Molecular marker closely linked with green-keeping character of peanut leaves and application of molecular marker
Through the molecular marker C5-23 developed in the chromosome 16 interval of Peanuts, PCR amplification and gel electrophoresis detection, the problem of insufficient research on the genetic mechanism of peanut leaves holding green traits was solved, rapid screening and efficient breeding were achieved, and flower production potential was improved.
Patent Information
- Application Number
- CN202510771752.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-11
- Publication Date
- 2025-08-26
AI Technical Summary
Inadequate research on the genetic mechanism of peanut leaves holding green traits has led to slow breeding progress and low selection efficiency, making it difficult to increase flower production through genetic improvement.
A molecular marker C5-23, which is closely linked to the green trait of peanut leaves, was developed, located in the 476.3kb interval of chromosome 16 of Peanut No. 7,402,289 to 7,878,548, total. The C5-23-F/R was PCR amplified and gel electrophoretic detection using primers to quickly identify green and premature aging types, and assist in selection and breeding.
Accurate genetic positioning and rapid screening of peanut leaves with green traits, improve breeding progress and selection efficiency, break through the technical bottleneck of genetic improvement of peanut green traits, and promote the cultivation of new varieties of high-yield and reversible peanuts.
Smart Images

Figure CN120536622A_ABST
Abstract
Description
Technical field:
[0001] The invention belongs to the technical field of crop molecular genetics and molecular breeding, and particularly relates to a molecular marker C5-23 tightly linked to a stay-green trait of peanut leaves and an application thereof. Background technology:
[0002] As an important oil and cash crop in the world, improving the greenness of peanuts, delaying leaf aging through genetic improvement, and conducting in-depth research on the regulatory mechanism of chlorophyll degradation are of key theoretical significance for breeding high-yield and stable varieties, and have become a key strategy to break through the bottleneck of peanut production.
[0003] The stay-green trait in plants, a unique phenotype in plant physiology that describes the retention of chlorophyll and sustained photosynthetic function in leaves during senescence, serves as a decelerator for the aging process. During leaf senescence, chlorophyll degradation and a continuous decline in photosynthetic system II (PSII) activity ultimately lead to irreversible loss of photosynthetic capacity. The stay-green phenotype, characterized by a significant slowing of chlorophyll metabolism and a prolonged photosynthetic duration during leaf senescence, has important agronomic value for extending the grain filling period and improving grain plumpness. Research on the sink-source relationship in plants is considered a key avenue for achieving high crop yields and has been a focus of research by scholars both domestically and internationally. The "source-sink theory" primarily describes how sinks and sources regulate the transport and distribution of assimilates in plants (Gong Yuehua and Gao Junfeng, 1999). A "source" refers to the organ that produces and exports photosynthetic products, typically mature leaves; a "sink" refers to the organ that receives and consumes photosynthetic products, typically fruit. A harmonious sink-source relationship is considered the physiological basis for high crop yields (Peng Xiaoxiao, 2022). Photosynthesis intensity is determined by photosynthesis size (leaf area) and photosynthesis activity (net photosynthetic rate per unit area) (Barnett et al., 1983; Zhang et al., 2008). Chlorophyll, as a key photosynthesis substance, is the foundation of photosynthesis, and the duration of its stay-green trait directly determines the accumulation of assimilated biomass and yield potential (Jing Ruilian, 2007; Farré et al., 2016).
[0004] QTLs associated with the stay-green trait have also been precisely mapped in the genomes of many other crops. For example, key QTLs associated with the stay-green trait have been successfully identified using genetic mapping techniques in the genomes of important crops, including tomato (Lycopersicon esculentum) (Kerr, 1956), sorghum (Sorghum bicolor) (Vietor et al., 1989), maize (Zea mays L.) (Beavis et al., 1994), soybean (Glycine max) (Canfield et al., 1995), pepper (Capsicum annuum) (Alós et al., 2008), rice (Oryza sativa L.) (Morita et al., 2010), rice (Oryza sativa L.) (Fu et al., 2011), alfalfa (Medicago truncatula) (Zhou et al., 2011), and wheat (Triticum aestivum L.) (Yang et al., 2016). However, there is currently insufficient research on the genetic mechanism of the stay-green trait of peanut leaves. Summary of the invention:
[0005] The purpose of the present invention is to overcome the shortcomings of the existing technology and provide a molecular marker C5-23 that is tightly linked to the peanut leaf stay-green trait and its application. By detecting the genotype of the molecular marker linked to the gene locus related to the peanut leaf stay-green trait, marker-assisted selection is performed on the leaf stay-green allele loci and traits of the offspring individuals, thereby improving the selection efficiency of the trait and accelerating the breeding progress, providing a theoretical basis and technical support for accelerating the selection and breeding of new peanut varieties.
[0006] In order to achieve the above object, the technical solution adopted by the present invention is:
[0007] The present invention provides a molecular marker C5-23 that is tightly linked to the stay-green trait of peanut leaves. The molecular marker C5-23 is located within a 476.3 kb interval from 7,402,289 to 7,878,548 on peanut chromosome 16. The sequence of the corresponding stay-green peanut variety M74 within a range of 2 kb before and after the marker is shown in SEQ ID NO.1. The sequence of the corresponding early-aging peanut variety Yaqian Dalidun within a range of 2 kb before and after the marker is shown in SEQ ID NO.2.
