (fluorescence collection).
[0033] The primers used for qRT-PCR are shown in Table 1. -ΔΔCT Methods The relative expression level of the TaFRK2 gene was calculated (see Schmittgen & Livak, 2008). All quantifications were performed in triplicate.
[0034] Table 1 Primer information
[0035] Gene name Forward primer Reverse primer TaFRK2-7B1 CTAAAGCAGAACGGCGTGAAT TTAGAAGTTTCTTAGCAAATCTCGC GADDPH CCTTCCGTGTTCCCACTGTTG ATGCCCTTGAGGTTTCCCTC
[0036] The expression levels of TaFRK2-7B1 in roots, stems, leaves, young panicles at the booting stage and in grains at 5, 10, 15, 20, 25, and 30 DPA after anthesis were determined by qRT-PCR. Figure 1 qRT-PCR results showed that TaFRK2-7B1 was specifically expressed in young panicles, suggesting that it plays a potential role in young panicle development.
[0037] 2. Obtaining molecular markers for the wheat grain weight-related gene TaFRK2-7B1
[0038] The wheat grain weight-related gene TaFRK2-7B1 provided by the present invention encodes fructokinase. According to the analysis of 681 wheat resequencing data from the Wheat Genome Variation Union Database (http: / / wheat.cau.edu.cn / WheatUnion / ), it was found that the gene TaFRK2-7B1 has a SNP mutation site at -1344 bp from the promoter (such as Figure 2 A), can be divided into two different haplotypes, namely TaFRK2-7B1a and TaFRK2-7B1b.
[0039] To further confirm the SNP variation of this site in different materials, we used the cetyltrimethylammonium bromide (CTAB) method to extract DNA from 12 wheat materials containing two haplotypes (Stewart & Via, 1993). Specific primers were designed to amplify the sequences located at the four single nucleotide polymorphism (SNP) sites (e.g. Figure 2 C) The wheat materials used were cultivated by various breeding units and propagated in our laboratory.
[0040] The DNA extraction method is as follows: cut approximately 10 cm wheat leaves and grind them in a mortar with liquid nitrogen. Collect approximately 100 mg of sample in a centrifuge tube, add 800 μL of preheated CTAB solution, mix well, and then place in a 65°C water bath for 40 minutes, mixing once every 10 minutes; add 800 μL of chloroform:isoamyl alcohol (24:1) solution and mix well, let it stand for 20 minutes, and centrifuge at 12000 rpm / min for 10 minutes; take the supernatant, add an equal amount of chloroform:isoamyl alcohol (24:1) solution and mix well, and centrifuge at 12000 rpm / min for 10 minutes; take the supernatant, add 2 volumes of anhydrous ethanol, let it stand at -20°C for 30 minutes, centrifuge at 2000 rpm / min for 5 minutes, invert to dry, and add 200 μL of ddH2O containing 1% RNase.
[0041] The total PCR volume was 15 μL, including 7.5 μL 2* Red Taq MasterMix, 1 μL each of forward and reverse primers (10 μM), 1.5 μL DNA (200 ng μL-1) and 4 μL ddH2O.
[0042] PCR conditions were 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 1 min; with a final extension at 72°C for 5 min. PCR products were examined on 1% agarose gels, and the desired bands were purified using the Tiangen Gel Purification Kit (Tiangen, Beijing, China) and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing.
[0043] The sequencing results were consistent with the resequencing data from the Wheat Variation Joint Database (e.g. Figure 2 The base at the SNP of Jinmai 68, Hanxuan 12, Qingnong 3, Chang 6452, Longyuan 964, and Lantian 9 is A, while the base at the SNP of Nongda 311, Chang 6878, Nongda 183, Yuandong 834, Longjian 4, and Lude 1 is G.
[0044] The wheat grain weight-related SNP site provided by the present invention is located at -1344bp of the TaFRK2-7B1 promoter. The SNP (A / G) at the -1344bp position of the TaFRK2-7B1 promoter is converted into a homologous allele-specific PCR (KASP) molecular marker, named KASP-TaFRK2-7B1, KASP-TaFRK2-7B1.
