Application of Odf3 gene or protein coded by Odf3 gene in preparation of medicine for regulating fertility of male animals

Abstract

The invention discloses an application of an Odf3 gene or a protein coded by the Odf3 gene in preparation of a medicine for regulating fertility of male animals, and belongs to the technical field of biological medicines. The AAV2 / 9 shows huge advantages in a testis overexpression mode, and keeps safety and effectiveness under the condition of efficient delivery. The Odf3 delivered by the testis seminiferous tubule through the AAV2 / 9 can be successfully expressed in spermatogenic cells, the sperm motility can be effectively improved, the fertility of the Odf3- / -mouse is saved, and offspring can be generated under the condition of natural mating. The F1-generation heterozygote mouse produced in a gene overexpression mode has the same fertility as that of a common heterozygote mouse.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to the use of an Odf3 gene or a protein encoded by the gene in preparing a drug for regulating the fertility of male animals. Background Art

[0002] Fertility regulation is a core research area in reproductive medicine. In recent years, the incidence of infertility has continued to rise globally. According to the World Health Organization, approximately 15% of couples of childbearing age face fertility problems, with male factors accounting for 40%-50% of these. While traditional treatments, such as hormone replacement therapy and assisted reproductive technology, have achieved some success, they still suffer from long treatment cycles, significant side effects, and limited efficacy for specific etiologies. In particular, there is a lack of targeted interventions for hereditary spermatogenic dysfunction. Summary of the Invention

[0003] The purpose of the present invention is to provide the use of the Odf3 gene or the protein encoded by it in the preparation of a drug for regulating the fertility of male animals, so as to solve the problems existing in the above-mentioned prior art.

[0004] To achieve the above object, the present invention provides the following solutions:

[0005] One of the technical solutions of the present invention is the use of the Odf3 gene or the protein encoded by it in the preparation of a drug for regulating the fertility of male animals.

[0006] The second technical solution of the present invention is a drug for regulating the fertility of male animals, including an agent for regulating the expression of the Odf3 gene.

[0007] Based on the above technical solution, the present invention has the following technical effects:

[0008] AAV2 / 9 shows great advantages in testicular overexpression, maintaining safety and effectiveness under high-efficiency delivery conditions. Odf3 can be successfully expressed in spermatogenic cells by AAV2 / 9 delivery to the seminiferous tubules of the testis, effectively improving sperm motility and rescuing Odf3. - / - Mouse fertility is the ability to produce offspring under natural mating conditions. F1 heterozygous mice produced through gene overexpression have the same fertility as ordinary heterozygous mice. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0010] Figure 1 The first-generation sequencing peak diagrams are for wild-type mice and homozygous knockout mice.

[0011] Figure 2 Schematic diagram of injection into the seminiferous tubules of the testis.

[0012] Figure 3 Figure 1 shows pAAV virus packaging and validation. A shows GL3010 as the viral vector template, H35377 as the viral vector inserted with Odf3-3×Flag, B shows plasmid validation in 293T cells by Western blotting, and C shows the CMV-GdGreen control virus successfully expressed in the testis via both interstitial injection and seminiferous tubules.

[0013] Figure 4 The pAAV viral vector can infect testicular interstitial and spermatogenic cells.

[0014] Figure 5 Effect of pAAV virus injection dose on sperm motility recovery.

[0015] Figure 6 The effect of different pAAV virus doses on testicular development. A is 8.32×10 9 Effect of vg / testis (Lowdose) injection on testicular development, B is 2.08×10 10 Effect of vg / testis (Middledose) injection on testicular development, C is 4.16×10 10 Effects of vg / testis (High dose) injection on testicular development.

[0016] Figure 7 Comparison of pAAV infection efficiency between testicular interstitial and seminiferous tubule injection conditions. A shows the infection efficiency comparison between testicular seminiferous tubule injection (ST injection) and testicular interstitial injection (Interstitial injection). B shows the fluorescence signal observed in the cauda epididymis after testicular seminiferous tubule injection.

[0017] Figure 8 Overexpression mediated by pAAV-Odf3 improves sperm motility. Figures A and B show sperm concentration before and after pAAV-Odf3 injection, and C show sperm forward motility before and after pAAV-Odf3 injection.