[0008] SEQ ID NO.1:
[0009] ATTTAGATTCATGCTTTCTTCTACTTTTGATTCTCAATTCTTGTTGTTACATTCATCTTCC
[0010] TCTATTCTTTTGTTGTAATCTCTTCTATTTTGTTTCCATGCTTTGTTGTAGATCTACTTTT
[0011] GTTCCTTCTCTTCTTTTTTAATTCAATTGAGGTAATTCATAATAATTGTGTTCCCTTTG
[0012] ATTGTTGTTATTGATTTCTTACAATAATTGTTGTTAGATTTTATTGTTGTTATCCATTTAC
[0013] TATGCTTTTCTTTAGTGCCTTCCAAGTGTTTGATGAAATGCTTGGTTGGATTTTAGTGTA
[0014] GATTTTGTTCCTCTTGGCCTAGGTGGAGTAATTAGTAATGCTTGAGTATCTAATTCCTTT
[0015] GTCGATTGATAATTAGAGTTGCTAATTGATTTGGATACCACTAACGCTAGTCTTTCCC
[0016] TTGGGAGTTGGCTAGGACTTGTGGAATCAAGTTGATTCATCCACTTGACTTTCCTCCAT
[0017] TATTAGAGGTTAACTAAGTGGTAGCAATGGACAATTGTGGTCACAATCGAGGAGGATA
[0018] ACTAGGATAGGAACTTCTAATTCTCACAACCTTGCCAAGTGCTTTTTAGTTGTTAGTTTAT
[0019] TTTTATTGTCATTTACATTTCATGTCTCTTATCCCAAAACCCAAAATACAATCCATAAC
[0020] CAATAACAAGACACTTTATTGTAATTCCTAGGGAGAACGACCCGAGATTTGAATACTT
[0021] CGGTTTATAAATTTTAGGGGTTTGTTTTAGTGACAAACAACTTTTTGTATGAAAGAATT
[0022] AGTGATTGGTTTAGAAACTATACTTGCAACGAGAATTCATTTGTGAAATTCTATACCAT
[0023] CAAAAATCCATTCATCAGCCGTCCCAGTTGCATCCGAACAGTTGGGTTTCGATCCGCTG
[0024] CTTTGAGATGGTTTGTGAATATCTGGAGCTGCCGGTCTCCGTTGAAGTCTTTTTGTTTCT
[0025] TTTTACTCTGACGAATCCCTCTAAAGAGGGGAAGGCGAAGAAAGGCTTTATGTCTTTTC
[0026] GATCTGCCCAGGGTCGGAGGATTTTTGGTTTTTTTGAGGACTCCTACCATGGGTTTAAA
[0027] GATAAGTATTTCAAGGTTCGTCCAACGGAGGGCCATCACCCATTTTGGCTGACGTTGGA
[0028] AGGAGAATGCCGTATCCTGACCTATTGGAGTTTCGGGGCGGGAGCCAACGCCTTTACC
[0029] AAAGTGACATACAAAGGGTTGTCCTCCGTGAATAAAAGGGTTGCCGACGTCTTATTGG
[0030] CTGTATTTGGGAAGAATAATGTTAATCCCCATCTTCTTATGAGTGATCAGGATGTAGCT
[0031] AGGAATTATATTCATGAGTAGTGTTTTTTTTTATGACTAACGAGCTTCCGTGTTCTGTAC
[0032] TAGTGTCGATGGCTGGCGAGCAAGTTGGCCTTGAAGATTTATTTAACACCTTCCTTGCT
[0033] GGCGACAGCGACGAGGAACCGGCCCCCGAAAACCAGGCCACTGATAATCAAGAGGAT
[0034] CCTTCTCAGAATACCGTAGAGGCCGGAGCTCAGTCCCAACCCTCCCATGGAGCTCAGG
[0035] CCCCACCCTCCCATGGTGAGGTAATCGGGAATGATGGTGGCCCAGAACCTCGGCCGGA
[0036] GATCGAGGTGGAGAATCCAGATGTGATAATAGTGGACAATCAGAGAAAGAGAAAATC
[0037] GTCTTCTAGCCCGGAGTGAGCTCTCACCGTGATGGAGAAGAACTTTGATGCCGGGGAC
[0038] TTTATCGATTCCCAACTGCTCTCGAGCACAGAGGACTTCTTCCACGGTGGGGATCTCCC
[0039] TGCTCAGGCGAGATGGATGTATCGCTCGTTGCTCCGGGGAGCCGCTATAGCGAGGAAG
[0040] GCGGAGTTTGCTCTGACTGGGGCATATTTTTTGGAGAACAAACTTGAATCCTCTGTTCA
[0041] AGCAAACAACAAATACAAAGCTGAAGTAGAGTCACTTTGGGAGCAACTGGCTACCACT
[0042] CG GGAGAAGCTGGCTATTGCTG CAGAGAAGGTTAAGACTTTTGATTCCACCGTAGGGA
[0043] GATGACTTTGGAGAGTCAGCTCAACGT CGCTCAAGGAAAGGTGAAAG AAGCCAAAAA
[0044] AGAGCGTGATGAACCCCTGTCCTTGGCGACTGCGGCTAAGGATGAGGCAGCCGAATTA
[0045] AAGAGAAAGTACAAGGAGACCGTGAAGTAGGGAAAGAACGCCATCTTGATGACTGAG
[0046] GAGGCCCTCAAGGCTCAAGTAAAGCTGCTGGCTCCCGACTTCAATACCTCAGCTGTTA
[0047] GCGTTTTCAAGACCATCAAGGATGGGAAGATTGTCGACATCTCGAAGAAGTGATTTGG
[0048] TCTTGCCTTTGTACTTTGTTTTCTGTAATATGTAGATTTTTGTATACTTTTGGCTAGCTTG
[0049] ACTGTCATTTTTTGGTGTATGTAACAAGGTAGTTGTGGTGAACTGGGTTGCCGTTTTTG
[0050] GCAGATATGCAGCTAATTGCTTGTCTACCATCATTGTTTCTTACCGTTTTACTGGTAGTT
[0051] AATCGTTTCGCTTGGTAGTCGTTGGAGCCGATTTGTGGCTTTTAATATTTTGGGTTCCCG
[0052] GGGTGATCAGTCCCGGGGTGCCGTTTTGTTTTGCTTATTTAAGCGCGCAAAGAGAACAC
[0053] CCCTGAGTTTCAAATAAAATCTACGAGACATGATAATGATAAAGCCGAATAATATAAA