[0045] Amplification primers (including two forward primers and one reverse primer, synthesized by Shanghai Sangon Biotechnology Co., Ltd.) were designed for the above-mentioned KASP molecular marker. The specific primers and their sequences are shown below:
[0046] KASP-TaFRK2-7B1-F1:'-GAAGGTCGGAGTCAACGGATTGACCTAATACGCCATGTG GACT-3'; KASP-TaFRK2-7B1-F2:5'-GAAGGTGACCAAGTTCATGCTACCTAATACGCCATG TGGACC-3'; KASP-TaFRK2-7B1-R:5'-GACGATGACGGAGGAGCC-3'.
[0047] Example 2
[0048] This example provides the application of TaFRK2-KASP in identifying wheat genotypes, as follows:
[0049] 1. Wheat genomic DNA extraction
[0050] Wheat leaves were collected at the three-leaf stage, and genomic DNA was extracted using the CTAB method. DNA concentration and quality were determined using a NanoDrop 2000 and 1% agarose gel electrophoresis. An A260 / A280 ratio of approximately 1.8 indicated acceptable sample quality.
[0051] 2. KASP marker amplification and detection
[0052] A two-step PCR reaction system was used: DNA denaturation at a higher temperature, followed by annealing and extension at the same lower temperature. The 4 μL PCR reaction system contained 2 μL of KASP Master mix (2×), 1 μL of SNP Primer Mix (primer mix 4×), 1 μL of DNA, and ddH20 to 4 μL.
[0053] The PCR amplification system was as follows: (1) 94°C, 15 min; (2) 94°C, 20 s; 61-55°C, decreasing by 0.6°C per cycle; 10 cycles in total; (3) 94°C, 20 s; 55°C, 45 s, 35 cycles. After the PCR amplification cycles were completed, the fluorescence value was read using the OMEGA SNP typing instrument. In this method, SNP site detection uses the fluorophores FAM (excitation light 485 nm, emission light 520 nm) and VIC (excitation light 535 nm, emission light 556 nm) to distinguish between two isogenic loci. The passive reference dye ROX (excitation light 575 nm, emission light 610 nm) was used to correct the signal difference between wells due to reaction volume error.
[0054] 3. Data Analysis
[0055] Data were analyzed using the genotype reading software KlusterCaller, in which VIC and FAM data were plotted on the x-axis and y-axis, respectively. The VIC and FAM values for each reaction well were corrected using the values of a reference dye (ROX) for that specific well, and the fluorescence values were normalized to obtain relative fluorescence values for VIC and FAM for each PCR reaction well. Samples were clustered based on relative fluorescence values, and genotypes were further determined based on sample clusters and fluorescence patterns.
[0056] Example 3
[0057] This example provides the application of the molecular marker KASP-TaFRK2-7B1 in identifying wheat starch content, thousand-grain weight, grain length, and grain width. The specific method is as follows:
[0058] 1. 247 wheat accessions from different ecological zones in my country (Table 1) were used. These accessions were planted at Tongwei Agricultural Station (35°11, 105°19, 1750 m above sea level) in 2021, at Tongwei and Zhuanglang Agricultural Stations (35°21, 105°58, 2110 m above sea level) in 2022, and at Tianshui Agricultural Station (34°34, 105°53, 1550 m above sea level) in 2023. The five planting environments were designated as 2021TW (Tongwei, 2021), 2022TW (Tongwei, 2022), 2022ZL (Zhuanglang, 2022), 2023ZL (Zhuanglang, 2023), and 2023TS (Tianshui, 2023). All wheat accessions were sown in late September and harvested in early July of the following year. The field experiment was conducted using a randomized block design with three replicates. Each material was planted in three rows with a row spacing of 20 cm and a row length of 1 m. 30 seeds were planted in each row. The seeds were tested after maturity. Three biological replicates were performed for each line.
[0059] 2. Seed length (GL), grain width (GW), and thousand-grain weight (TGW) were analyzed using a Wanshen SC-G automatic seed analyzer and a thousand-grain weight analyzer. Wheat starch content (SC) was measured using a near-infrared grain analyzer (NIRSDS2500, FOSS). All measurements were performed with three biological replicates. The specific data are shown in Table 1.
[0060] 3. Using the molecular markers provided in Example 1 and the method provided in Example 2, the significance between the phenotypes of wheat germplasm resources of the two genotypes was analyzed. The typing results were as follows: Figure 3 The one-way analysis of variance method using SPSS22.0 software was used to analyze whether there were significant differences in starch content (SC), thousand-grain weight (TGW), grain length (GL) and grain width (GW) of wheat with different genotypes. The specific data are shown in Tables 2 and Figure 3 .
