DNA aptamer for improving crisper / cas9-mediated exogenous gene integration efficiency based on ctip protein and application thereof

By designing DNA aptamers based on CtIP protein and optimizing donor vectors for the CRISPR/Cas9 system, the HMEJ mechanism was used to achieve targeted enrichment of repair templates, solving the problem of low integration efficiency of exogenous genes mediated by CRISPR/Cas9 and significantly improving the integration efficiency of exogenous genes in HEK-293T and HeLa cells.

CN120555441BActive Publication Date: 2026-04-17NORTHWEST A & F UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510710603.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-29
Publication Date
2026-04-17
Estimated Expiration
2045-05-29

AI Technical Summary

Technical Problem

CRISPR/Cas9-mediated integration of exogenous genes has low efficiency. Existing technologies suffer from low vector transfection efficiency, poor protein stability, complex operation, and limited applicability, making it difficult to achieve efficient and precise gene integration.

Method used

We designed DNA aptamers based on the CtIP protein, optimized the donor vector of the CRISPR/Cas9 system through the HMEJ mechanism, and used high-affinity DNA aptamers to insert at the end of the homologous arm of the donor vector to achieve targeted enrichment of repair templates and improve the integration efficiency of exogenous genes.

Benefits of technology

Significantly improved the integration efficiency of exogenous genes in HEK-293T and HeLa cells. Aptamers A6913 and A13-32 improved the integration efficiency by more than 3 times, achieving highly efficient site-specific gene integration.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120555441B_ABST
    Figure CN120555441B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biotechnology, specifically relating to a DNA aptamer based on CtIP protein to improve the integration efficiency of CRISPR / Cas9-mediated exogenous genes and its application. The nucleotide sequence of the DNA aptamer is at least one of SEQ ID NO.1 and SEQ ID NO.10. This invention, for the first time, targets CtIP protein, a key factor in DNA double-strand break repair, screening for two aptamers and utilizing them to optimize the donor vector of the CRISPR / Cas9 system, thereby improving the integration efficiency of exogenous genes in HEK-293T cells and HeLa cells. The screened CtIP protein-specific DNA aptamers exhibit nanomolar affinity and Kd values ​​ranging from 42.56 nM to 407.29 nM. By inserting the aptamer into the end of the homologous arm of the donor vector, targeted enrichment of the repair template is achieved using the HMEJ mechanism. Aptamers A6913 and / or A13-32 significantly enhance the integration efficiency of exogenous genes, increasing it by more than three times compared to the control group.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a DNA aptamer based on CtIP protein that improves the efficiency of CRISPR / Cas9-mediated integration of exogenous genes and its applications. Background Technology

[0002] CRISPR / Cas9 technology is widely used in gene editing due to its high efficiency and specificity, but low integration efficiency of exogenous genes remains a bottleneck restricting its application. Homologous recombination (HR) is the main pathway for precise gene integration, but its efficiency is limited by the enrichment capacity of the repair template. CtIP protein is a key factor in HR repair, but its direct application suffers from problems such as low vector transfection efficiency and poor protein stability.

[0003] In existing technologies, fusion of CtIP protein fragments or inhibition of non-homologous end joining (NHEJ) can partially improve HR efficiency, but these methods suffer from drawbacks such as complex operation, low vector transfection efficiency, and limited applicability. Therefore, there is an urgent need to provide a new strategy based on CtIP protein to improve the efficiency of CRISPR / Cas9-mediated exogenous gene integration. Summary of the Invention

[0004] To address the problem of low integration efficiency of exogenous genes mediated by CRISPR / Cas9, this invention provides a DNA aptamer based on CtIP protein to improve the integration efficiency of exogenous genes mediated by CRISPR / Cas9.

[0005] The technical solution adopted in this invention is:

[0006] This invention provides a DNA aptamer based on CtIP protein to improve the efficiency of CRISPR / Cas9-mediated integration of exogenous genes, wherein the nucleotide sequence of the DNA aptamer is at least one of SEQ ID NO.1 and SEQ ID NO.10.

[0007] A second aspect of the present invention provides a donor vector for a CRISPR / Cas9 gene editing system, the donor vector being constructed using pMD19-T as the starting vector, and the donor vector containing the aforementioned DNA aptamer.

[0008] A third aspect of the present invention provides a vector set for constructing a CRISPR / Cas9 gene editing system, the vector set comprising the donor vector and the cutting vector described above.

[0009] Preferably, the cleavage vector is obtained by digesting pSpCas9(BB)-2A-Puro with enzymes and then ligating it into sgRNA.

[0010] A fourth aspect of the present invention provides an application of the aforementioned DNA aptamer, the aforementioned donor vector, or the aforementioned vector set, wherein the application refers to improving the integration efficiency of CRISPR / Cas9-mediated exogenous genes.

[0011] Preferably, the integration efficiency of exogenous genes is improved by the following methods:

[0012] The donor vector and the cleavage vector were co-transfected into cells and cultured.

[0013] Preferably, the cells include either HEK-293T or HeLa cells.

[0014] Preferably, the mass ratio of the donor carrier to the cutting carrier is 1 to 3:1.

[0015] Preferably, the mass ratio of the donor carrier to the cutting carrier is 2:1.