[0054] CACGGGGTAAAACAGACGACATAAACAACAATCATAAGTCAAAAGATCCCGTATACA
[0055] GCAATACAAATCTTACTCGCCTGGTTGAACCTGGTAGGTCGTTTGCTCGCCTAGCATGC
[0056] CTTGGCTGCTAGGATAAAACCTCCTTAGGTTAACCGAATTCCATGTCCTTGGTATTTCTT
[0057] TGCCATCAAGCCGTTCCAATTTGTAGGCCCCATTGCCGAGCACTTCTTTCACTTTGTAC
[0058] GGGCCTTCCCAATTTGCCGCCAGCTTTCCTTGCCCGGGTGTTAGTAACCCGATATCGTT
[0059] GCGTCGCATGACCAGGTCGTCCCGCTCGAATTCTCTCTTGAGTACCTTGGCATTGTAGC
[0060] GCAGAGCCATCTTCTGTTTTAACACCGTTTCCAACAAGTGGGCCATCTCCCTGGCTTCA
[0061] TCTACCAAGTCTTTTTCTATGGCTTCGTCGACTCCTCCTAGGAGTATCCGCGGGCTCGGT
[0062] TCGCCGATCTCTACAGGTATTACTGCGTCTACCCTATACGTGAGTTGAAAGGGGTCTCT
[0063] CCGGTGCTGGGTCGTGCGGTAGGACCAGAGGACTGATGCTAGCTCGTCCGCCCATGTC
[0064] CCCTTTTTCTGGTCAAGTCGCTTCTTGAGGCCCTGCAGGATGACCTTGTTCACCGCTTCT
[0065] ACTTGTCCGTTAGTCTGAGGATGTTCAACTGACGAGAACTTTTGCTGTATGCCCAGGCT
[0066] GGCAAGAAATTCTCCGAATCTTTTATCCGTGAACTGGGTCCCAGGATGTTCAACTGACG
[0067] ACTTCCAGTATTCCGAACCTGGCTATTATCTGTCTCCACATGGTTGGTCGGTTATCGGA
[0068] CGATTTAAGGTTGCTTGTTGGGTGTGAAGGTGGGTCCCTGCCTTGGCCTGGATCCTGGG
[0069] AATGAGAAGCGTGAGCAACCGACTTCCCGAGTTCTTCGCGAGGTGAGGGGGGTGCCAC
[0070] ATGCAAGGACACTCCGACGCTCAAGTCAGTAGGTGAGCAGGTGGTGAAGAGGAAAAG
[0071] TTATGGTGACGTACCTTGACCCCTCCCCCTATATACTGTGTCAGAGGTGGGCCCCTCGT
[0072] GGACAGACCCACCTTCCGCGAAGTTTCCCCTGCTAGCTGTTGCCAGGTGAGTTGGCTCC
[0073] CAGAAGAAAAGGTGTTTGGGTCAACAGCCGGACGCGTGGTGCCCCGCTGAACGATCGC
[0074] CCGGATCCGTCAAGGACGCGTGCCAGTCGGATCAACCATGGGGCCAGCTGGGCTGGGC
[0075] CGCAATAATTATTATAATAATTAATTAATTATTACAATAATTAATAAATATTAAATGAGATAAATTATGACTATTTTTAATTGACTTTTTTTATTATCAAATATTTCCGTTAACTC。
[0076] SEQ ID NO.2:
[0077] ATTTAGATTCATGCTTTCTTCTACTTTTGATTCTCAATTCTTGTTGTTACATTCATCTTCC
[0078] TCTATTCTTTTGTTGTAATCTCTTCTATTTTGTTTCCATGCTTTGTTGTAGATCTACTTTT
[0079] GTTCCTTCTCTTCTTTTTTAATTCAATTGAGGTAATTCATAATAATTGTGTTCCCTTTG
[0080] ATTGTTGTTATTGATTTCTTACAATAATTGTTGTTAGATTTTATTGTTGTTATCCATTTAC
[0081] TATGCTTTTCTTTAGTGCCTTCCAAGTGTTTGATGAAATGCTTGGTTGGATTTTAGTGTA
[0082] GATTTTGTTCCTCTTGGCCTAGGTGGAGTAATTAGTAATGCTTGAGTATCTAATTCCTTT
[0083] GTCGATTGATAATTAGAGTTGCTAATTGATTTGGATACCACTAACGCTAGTCTTTCCC
[0084] TTGGGAGTTGGCTAGGACTTGTGGAATCAAGTTGATTCATCCACTTGACTTTCCTCCAT
[0085] TATTAGAGGTTAACTAAGTGGTAGCAATGGACAATTGTGGTCACAATCGAGGAGGATA
[0086] ACTAGGATAGGAACTTCTAATTCTCACAACCTTGCCAAGTGCTTTTTAGTTGTTAGTTTAT
[0087] TTTTATTGTCATTTACATTTCATGTCTCTTATCCCAAAACCCAAAATACAATCCATAAC
[0088] CAATAACAAGACACTTTATTGTAATTCCTAGGGAGAACGACCCGAGATTTGAATACTT
[0089] CGGTTTATAAATTTTAGGGGTTTGTTTTAGTGACAAACAACTTTTTGTATGAAAGAATT
[0090] AGTGATTGGTTTAGAAACTATACTTGCAACGAGAATTCATTTGTGAAATTCTATACCAT
[0091] CAAAAATCCATTCATCAGCCGTCCCAGTTGCATCCGAACAGTTGGGTTTCGATCCGCTG
[0092] CTTTGAGATGGTTTGTGAATATCTGGAGCTGCCGGTCTCCGTTGAAGTCTTTTTGTTTCT
[0093] TTTTACTCTGACGAATCCCTCTAAAGAGGGGAAGGCGAAGAAAGGCTTTATGTCTTTTC
[0094] GATCTGCCCAGGGTCGGAGGATTTTTGGTTTTTTTGAGGACTCCTACCATGGGTTTAAA
[0095] GATAAGTATTTCAAGGTTCGTCCAACGGAGGGCCATCACCCATTTTGGCTGACGTTGGA
[0096] AGGAGAATGCCGTATCCTGACCTATTGGAGTTTCGGGGCGGGAGCCAACGCCTTTACC
[0097] AAAGTGACATACAAAGGGTTGTCCTCCGTGAATAAAAGGGTTGCCGACGTCTTATTGG
[0098] CTGTATTTGGGAAGAATAATGTTAATCCCCATCTTCTTATGAGTGATCAGGATGTAGCT
[0099] AGGAATTATATTCATGAGTAGTGTTTTTTTTTATGACTAACGAGCTTCCGTGTTCTGTAC