[0061] Table 2 Grain phenotypic data of two haplotype wheat germplasm resources with TaRBL14a gene in different ecological zones
[0062]
[0063]
[0064] The results showed that wheat materials with the G / G genotype had significantly greater 1000-kernel weight, grain length, and grain width than those with the A / A genotype. This indicates that the G / G genotype is a superior allele with a positive effect on 1000-kernel weight and grain yield. This indicates that TaFRK2-7B1b is a superior haplotype for wheat SC, TGW, and grain yield.
[0065] Example 4
[0066] This example provides the application of TaFRK2-7B1b in positive selection in wheat breeding in China, as follows:
[0067] To investigate whether the superior haplotype TaFRK2-7B1b is actively selected in wheat breeding, we evaluated the geographical distribution of two TaFRK2-7B1 haplotypes in China using 305 wheat accessions from 12 provinces in China. Figure 5 A and Table 3. In each province, if the total number of varieties containing two haplotypes is greater than or equal to 4, they can be counted; if the total number is less than 4, the province will not be counted. The ratio of the two haplotype materials in different provinces is calculated.
[0068] The results showed that the frequency of TaFRK2-7B1b increased with decreasing latitude, while the frequency of TaFRK2-7B1a decreased slightly. We also found that TaFRK2-7B1b germplasm was predominant in Sichuan (68%), Tibet (76%), and Yunnan (87%). However, in China's major wheat-producing regions of Henan (67%), Shandong (58%), Shanxi (58%), and Jiangsu (57%), the frequency of TaFRK2-7B1b was higher than that of TaFRK2-7B1a.
[0069] Table 3 Geographical distribution of wheat germplasm resources with different haplotypes of TaFRK2-7B1 gene
[0070] area TaFRK2-7B1a quantity TaFRK2-7B1b quantity Beijing 6 7 Gansu 13 18 Hebei 10 10 Henan 6 12 Jiangsu 3 4 Ningxia 2 2 Qinghai 2 2 Shandong 10 15 Shanxi 10 11 Shaanxi 9 10 Sichuan 5 13 Tibet 18 88 Xinjiang 6 1 Yunnan 2 8
[0071] To determine whether the haplotype TaFRK2-7B1b has been positively selected during wheat breeding in China, we analyzed the allelic variation of the TaFRK2-7B1 gene during historical wheat breeding using 200 different wheat cultivars. Figure 5 B and Table 4. The years of all materials were divided into four time points: pre-1970, 1971-1985, 1986-2000, and post-2000, and the distribution frequencies of the two haplotype materials in the four time periods were calculated.
[0072] The results showed that TaFRK2-7B1b was positively selected during the history of wheat domestication. The spatiotemporal distribution results showed that the selection of the superior haplotype TaFRK2-7B1b could positively improve wheat grain traits during the history of wheat domestication in my country.
[0073] Table 4 Allele variation frequency of TaFRK2-7B1 in Chinese wheat breeding programs in different eras
[0074]
[0075] Example 5
[0076] This example provides a detailed association analysis method for the TaFRK2-7B1 haplotype and its relationship with grain-related traits, as follows:
[0077] 1. Test materials and phenotypic identification
[0078] This study used a natural population of 247 wheat varieties grown in the laboratory as experimental material (Table 2). These varieties were planted in Tongwei, Gansu Province in 2021, in Tongwei and Zhuanglang, Gansu Province in 2022, and in Tianshui and Zhuanglang, Gansu Province in 2023, designated E1-E5, respectively. After wheat maturity, random samples of each variety were threshed, and grain-related traits were measured with three replicates.
[0079] 2. Genotype identification and haplotype analysis of wheat TaFRK2-7B1 gene
[0080] The resequencing data of 681 hexaploid wheat samples in the WheatUnion database (http: / / wheat.cau.edu.cn / WheatUnion / ) were used to obtain the variant sites of the TaFRK2-7B1 gene in different wheat materials, check the genotypes, and perform haplotype analysis on the wheat TaFRK2-7B1 gene. The results showed that four SNP sites were found in the coding region of the TaFRK2-7B1 gene and one SNP site was found in the promoter region, forming two haplotypes, TaFRK2-7B1a and TaFRK2-7B1b. Figure 2 A).