[0018] Figure 9 The results of in vivo fertility test after overexpression of pAAV-Odf3 virus.

[0019] Figure 10 Odf3 was restored by overexpression of pAAV-Odf3 virus - / - Male mouse fertility. A is 2.08×10 10 One cub was born in the vg / testis treatment group, with a B of 4.16×10 10 Three pups were born in the vg / testis treatment group. C shows that mice born in the gene overexpression mode were heterozygous as shown by Sanger sequencing. D shows the comparison of the litter size between the gene overexpression treatment group and the wild-type and untreated groups.

[0020] Figure 11 The offspring overexpressing the pAAV-Odf3 virus gene have normal fertility.

[0021] Figure 12 The sperm parameters of the offspring of pAAV-Odf3 viral gene overexpression are normal. A is the testis weight ratio of normal heterozygous mice and AAV-treated offspring, B is the epididymal weight ratio of normal heterozygous mice and AAV-treated offspring, C is the sperm concentration of normal heterozygous mice and AAV-treated offspring, D is the sperm motility of normal heterozygous mice and AAV-treated offspring, E is the forward motility of sperm of normal heterozygous mice and AAV-treated offspring, F is the average curvilinear velocity (VCL) of sperm of normal heterozygous mice and AAV-treated offspring, G is the average linear velocity (VSL) of sperm of normal heterozygous mice and AAV-treated offspring, H is the average path velocity (VAP) of sperm of normal heterozygous mice and AAV-treated offspring, and I is the average lateral swing amplitude (ALH) of sperm of normal heterozygous mice and AAV-treated offspring. DETAILED DESCRIPTION

[0022] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0023] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0024] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0025] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the present invention. The present description and examples are intended to be illustrative only.

[0026] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0027] Unless otherwise specified, the technical solutions described in the present invention are all conventional solutions in the field, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0028] The embodiments of the present invention provide the use of the Odf3 gene or the protein encoded by it in the preparation of a drug for regulating the fertility of male animals.

[0029] In some specific embodiments, the animal comprises a mouse.

[0030] In some specific embodiments, silencing or knocking out the Odf3 gene or reducing the level of its encoded protein reduces the fertility of male animals; overexpressing the Odf3 gene or increasing the level of its encoded protein improves the fertility of male animals.

[0031] In some specific embodiments, AAV2 / 9 vector is used to regulate the expression of Odf3 gene.

[0032] An embodiment of the present invention further provides a drug for regulating male animal fertility, wherein the drug includes an agent for regulating Odf3 gene expression.

[0033] In some specific embodiments, the drug comprises AAV2 / 9-Odf3-GdGreen or pAAV-CMV-Odf3-3×Flag-EF1-GdGreen-WPRE.

[0034] Example 1

[0035] Experimental Materials:

[0036] 1. Viruses: pAAV-CMV-MCS-EF1-GdGreen-WPRE and pAAV-CMV-Odf3-3×Flag-EF1-GdGreen-WPRE viruses were ordered from Heyuan Biotechnology.

[0037] Table 1

[0038]

[0039] 2. Odf3 - / - Mouse: A stop codon was introduced by microinjection of a single-base editor (cytosine base editor, purchased from Addgene, cat. no. 113423) and sgRNA (TTCCGAGTGGACAGCACTCC) into the fertilized egg, i.e., Odf3 was constructed using the iSTOP method. - / - Mice. Female Odf3 knockout mice were mated with wild-type C57BL / 6 mice to obtain Odf3 heterozygous knockout mice, and heterozygous knockout mice were mated with each other to obtain Odf3 knockout male mice for testing and analysis.

[0040] 3. Preparation of AAV2 / 9 virus injection solution

[0041] The AAV2 / 9 injection solution for testis injection consists primarily of ddH2O, FastGreen, 10× PBS, and AAV9 virus; the preparation method is shown in Table 2. A 20 μL injection is administered unilaterally to each testis. The testicular injection procedure is similar to that for testicular electroporation. Following injection, the mouse's abdomen can be sutured and the mouse allowed to recover on a 37°C heating pad.