[0100] TAGTGTCGATGGCTGGCGAGCAAGTTGGCCTTGAAGATTTATTTAACACCTTCCTTGCT
[0101] GGCGACAGCGACGAGGAACCGGCCCCCGAAAACCAGGCCACTGATAATCAAGAGGAT
[0102] CCTTCTCAGAATACCGTAGAGGCCGGAGCTCAGTCCCAACCCTCCCATGGAGCTCAGG
[0103] CCCCACCCTCCCATGGTGAGGTAATCGGGAATGATGGTGGCCCAGAACCTCGGCCGGA
[0104] GATCGAGGTGGAGAATCCAGATGTGATAATAGTGGACAATCAGAGAAAGAGAAAATC
[0105] GTCTTCTAGCCCGGAGTGAGCTCTCACCGTGATGGAGAAGAACTTTGATGCCGGGGAC
[0106] TTTATCGATTCCCAACTGCTCTCGAGCACAGAGGACTTCTTCCACGGTGGGGATCTCCC
[0107] TGCTCAGGCGAGATGGATGTATCGCTCGTTGCTCCGGGGAGCCGCTATAGCGAGGAAG
[0108] GCGGAGTTTGCTCTGACTGGGGCATATTTTTTGGAGAACAAACTTGAATCCTCTGTTCA
[0109] AGCAAACAACAAATACAAAGCTGAAGTAGAGTCACTTTGGGAGCAACTGGCTACCACT
[0110] CG GGAGAAGCTGGCTATTGCTG CAGAGAAGGTTAAGACTTTTGATTCCACCGTTGCGC
[0111] GGCTTACCGAGAGGGAGATGACTTTGGAGAGTCAGCTCAACGT CGCTCAAGGAAAGGT
[0112] GAAAG AAGCCAAAAAAGAGCGTGATGAACCCCTGTCCTTGGCGACTGCGGCTAAGGA
[0113] TGAGGCAGCCGAATTAAAGAGAAAGTACAAGGAGACCGTGAAGTAGGAAAGAACGC
[0114] CATCTTGATGACTGAGGAGGCCTCAAGGCTCAAGTAAAGCTGCTGGCTCCCGACTTC
[0115] AATACCTCAGCTGTTAGCGTTTTCAAGACCATCAAGGATGGGAAGATTGTCGACATCTC
[0116] GAAGAAGTGATTTGGTCTTGCCTTTGACTTTGTTTTCTGTAATATGTAGATTTTTGTAT
[0117] ACTTTTGGCTAGCTTGACTGTCGTTTTTTGGTGTATGTAACAAGGTAGTTGTGGTGAAC
[0118] TGGGTTGCCGTTTTTGGCAGATATGCAGCTAATTGCTTGTCTACCATCATTGTTTCTTAC
[0119] CGTTTTACTGGTAGTTAATCGTTTCGCTTGGTAGTCGTTGGAGCCGATTTGTGGCTTTTA
[0120] ATATTTTGGGTTCCCGGGGTGATCAGTCCCGGGTGCCGTTTTGTTTTGCTTATTTAAGC
[0121] GCGCAAAGAGAACACCCCTGAGTTTTCAAATAAAATCTACGAGACATGATAATGATAAA
[0122] GCCGAATAATATAAACACGGGGTAAAACAGACAGACATAAACAACAATCATAAGTCAA
[0123] AAGATCCCGTATACAGCAATACAAATCTTTACTCGCCTGGTTGAACCTGGTAGGTCGTTT
[0124] GCTCGCCTAGCATGCCTTGGCTGCTAGGATAAAACCTCCTTAGGTTAACCGAATTCCAT
[0125] GTCCTTGGTATTTCTTTGCCATCAAGCCGTTCCAATTTGTAGGCCCCATTGCCGAGCACT
[0126] TCTTTCACTTTGTACGGGCCTTCCCAATTTGCCGCCAGCTTTCCTTGCCCGGGTGTTAGT
[0127] AACCCGATATCGTTGCGTCGCATGACCAGGTCGTCCCGCTCGAATTCTCTCTTGAGTAC
[0128] CTTGGCATTGTAGCGCAGAGCCATCTTCTGTTTTAACACCGTTTCCAACAAGTGGGCCA
[0129] TCTCCCTGGCTTCATCTACCAAGTCTTTTTCTATGGCTTCGTCGACTCCTCCTAGGAGTA
[0130] TCCGCGGGCTCGGTTCGCCGATCTCTACAGGTATTACTGCGTCTACCCTATACGTGAGT
[0131] TGAAAGGGGTCTCTCCGGTGCTGGGTCGTGCGGTAGGACCAGAGGACTGATGCTAGCT
[0132] CGTCCGCCCATGTCCCCTTTTTCTGGTCAAGTCGCTTCTTGAGGCCCTGCAGGATGACC
[0133] TTGTTCACCGCTTCTACTTGTCCGTTAGTCTGAGGATGTTCAACTGACGAGAACTTTTGC
[0134] TGTATGCCCAGGCTGGCAAGAAATTCTCCGAATCTTTTATCCGTGAACTGGGTCCCAGG
[0135] ATGTTCAACTGACGACTTCCAGTATTCCGAACCTGGCTATTATCTGTCTCCACATGGTT
[0136] GGTCGGTTATCGGACGATTTAAGGTTGCTTGTTGGGTGTGAAGGTGGGTCCCTGCCTTG
[0137] GCCTGGATCCTGGGAATGAGAAGCGTGAGCAACCGACTTCCCGAGTTCTTCGCGAGGT
[0138] GAGGGGGGTGCCACATGCAAGGACACTCCGACGCTCAAGTCAGTAGGTGAGCAGGTG
[0139] GTGAAGAGGAAAAGTTATGGTGACGTACCTTGACCCCTCCCCCTATATACTGTGTCAG
[0140] AGGTGGGCCCCTCGTGGACAGACCCACCTTCCGCGAAGTTTCCCCTGCTAGCTGTTGCC
[0141] AGGTGATTGGCTCCCAGAAGAAAAGGTGTTTGGGTCAACAGCCGGACGCGTGGTGCC
[0142] CCGCTGAACGATCGCCCGGATCCGTCAAGGACGCGTGCCAGTCGGATCAACCATGGGG
[0143] CCAGCTGGGCTGGGCCGCAATAATTATTATAATAATTAATTAATTATTACAATAATTAA
[0144] TAAATATTAAATGAGATAAATTATGACTATTTTTAATTGACTTTTTTTATTATCAAATATTTCCGTTAACTC.