[0081] 3. SNPs verification
[0082] To confirm the SNP variation at this site in different materials, DNA from 10 wheat materials containing two haplotypes was extracted using the cetyltrimethylammonium bromide (CTAB) method (Stewart & Via, 1993). Specific primers were designed to amplify the sequence of the single nucleotide polymorphism (SNP) site located in the promoter region. The sequencing results were consistent with the resequencing data from the Wheat Variation Joint Database ( Figure 2 C).
[0083] 4. Results of association analysis between molecular marker development of wheat TaFRK2-7B1 gene and grain-related traits
[0084] Based on the SNP (A / G) site at -1344bp in the promoter region of the TaFRK2-7B1 gene, molecular markers were developed and tested on 247 wheat materials of the research team to distinguish the two haplotypes TaFRK2-7B1a and TaFRK2-7B1b, and separate the varieties of the two haplotypes ( Figure 2 B).
[0085] Association analysis of grain-related traits of two haplotypes of TaFRK2-7B1 gene was performed using natural population materials in Table 2 ( Figure 3The results showed that the starch content of haplotype TaFRK2-7B1b was significantly higher than that of haplotype TaFRK2-7B1a in three environments (P<0.05); the 1000-grain weight of haplotype TaFRK2-7B1b was significantly higher than that of haplotype TaFRK2-7B1a in three environments (P<0.05); the grain width of haplotype TaFRK2-7B1b was significantly higher than that of haplotype TaFRK2-7B1a in two environments (P<0.05); and the grain length of haplotype TaFRK2-7B1b was significantly higher than that of haplotype TaFRK2-7B1a in two environments (P<0.05). The above results indicate that the TaFRK2-7B1 gene may affect grain weight by affecting grain starch content, grain length and grain width, and haplotype TaFRK2-7B1b is an excellent haplotype.
[0086] In addition, the TaFRK2-7B1b haplotype showed higher TGW and stronger fructokinase activity than TaFRK2-7B1a, and its fructokinase activity was highly correlated with TGW and fructose content ( Figure 4 ).
[0087] 5. Selection of wheat TaFRK2-7B1b haplotype in Chinese wheat breeding
[0088] During the wheat breeding process, superior alleles gradually accumulated. To determine whether the superior haplotype TaFRK2-7B1b was selected during wheat breeding, the geographical distribution of the two haplotypes TaFRK2-7B1a and TaFRK2-7B1b in my country was evaluated in 305 natural wheat population materials ( Figure 5 A). The results showed that the haplotype TaFRK2-7B1b accounts for a larger proportion than the haplotype TaFRK2-7B1b in the main wheat-producing areas of my country. It can be considered that the superior haplotype TaFRK2-7B1b has been actively selected in the wheat breeding process in my country. In order to further determine whether the haplotype TaFRK2-7B1b has been positively selected in the wheat breeding process in China, we used 200 different wheat varieties to analyze the allelic variation of the TaFRK2-7B1 gene in the historical wheat breeding process. The results showed that TaFRK2-7B1b has been actively selected in the wheat breeding process in my country ( Figure 5 B).
[0089] Therefore, the molecular marker KASP-TaFRK2-7B1 developed by the present invention for the TaFRK2-7B1 gene can be used to screen the excellent haplotype TaFRK2-7B1b of the TaFRK2-7B1 gene in different wheat germplasms. This molecular marker and the screened excellent haplotype can be applied to future molecular breeding work.
[0090] Example 6
[0091] This example provides a method for verifying the function of the wheat grain weight-related gene TaFRK2-7B1, as follows:
[0092] 1. Cloning of wheat TaFRK2-7B1 gene and construction of transgenic vector
[0093] Total RNA was extracted from wheat spikelets using the Trizal method, and concentration was measured using a NanoDrop 2000. An A260 / A280 ratio of approximately 2.0 indicated acceptable sample quality. The coding region of the TaFRK2-7B1 gene was cloned, and a 35S promoter-driven overexpression recombinant vector was constructed using homologous recombination.