[0042] Table 2

[0043]

[0044] 4. Testicular microinjection

[0045] ① Under a stereomicroscope, locate the testicular efferent ductules as the injection port. The efferent ductules are the thin vascular connection between the testicle and epididymis. They are located near the protruding testicular artery, at an angle of almost 45° to the artery. The efferent ductules are usually buried in adipose tissue. Use fine forceps to remove the adipose tissue covering the efferent ductules until the efferent ductules are clearly exposed and adjusted to the desired angle.

[0046] ② Connect the microinjection capillary containing AAV virus to the micromanipulator (Eppendorf FemtoJet 4i injector);

[0047] ③ Place the microinjection needle parallel to the efferent ductules, with the needle tip pointing toward the rete testis;

[0048] ④ Carefully direct the needle toward the testis and stop when it passes through the rete testis below the tunica albuginea. If it passes beyond the rete testis, the viral solution will leak into the interstitial space, which often leads to injection failure in spermatogenic mice.

[0049] ⑤ For the injection of the virus solution, use an Eppendorf FemtoJet 4i syringe with the following settings, continuous discharge mode pw = 100-200, and fine-tune according to the discharge situation.

[0050] ⑥ Monitor the entire injection process by observing the filling status of the testicles. Note that the plasmid solution can only fill 2 / 3 of the testicle volume. If the injection volume is too large, it may damage the testicular tissue. Figure 2 shown.

[0051] Experimental results

[0052] 1. The virus can target spermatogenic cells after being injected into the seminiferous tubules of the testis

[0053] When pAAV-CMV-Odf3-3×Flag-EF1-GdGreen-WPRE was injected into the seminiferous tubules of mouse testes in the same way, green fluorescence was found to be localized in the interstitial and spermatogenic cells of the testes. The structure of the seminiferous tubules was normal, the PNA signal was intact, and spermatogenesis could continue normally. Figure 3-4 shown.

[0054] 2. Effects of different injection concentrations of pAAV-Odf3-GdGreen on sperm motility and testicular development in mice

[0055] The established method of testicular seminiferous tubule injection was used to determine whether AAV2 / 9-based gene overexpression could effectively restore ODF3 expression and sperm motility. AAV2 / 9-Odf3-GdGreen viral vector was used to inject 8.32×10 9 vg / testis, 2.08×10 10 vg / testis, 4.16×10 10 vg / testis, 6.24×10 10 The virus of vg / testis was injected into the inner side of the seminiferous tubules of mice, and samples were collected at the same number of days after infection. The forward motility of mouse sperm was detected using the CASA method.

[0056] The results showed that 2.08×10 10 vg / testis, 4.16×10 10 vg / testis, 6.24×10 10The injection dose of vg / testis was significantly different from that of the Odf3 homozygous knockout group, but 2.08×10 10 vg / testis, 4.16×10 10 vg / testis, 6.24×10 10 There was no significant difference among the three groups of vg / testis. Figure 5 As shown. The subsequent focus is on 2.08×10 10 vg / testis, 4.16×10 10 vg / testis for injection exploration.

[0057] 3. Virus injection does not affect the development of mouse testicles

[0058] For 8.32×10 9 vg / testis(Low dose),2.08×10 10 vg / testis(Middledose), 4.16×10 10 vg / testis (High dose) was used to study the effects of three groups on testicular development. The corresponding concentration of virus was injected into one side of the testicle of the mice, while the other side was not injected. The testicular weight was weighed and compared after the same time. The results showed that the three concentration gradient injections had a certain degree of effect on the development of testicular size, but there was no significant difference compared with the non-injected group. The statistical results are as follows Figure 6 shown.

[0059] 4. pAAV-Odf3-GdGreen can target spermatogenic cells through different testicular injection methods

[0060] By injecting pAAV-GdGreen virus into the inner and outer sides of the seminiferous tubules of the mouse testis, two weeks after the injection, it can be found through stereofluorescence microscopy that after injection into the inner side of the seminiferous tubules, the fluorescence spreads throughout the seminiferous tubules, while after injection into the outer side of the seminiferous tubules, the fluorescence diffuses on the outer side of the seminiferous tubules.