[0145] The present invention also provides a primer pair for detecting the molecular marker C5-23 that is tightly linked to the stay-green leaf trait. The primer pair is C5-23-F / R, and the sequences are shown in SEQ ID NO. 3 and SEQ ID NO. 4:
[0146] C5-23-F:5`-GGAGAAGCTGGCTATTGCTG-3`(SEQ ID No.3),
[0147] C5-23-R:5`-CTTTCACCTTTCCTTGAGCG-3` (SEQ ID No. 4).
[0148] The present invention also provides a kit for detecting the stay-green trait of leaves, comprising the primer pair.
[0149] The present invention also provides a method for identifying the stay-green trait of peanut leaves, comprising the following steps:
[0150] (1) Extracting DNA from peanut leaves to be tested;
[0151] (2) PCR amplification of the extracted DNA was performed using primer pair C5-23-F / R;
[0152] (3) The amplified product obtained in step (2) is monitored by non-denaturing polyacrylamide gel electrophoresis. If a characteristic band of 119 bp appears, the phenotype of the peanut material to be tested is determined to be premature aging type; if a characteristic band of 135 bp appears, the phenotype of the peanut material to be tested is determined to be stay-green type; if both characteristic bands of 119 bp and 135 bp appear, the phenotype of the peanut to be tested is determined to be stay-green type.
[0153] Furthermore, in step (2), the total volume of the PCR amplification is 10 μL: DNA template 100-200 ng / μL 1 μL, primer pair 10 μM each 0.5 μL, 2×Taq Accurate Buffer 5 μL, RNase free water 3 μL.
[0154] Furthermore, in step (2), the PCR amplification reaction conditions are: pre-denaturation at 94°C for 30s; 98°C for 10s, 55°C for 30s, and 72°C for 1min, 35 cycles; and extension at 72°C for 2min.
[0155] Furthermore, in step (3), 8% non-denaturing polyacrylamide gel electrophoresis was used.
[0156] The present invention also provides an application of the primer pair or kit in peanut molecular marker-assisted breeding, specifically: using genomic DNA of a stay-green parent, an early-senescent parent, and their hybrid offspring as templates, the above-mentioned DNA templates are subjected to PCR amplification and gel detection using a primer pair labeled C5-23, and the genotype of the individual marker is determined based on the size of the amplified product of the hybrid offspring individual and the size of the amplified product of the parents, thereby determining the genotype of the gene related to the leaf stay-green trait and the leaf stay-green trait of the individual; if the size of the marker amplification of the offspring individual is the same as that of the stay-green parent, then the genotype of the gene related to the leaf stay-green trait of the individual is the stay-green parent type, and its phenotype is stay-green; if the size of the marker amplification of the offspring individual is the same as that of the early-senescent parent, then the genotype of the gene related to the leaf stay-green trait of the individual is the early-senescent parent type, and its phenotype is early-senescent; since stay-green is dominant to early-senescence, when the marker amplification product of the offspring individual contains both parental bands, the genotype of the gene related to the leaf stay-green trait of the individual is heterozygous, and the phenotype of the individual is stay-green.
[0157] In response to the current situation where there is insufficient research on the genetic mechanism of the stay-green trait of peanut leaves, the present invention constructs an F2 genetic population using the early-aging variety Yaqian Dalidun and the stay-green variety M74 as parents. By comprehensively applying Multiple BSA-seq, genetic map construction and QTL verification, a major QTL site on peanut chromosome 16 is successfully located, and its phenotypic variation explanation rate reaches 16.49%. The present invention has achieved the precise genetic positioning of the stay-green trait of peanuts for the first time, which not only provides a key target for analyzing the molecular regulatory network of peanut leaf aging, but also develops molecular markers with practical value for molecular marker-assisted selection. The research results have broken through the technical bottleneck of the genetic improvement of the stay-green trait of peanuts. Through the molecular marker-assisted selection of leaf stay-green traits, peanut varieties that maintain a high photosynthetic efficiency during maturity have opened up a new way to improve the yield potential of peanuts, and have important application value for breeding new high-yield and stress-resistant peanut varieties.
[0158] Compared with the prior art, the present invention has the following beneficial effects:
[0159] The InDel marker C5-23 of the gene locus related to the peanut leaf stay-green trait provided by the present invention is a simple, precise and rapid identification method with the advantages of simple technical requirements and high selection efficiency. Compared with CAPS molecular markers, it does not require steps such as enzyme digestion, purification, and recovery. It only needs to use primers to amplify the target band and identify the genotype of the amplified target band to distinguish between the stay-green type and the early-senescent type of peanuts, quickly screen the type of the leaf stay-green trait of peanut hybrid offspring, and assist in plant type breeding and yield breeding related to the leaf stay-green trait. The molecular marker of the present invention can effectively identify the leaf stay-green trait of peanuts, which, on the one hand, helps with the precise positioning, isolation and cloning of genes, and on the other hand, has important application value for molecular breeding and quality improvement of peanuts. Description of the drawings:
[0160] Figure 1 This is the leaf staying green phenotype diagram of the staying green type peanut parent M74 and the early aging type peanut variety Yaqian Dalidun involved in the present invention.