[0094] 2. Construction of transgenic rice and screening of homozygous lines
[0095] The recombinant vector was introduced into the recipient material Zhonghua 11 using the Agrobacterium-mediated genetic transformation method, and the transgenic rice strain was obtained through resistance screening, differentiation, rooting, and seedling strengthening. The TaFRK2-7B1 overexpression homozygous strain was obtained through generation-by-generation resistance screening.
[0096] 3. Phenotypic Analysis of Transgenic Rice
[0097] The recipient rice variety Zhonghua 11 and the homozygous transgenic rice were potted in a greenhouse. Fructose kinase (FRK) activity was measured using a fructokinase (FRK) activity assay kit (Solarbio) in mid-grain filling. After maturity, 30 randomly selected plants from each material were photographed and measured for 1,000-grain weight, grain length, grain width, and grain thickness using a Wanshen SC-G automatic seed analyzer. Phenotypic values are the average of three replicates.
[0098] like Figure 6 As shown, the transgenic TaFRK2-7B1 rice had significantly higher fructokinase activity and larger grain length, width, and thickness than the recipient Zhonghua 11. Statistical analysis showed that the 1000-grain weight, grain length, width, and thickness of the transgenic TaFRK2-7B1 rice were significantly higher than those of the recipient Zhonghua 11.
[0099] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments.
[0100] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.
[0101] The above is only a specific implementation method of the present application. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present application, and these should also be considered as the scope of protection of the present application.
Claims
1. Application of wheat TaFRK2-7B1 molecular marker in the selection of grain weight lines, characterized by The molecular markers include the AA type shown in SEQ ID No. 1, where the 201st position is A; and the GG type shown in SEQ ID No. 2, where the 201st position is G. The application is achieved by using the molecular markers and the following method: (1) Extracting wheat DNA: Extract the genomic DNA of the wheat to be tested, and perform PCR amplification using the following two pairs of specific primers to obtain the PCR amplification product; (2) Detection of PCR amplification products by agarose gel electrophoresis; (3) SNP detection: The genotype is determined by detecting the fluorescent signal of the PCR amplification product. If the PCR amplification product only shows the color of the fluorescent label connected to the 5' end of the DNA molecule as shown in the sequence list SEQ ID NO.1, the genotype of the wheat SNP marker to be tested is AA; if the PCR amplification product only shows the color of the fluorescent label connected to the 5' end of the DNA molecule as shown in the sequence list SEQ ID NO.2, the genotype of the wheat SNP marker to be tested is GG; (4) Identify varieties or lines with genotype GG as wheat with high starch content, thousand-grain weight, grain length, and grain width.
2. The use of the wheat TaFRK2-7B1 molecular marker in the selection of grain weight lines according to claim 1, characterized in that The TaFRK2-7B1 molecular marker is a SNP variation site located at -1344 bp from the start codon in the promoter region of the wheat gene TaFRK2-7B1 (TraesCS7B02G219800.1), and can be divided into two different haplotypes, AA and GG.
3. The use of the wheat TaFRK2-7B1 molecular marker in the selection of grain weight lines according to claim 1, characterized in that The agarose gel electrophoresis primers are: KASP-TaFRK2-7B1-F1: 5'-GAAGGTCGGAGTCAACGGATTGACCTAATACGCCATGTGGACT-3'; KASP-TaFRK2-7B1-F2: 5'-GAAGGTGACCAAGTTCATGCTACCTAATACGCCATGTGGACC-3'; KASP-TaFRK2-7B1-R: 5'-GACGATGACGGAGG AGCC-3'.
4. Functional verification method of wheat grain weight-related gene TaFRK2-7B1, characterized by The specific method is as follows: (1) Clone the TaFRK2-7B1 gene and construct a transgenic overexpression recombinant vector; (2) Using Agrobacterium-mediated genetic transformation, the recombinant vector was introduced into the recipient material 11; a TaFRK2-7B1 overexpression homozygous strain was obtained by screening; (3) The fructokinase activity of the grains of the recipient rice Zhonghua 11 and the transgenic homozygous rice at the middle stage of grain filling was determined, the mature grains were photographed, and the thousand-grain weight, grain length, and grain width were measured and statistically analyzed.
5. Application of overexpressing wheat TaFRK2-7B1 gene to increase 1000-grain weight, grain length, grain width and grain thickness of rice, characterized in that The CDS sequence of the wheat TaFRK2-7B1 gene is shown in SEQ ID NO.3.