[0061] Frozen sections of the testes reveal that injections into the medial and lateral seminiferous tubules can infect spermatogenic cells, including spermatogonia, primary spermatocytes, secondary spermatocytes, and round spermatids, in addition to targeting interstitial cells, basement membranes, and Sertoli cells. However, given the same viral injection volume, the infection efficiency of interstitial injections is lower than that of injections into the medial seminiferous tubules.

[0062] As the infection progresses, about 40 days after virus injection, fluorescent signals can be found migrating from the testis to the epididymal caput and cauda epididymis. After freezing sections of the epididymal caput and cauda epididymis and staining the cell nuclei, green fluorescent signals can be observed as dots. This may be because sperm carrying GdGreen migrates from the testis to the epididymal caput and then to the epididymal cauda epididymis. Figure 7 shown.

[0063] 5. pAAV-Odf3-GdGreen delivery improves Odf3 - / - Mouse sperm motility

[0064] Using CASA to analyze Odf3 - / - The results of sperm motility test showed that the motility of mouse sperm after homozygous knockout of the Odf3 gene decreased to about 40%, and the forward motility decreased to less than 20%. By comparing the difference in sperm motility before and after treatment, CASA test was performed on the sperm of mice after pAAV-Odf3-GdGreen gene overexpression treatment. The results showed that the motility of mouse sperm after pAVV-Odf3-GdGreen treatment was significantly improved, with sperm motility increased to about 60% and forward motility increased to about 35%. Although the sperm motility and forward motility of treated mice are lower than those of wild-type mice, they are significantly higher than the sperm motility level of mice with asthenozoospermia caused by Odf3 deficiency, such as Figure 8 shown.

[0065] 6. pAAV-Odf3-GdGreen-mediated gene overexpression restored Odf3 - / - Mouse fertility

[0066] Through screening of AAV2 / 9-Odf3-GdGreen virus concentration, the most suitable virus injection concentration was found to be 2.08×10 10 , 4.16×10 10 vg / testis as injection dose.

[0067] Four-week-old male mice with homozygous knockout of Odf3 were injected with the virus. About 35 days after the injection, they were caged with wild-type females that were superovulated with hormones. The next day, the female mice were dissected and fertilized eggs were cultured in vitro. It was found that sperm from a male mouse injected into the interstitial testis could also fertilize the egg and develop it to the blastocyst stage. The blastocyst was identified by Sanger sequencing and found to be heterozygous. At the same time, a male mouse was injected into the seminiferous tubules on one side and the interstitial testis on the other side. A blastocyst was also found in this mouse, and it was identified as a heterozygous blastocyst. Figure 9-10 shown.

[0068] Subsequently, the gene-treated male mice were co-housed with C57 female mice to check for thrombosis and to see if any offspring would be produced. 10 and 4.16×10 10 The injection dose of vg / testis gene therapy resulted in 1 and 3 pups born naturally, respectively. In subsequent experiments, 4.16×10 10 Vg / testis is a more suitable concentration for gene therapy injection, and it was found that after 4.16×10 10 The vg / testis gene therapy group will give birth to cubs one after another.

[0069] Sanger sequencing of the offspring of gene-treated mice (F0) revealed that all offspring mice (F1) were heterozygous. One-way ANOVA revealed that Odf3 - / - -AAV treatment group and Odf3 - / - There are significant differences in mouse fertility, such as Figure 9-10 shown.

[0070] 7. The offspring of gene-overexpressing mice have normal fertility

[0071] The offspring (F1) of gene overexpression therapy were heterozygous. The adult F1 male mice bred with wild-type female mice and the adult F1 female mice bred with wild-type male mice could reproduce normal offspring (F2). The number of offspring in each litter was about 7-8 pups, which was similar to the number of offspring in Odf3. + / - There was no difference in the number of offspring of male mice. This also indicates that the offspring of heterozygous gene-treated mice have normal reproductive function, such as Figure 11 shown.