[0161] Figure 2 This is a schematic diagram of the principle of preliminary positioning of genes related to the stay-green trait of peanut leaves through Multiple BSA-seq involved in the present invention, wherein A is the ΔSNP-index algorithm, which calculates the difference in SNP-index values of two extreme individual pools, and takes the region with a 95% confidence level as the candidate interval; B is the BSA analysis result of the Gst method, which intuitively reflects the distribution of G values on chromosomes; C intuitively reflects the distribution of ED values on chromosomes.
[0162] Figure 3 Schematic diagram of the results of fine mapping of the gene controlling the stay-green trait of peanut leaves and the development of the tightly linked molecular marker C5-23.
[0163] Figure 4 Schematic diagram of electrophoresis detection results of the primer pair labeled C5-23 in the parental and F2 populations according to the present invention.
[0164] Figure 5 Violin diagram of the changes in the leaf stay-green trait of the molecular marker C5-23 haplotype designed for the present invention, wherein the horizontal axis represents the three genotypes "A", "B" and "H", and the vertical axis represents the stay-green situation. The larger the value, the more the trait tends to be premature aging type; the upper and lower limits of the box in the figure represent the upper quartile and the lower quartile, and the middle horizontal line represents the median; asterisks mark significant differences based on the Student t-test (p<0.05), and the number of asterisks is positively correlated with the significance level of the difference (the more the number, the higher the significance). Specific implementation method:
[0165] The present invention will be further described below through specific embodiments in conjunction with the accompanying drawings.
[0166] Example 1: Genetic mapping of gene loci controlling leaf stay-green
[0167] In order to locate the gene that controls the greening of peanut leaves, this example uses the early-aging type peanut variety Yaqian Dalidun as the female parent and the green-staying type peanut variety M74 as the male parent (both parents were provided by the Peanut Center of Qingdao Agricultural University) for hybridization, plants the hybrid F1, and self-pollinates to obtain the F2 segregating population.
[0168] Phenotypic analysis of the F2 segregating population revealed that 30 individuals with a significant stay-green trait and 30 individuals with a significant early-aging trait were selected from the F2 population. DNA from the 30 individuals with the stay-green trait was mixed in equal amounts to form a stay-green pool (G-Pool), and DNA from the 30 individuals with the early-aging trait was mixed in equal amounts to form a early-aging pool (Y-Pool). DNA from the parental lines Yaqian Dalidun and M74 was also extracted. Whole-genome resequencing of the extreme stay-green and early-aging pools, along with the parental lines Yaqian Dalidun and M74, was performed at 30× depth by Guangzhou Kidio Biotechnology Co., Ltd. The resequencing results were analyzed using a modified extreme trait pool sequencing method (Multiple BSA-seq), which revealed that the major gene controlling peanut leaf stay-green is located on chromosome 16. Through the overlapping interval and threshold analysis of the ΔSNP-index algorithm, G-statistic algorithm and ED algorithm, it was found that the candidate interval was located in the 98.8Mb interval of 1,628,221bp-100,444,735bp on chromosome 16 ( Figure 2 ).
[0169] In this example, a plant DNA extraction kit was used to extract DNA, and the specific method was as follows:
[0170] (1) A 2 mL centrifuge tube containing peanut leaves was rapidly cooled with liquid nitrogen, and then steel balls were placed in the tube and ground using a grinder.
[0171] (2) Add 500 μL of Buffer LS-4, then add 1 μL of RNase A, shake to mix, and heat the centrifuge tube in a 56°C water bath for 30 min.
[0172] (3) Add 63 μL of Buffer PA and mix thoroughly. Place on ice for 5 minutes and centrifuge at 12,000 rpm for 5 minutes. Take an equal volume of the supernatant and add Buffer BS-2 and mix thoroughly.
[0173] (4) Transfer the above solution to a Plant DNA Mini Column, let it stand at room temperature for 1 minute, then centrifuge at 12,000 rpm for 1 minute and discard the waste liquid;
[0174] (5) Add 500 μL of Buffer WA to the Mini column, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid;
[0175] (6) Add 750 μL of Buffer WB twice to the Mini column, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid;
[0176] (7) Place the mini column in a new 2 mL collection tube and centrifuge at 12,000 rpm for 2 min.
[0177] (8) Place the Mini column in a new 1.5 mL centrifuge tube, add 100 μL of Elution Buffer to the center of the membrane, let it stand at room temperature for 2 minutes, and centrifuge at 12,000 rpm for 2 minutes to elute the DNA.
[0178] Based on the results of the initial positioning by Multiple BSA-seq, markers were developed within the candidate interval, and genotypes were detected for all strains in the segregating population. A local genetic linkage map of the candidate interval was constructed using the developed markers. Information on the developed marker primer pairs is shown in Table 1.
[0179] Table 1 Primers used for markers of chromosome 16
[0180]
[0181]
[0182] Combined with the phenotypic statistical results of leaf greening in each strain, the key gene controlling peanut leaf greening was precisely located and locked in the 476.3kb interval of chromosome 16 from 7,402,289 to 7,878,548 through linkage analysis and comparative genomics analysis. Figure 3 ), and marker C5-23 was found to be tightly linked to leaf greenness.
[0183] The specific method for developing markers within the candidate interval involved in this embodiment is as follows:
[0184] (1) Logo design
[0185] Based on the resequencing results, Indel markers were designed where large deletions or insertions occurred in the candidate intervals. Upstream and downstream primers were designed using Primer Premier 6 for the selected SNP positions. The primer length was set to 20-28 bp and the GC% content was set to 40-60%. These markers were then screened according to physical distance.