[0072] CASA was performed on the sperm motility of F1 mice treated with AAV. The results showed that there was no significant difference in the various sperm motility indicators between F1 heterozygous mice and ordinary heterozygous mice. At the same time, the expression of ODF3 protein in 3 F1 heterozygous mice (right) and 3 ordinary heterozygous mice (left) was detected. The results showed that there was no significant difference in protein expression between the two heterozygous mice. In addition, to verify whether the virus was integrated into the genome of the offspring, the present invention took three Odf3 mice treated with AAV. - / - Western blot analysis of the Flag tag in the brain, thymus, testis, and sperm of the offspring of mice revealed no Flag expression in the representative tissues of the treated offspring, except for a band in the testis of mice injected with AAV-Odf3 virus. Figure 12 shown.

[0073] In summary, AAV2 / 9 shows great advantages in testicular overexpression, and maintains safety and effectiveness under high-efficiency delivery conditions. Odf3 can be successfully expressed in spermatogenic cells by AAV2 / 9 delivery in the seminiferous tubules of the testis, effectively improving sperm motility and rescuing Odf3. - / - Mouse fertility is the ability to produce offspring under natural mating conditions. F1 heterozygous mice produced through gene overexpression have the same fertility as ordinary heterozygous mice.

[0074] Since AAV vectors have shown great advantages in the field of gene therapy due to their unique characteristics, the present invention uses AAV delivery to deliver AAV-encapsulated target gene vectors to the seminiferous tubules of the testis through the testicular efferent ductules. Since AAV2 / 9 shows very high delivery efficiency in the testis, by directly targeting spermatogenic cells, ODF3 protein can be successfully delivered to Odf3 - / - The expression of ODF3 in male mouse spermatogenic cells was detected by CASA. The results showed that overexpression of ODF3 protein effectively increased the expression of Odf3 in sperm of mice treated with AAV2 / 9 gene overexpression. - / - Mouse sperm motility. The present invention tested several different virus doses and found that different dose conditions did not have a significant effect on testicular development. After treatment, Odf3 - / - The asthenozoospermia mice induced by this treatment can be detected with heterozygous blastocysts in the in vivo fertility test, which indicates that after treatment, Odf3 - / - Mouse sperm can partially fertilize, although the fertilization rate is low, only around 2-5%. Two different injection methods were tested during treatment: one into the interstitial testis and the other into the seminiferous tubules. In the interstitial testis injection group, only one heterozygous blastocyst was found during in vivo fertility testing, while the seminiferous tubule injection group also produced one heterozygous blastocyst. Furthermore, the seminiferous tubule injection group was able to produce offspring naturally after mating with wild-type female mice approximately 35 days after treatment. This demonstrates that AAV2 / 9 gene overexpression can successfully overexpress ODF3 protein in spermatogenic cells, and that the exogenously overexpressed ODF3 protein can be incorporated into sperm and function during this process.

[0075] The AAV2 / 9 delivery method has shown great advantages in this regard, and has a higher delivery efficiency than electroporation without damaging the testis. - / - The male mice regained their fertility under natural mating conditions.

[0076] Obviously, the above embodiments of the present invention are merely examples for the purpose of clearly illustrating the present invention and are not intended to limit the implementation methods of the present invention. A person skilled in the art will be able to make other variations or modifications based on the above description. It is not necessary and impossible to enumerate all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the claims of the present invention.

Claims

1. Use of the Odf3 gene or the protein it encodes in the preparation of a drug for regulating male animal fertility.

2. The use according to claim 1, characterized in that The animals include mice.

3. The use according to claim 1, characterized in that Silencing or knocking out the Odf3 gene or reducing the level of the protein it encodes reduces the fertility of male animals; overexpressing the Odf3 gene or increasing the level of the protein it encodes improves the fertility of male animals.

4. The use according to claim 3, characterized in that AAV2 / 9 vector was used to regulate the expression of Odf3 gene.

5. A drug for regulating male animal fertility, characterized in that: The medicament includes an agent that regulates the expression of the Odf3 gene.

6. The drug according to claim 5, characterized in that The drugs include AAV2 / 9-Odf3-GdGreen or pAAV-CMV-Odf3-3×Flag-EF1-GdGreen-WPRE.

Images