[0186] (2) DNA extraction: Use a plant DNA extraction kit to extract the DNA to be tested. The specific method is as follows:
[0187] 1) Quickly cool the peanut leaves in a 2 mL centrifuge tube with liquid nitrogen, then fill it with steel balls and grind using a grinder.
[0188] 2) Add 500 μL of Buffer LS-4, then 1 μL of RNase A. Vortex to mix thoroughly, and heat the tube in a 56°C water bath for 30 min.
[0189] 3) Add 63 μL of Buffer PA and mix thoroughly. Incubate on ice for 5 minutes, then centrifuge at 12,000 rpm for 5 minutes. Add an equal volume of Buffer BS-2 to the supernatant and mix thoroughly.
[0190] 4) Transfer the above solution to a Plant DNA Mini Column, let it stand at room temperature for 1 minute, then centrifuge at 12,000 rpm for 1 minute and discard the waste liquid;
[0191] 5) Add 500 μL of Buffer WA to the Mini column, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid.
[0192] 6) Add two 750 μL volumes of Buffer WB to the Mini column, centrifuge at 12,000 rpm for 1 min, and discard the waste solution.
[0193] 7) Place the Mini Column in a new 2 mL Collection Tube and centrifuge at 12,000 rpm for 2 minutes.
[0194] 8) Place the mini column in a new 1.5 mL centrifuge tube, add 100 μL of Elution Buffer to the center of the membrane, let it stand at room temperature for 2 minutes, and centrifuge at 12,000 rpm for 2 minutes to elute the DNA.
[0195] (3) PCR amplification
[0196] The genomic DNA of the above-mentioned Yaqian Dalidun, M74 and its F2 population was used as a template, and the above templates were PCR amplified using the primer pairs in Table 1 on a PCR instrument. The PCR reaction system was 10 μL: 100-200 ng / μL
[0197] 1 μL DNA template, 0.5 μL of each 10 μM primer pair, 5 μL of 2× Taq Accurate Buffer, and 3 μL of RNase-free water were used. The PCR reaction procedure was as follows: initial denaturation at 94°C for 30 s; denaturation at 98°C for 10 s; annealing (annealing temperature was adjusted according to different primer pairs) for 30 s; extension at 72°C for 1 min, for 35 cycles; and a final extension at 72°C for 2 min.
[0198] (4) Analysis of electrophoresis results
[0199] 1.5 μL of the amplified product was electrophoresed on an 8% non-denaturing polyacrylamide gel at 150 V and 250 mA for 1 hour and 40 minutes. The polyacrylamide gel was then fixed for 10 minutes, permeabilized for 10 minutes, rinsed for 30 seconds, and developed for 5 minutes to allow for silver staining. The polyacrylamide gel was prepared using the following: 28 ml of ddH2O; 10x TBE Buffer.
[0200] 4ml; liquid Acrylamide 40% (19:1) 8ml; AP Buffer 400μl; TEMED
[0201] Finally, select the markers that show significant differences between the parents.
[0202] Example 2: Development and application of assisted selection markers for leaf stay-green related gene loci
[0203] 1. Materials
[0204] The tooth-front large grain mound, M74 and its F2 population in Example 1 were used as test materials.
[0205] 2. DNA extraction: Use a plant DNA extraction kit to extract the DNA to be tested. The specific method is as follows:
[0206] (1) A 2 mL centrifuge tube containing peanut leaves was rapidly cooled with liquid nitrogen, and then steel balls were placed in the tube and ground using a grinder.
[0207] (2) Add 500 μL of Buffer LS-4, then add 1 μL of RNase A, shake well, and heat the centrifuge tube in a 56°C water bath for 30 min.
[0208] (3) Add 63 μL of Buffer PA and mix thoroughly. Place on ice for 5 minutes and centrifuge at 12,000 rpm for 5 minutes. Take an equal volume of the supernatant and add Buffer BS-2 and mix thoroughly.
[0209] (4) Transfer the above solution to a Plant DNA Mini Column, let it stand at room temperature for 1 minute, then centrifuge at 12,000 rpm for 1 minute and discard the waste liquid;
[0210] (5) Add 500 μL of Buffer WA to the Mini column, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid;
[0211] (6) Add 750 μL of Buffer WB twice to the Mini column, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid;
[0212] (7) Place the mini column in a new 2 mL collection tube and centrifuge at 12,000 rpm for 2 min.
[0213] (8) Place the Mini column in a new 1.5 mL centrifuge tube, add 100 μL of Elution Buffer to the center of the membrane, let it stand at room temperature for 2 minutes, and centrifuge at 12,000 rpm for 2 minutes to elute the DNA.
[0214] 3. PCR Amplification
[0215] Using genomic DNA from the Yaqian Dalidun, M74, and their F2 populations described in Example 1 as templates, PCR amplification was performed on a PCR instrument using the primer pair labeled C5-23. 1.5 μL of the amplified product was electrophoresed on an 8% non-denaturing polyacrylamide gel at 150 V and 250 mA for 1 hour and 40 minutes. Finally, the polyacrylamide gel was fixed for 10 minutes, permeabilized for 10 minutes, rinsed for 30 seconds, and developed for 5 minutes, followed by silver staining. The polyacrylamide gel was prepared using the following ingredients: 28 ml of ddH2O; 4 ml of 10x TBE Buffer; 8 ml of 40% (19:1) liquid Acrylamide; 400 μl of AP Buffer; and 40 μl of TEMED.
[0216] The PCR reaction system was 10 μL: 1 μL of 100-200 ng / uL DNA template, 0.5 μL of each 10 μM primer pair, 5 μL of 2× Taq Accurate Buffer, and 3 μL of RNase-free water. The PCR reaction procedure was pre-denaturation at 94°C for 30 s; denaturation at 98°C for 10 s; annealing at 55°C for 30 s; extension at 72°C for 1 min, 35 cycles, and a final extension at 72°C for 2 min.
[0217] The genotype of the molecular marker of the offspring individual is determined based on the electrophoresis detection results. The genotype of the molecular marker of the offspring individual is determined by comparing the size of the amplified product of the molecular marker primer pair in the hybrid offspring individual with the size of the amplified product of the molecular marker primer pair in the parent. Then, the genotype of the leaf green-related gene in the marker linkage region is determined, and the offspring individual is selected based on the genotype of the amplified product.
[0218] 4. Analysis of Electrophoresis Results
[0219] The electrophoresis results of the primer pair labeled C5-23 in the parental and F2 populations are shown in Figure 4 .from Figure 4 It can be seen that the primer pair marked C5-23 amplifies a 119bp band in the early-aging parent Yaqian Dalidun, and a 135bp band in the stay-green type peanut parent M74; if the amplified product of the offspring individual is a 119bp band, then the genotype of the leaf stay-green trait-related gene locus of the individual is the early-aging parent Yaqian Dalidun (denoted as genotype A), and the corresponding phenotype is early-aging type; if the amplified product of the offspring individual is a 135bp band, then the genotype of the leaf stay-green trait-related gene locus of the individual is the stay-green parent M74 (denoted as genotype B), and the corresponding phenotype is stay-green type; if the amplified product of the offspring individual is two bands of 119bp and 135bp, then the genotype of the leaf stay-green trait-related gene locus of the individual is a heterozygous type (denoted as genotype H). Since stay-green is dominant to early aging, the phenotype of the individual is stay-green type.
[0220] 5. Leaf Trait Analysis of Molecular Marker C5-23 Haplotype
[0221] Based on the genotype of molecular marker C5-23 in the population, the effect of genotype on leaf stay-green traits was studied. All individuals in the 2023 F2 population and the 2024 F2 population were grouped according to genotype, and the leaf stay-green phenotype of each group was investigated. The results are as follows: Figure 5 shown.
[0222] from Figure 5 It can be seen that the values of the two genotypes A and B are significant, and the individuals carrying only genotype A have lower green staying ability than the individuals carrying only genotype B; there is a significant difference between genotype H and genotype A, but no significant difference with genotype B. This finding further verifies the close linkage relationship between the C5-23 marker and the peanut leaf green trait, and is highly credible in practical applications.
Claims
1. A primer pair for detecting a molecular marker C5-23 tightly linked to the stay-green leaf trait, characterized in that: The primer pair is C5-23-F / R, and the sequences are shown in SEQ ID NO.3 and SEQ ID NO.4; the molecular marker C5-23 is located in the 476.3kb interval from 7,402,289 to 7,878,548 on peanut chromosome 16, and the corresponding sequence of the 2kb range before and after the marker of the green-holding peanut variety M74 is shown in SEQ ID NO.1, and the corresponding sequence of the 2kb range before and after the marker of the early-aging peanut variety Yaqian Dalidun is shown in SEQ ID NO.
2.
2. A method for identifying the stay-green trait of peanut leaves, characterized in that: The following steps are involved: (1) Extracting DNA from peanut leaves to be tested; (2) performing PCR amplification on the extracted DNA using the primer pair C5-23-F / R described in claim 1; (3) The amplified product obtained in step (2) is monitored by non-denaturing polyacrylamide gel electrophoresis. If a characteristic band of 119 bp appears, the phenotype of the peanut material to be tested is determined to be premature aging type; if a characteristic band of 135 bp appears, the phenotype of the peanut material to be tested is determined to be stay-green type; if both characteristic bands of 119 bp and 135 bp appear, the phenotype of the peanut to be tested is determined to be stay-green type.
3. The method for identifying the stay-green trait of peanut leaves according to claim 2, characterized in that: In step (2), the total volume of the PCR amplification was 10 μL: 1 μL of DNA template (100-200 ng / μL), 0.5 μL of each 10 μM primer pair, 5 μL of 2×Taq Accurate Buffer, and 3 μL of RNase-free water.
4. The method for identifying the stay-green trait of peanut leaves according to claim 2, characterized in that: In step (2), the PCR amplification reaction conditions are: pre-denaturation at 94°C for 30s; 98°C for 10s, 55°C for 30s, and 72°C for 1min, 35 cycles; and extension at 72°C for 2min.
5. The method for identifying the stay-green trait of peanut leaves according to claim 2, characterized in that: In step (3), 8% non-denaturing polyacrylamide gel electrophoresis was performed.
6. A kit for detecting the stay-green trait of leaves, comprising the primer pair according to claim 1.
7. Use of the primer pair according to claim 1 or the kit according to claim 6 in peanut molecular marker-assisted breeding.
8. Use of the primer pair or kit according to claim 7 in peanut molecular marker-assisted breeding, characterized in that: Using the genomic DNA of the stay-green parent, the early-senescent parent and their hybrid offspring as templates, the primer pair C5-23-F / R was used to perform PCR amplification and gel detection on the above templates. The genotype of the individual marker was determined by comparing the size of the amplified product of the hybrid offspring individual with the size of the amplified product of the parents, and then the genotype of the gene related to the leaf stay-green trait and the leaf stay-green trait of the individual were determined; if the size of the marker amplification of the offspring individual was the same as that of the stay-green parent, the genotype of the gene related to the leaf stay-green trait of the individual was the stay-green parent type, and its phenotype was stay-green; if the size of the marker amplification of the offspring individual was the same as that of the early-senescent parent, the genotype of the gene related to the leaf stay-green trait of the individual was the early-senescent parent type, and its phenotype was early-senescence; given that stay-green is dominant to early aging, when the marker amplification product of the offspring individual has both parental bands, the genotype of the gene related to the leaf stay-green trait of the individual is heterozygous, and the phenotype of the individual is stay-green.
Citation Information
Cited By
InDel molecular marker SL-12 for identifying sizes of peanut leaves, primer pair and application of InDel molecular marker SL-12
CN121183030A