[0016] A fifth aspect of the present invention provides a kit for detecting the efficiency of CRISPR / Cas9-mediated integration of exogenous genes, the kit comprising the DNA aptamer or the donor vector described above.

[0017] Compared with the prior art, the beneficial effects of the present invention are:

[0018] This invention provides a DNA aptamer based on CtIP protein to improve the integration efficiency of CRISPR / Cas9-mediated exogenous genes. The nucleotide sequence of the DNA aptamer is at least one of SEQ ID NO.1 and SEQ ID NO.10. This invention is the first to target CtIP protein, a key factor in DNA double-strand break repair, screening for two aptamers and using them to optimize the donor vector of the CRISPR / Cas9 system, thereby improving the integration efficiency of exogenous genes in HEK-293T cells and HeLa cells. The screened CtIP protein-specific DNA aptamers have nanomolar affinity and Kd values ​​of 42.56 nM to 407.29 nM. By inserting the aptamer into the end of the homologous arm of the donor vector, the repair template is targeted for enrichment using the HMEJ mechanism. Aptamers A6913 and / or A13-32 significantly improve the integration efficiency of exogenous genes, increasing it by more than three times compared to the control group. Attached Figure Description

[0019] Figure 1 This is a statistical chart of DNA recovery rate.

[0020] Figure 2 Five representative candidate sequences that may have affinity for CtIP were selected.

[0021] Figure 3Affinity and specificity analysis of aptamer candidate sequences for CtIP protein.

[0022] Figure 4 The fitting curves for the dissociation constants of CtIP to aptamer candidate sequences are: A: A6913; B: A6-17; C: A9-2; D: A13-32.

[0023] Figure 5 This is a donor vector map in the HMEJ strategy.

[0024] Figure 6 Enzyme digestion identification results for LA-SEPPA-19T.

[0025] Figure 7 The enzyme digestion identification results are for the donor vector Rosa26-Aptamer-HMEJ-Donor.

[0026] Figure 8 This is a schematic diagram of positive monoclonal cell screening based on the HMEJ strategy.

[0027] Figure 9 The results of junction PCR detection in HMEJ-mediated hybrid clonal cells are as follows: A: This demonstrates that the 5' insert of Rosa26-Aptamer-HMEJ-Donor successfully integrates into the upstream homologous arm of the Rosa26 genome; B: This demonstrates that the 3' insert of Rosa26-Aptamer-HMEJ-Donor successfully integrates into the downstream homologous arm of the Rosa26 genome.

[0028] Figure 10 The expression of EGFP protein in HEK-293T monoclonal cells under a fluorescence microscope.

[0029] Figure 11 The expression of EGFP protein in HEK-293T cells under a fluorescence microscope after 2, 4, and 6 days of culture.

[0030] Figure 12 The results are statistical analysis results of the proportion of green fluorescence area in HEK-293T cells under a fluorescence microscope using ImageJ software.

[0031] Figure 13 Flow cytometry analysis of the exogenous EGFP positivity rate in HEK-293T cells: A: Flow cytometry scatter plot; B: Statistical analysis of the percentage of positive cells based on flow cytometry results.

[0032] Figure 14 The images show the expression of EGFP protein in HeLa cells under a fluorescence microscope. A: Results 2 days after transfection; B: Results 4 days after transfection.

[0033] Figure 15 The results are statistical analysis results of the proportion of green fluorescence area in HeLa cells under a fluorescence microscope using ImageJ software.

[0034] Figure 16 Flow cytometry analysis of the exogenous EGFP positivity rate in HeLa cells: A: Flow cytometry scatter plot; B: Statistical analysis of the percentage of positive cells based on flow cytometry results. Detailed Implementation

[0035] The present invention will be further illustrated below with specific embodiments, but these embodiments do not limit the scope of the invention. Modifications or substitutions to the details and form of the technical solutions of the present invention may be made without departing from the spirit and scope of the invention, but all such modifications or substitutions fall within the protection scope of the present invention.

[0036] The inventive concept of this invention is as follows:

[0037] This invention provides a DNA aptamer based on the CtIP protein to improve the efficiency of CRISPR / Cas9-mediated integration of exogenous genes, as follows:

[0038] 1) DNA aptamer screening: Using DNA library immobilized magnetic beads SELEX technology, CtIP protein was used as the target, and high-affinity aptamers such as A6913 and A13-32 were obtained through 13 rounds of screening.

[0039] 2) Donor vector construction: A donor vector based on the HMEJ strategy was designed, and aptamer sequences were inserted at the ends of the left and right homologous arms to enrich the repair template at the DNA break site.

[0040] 3) Application of CRISPR / Cas9 system: The donor vector and the CRISPR / Cas9 cleavage vector are co-transfected into the target cells, such as HEK-293T or HeLa, and the gene integration efficiency is detected by fluorescence reporter system and flow cytometry.

[0041] To enable those skilled in the art to better understand and implement the technical solutions of this invention, the invention will be further described below with reference to specific embodiments. In the description of this invention, unless otherwise specified, all reagents used are commercially available, and all methods used are conventional techniques in the art.

[0042] Example 1

[0043] A DNA aptamer based on the CtIP protein to improve the efficiency of CRISPR / Cas9-mediated integration of exogenous genes is described below:

[0044] 1. Screening of DNA aptamers for CtIP protein.

[0045] 1.1 DNA library immobilized magnetic bead SELEX screening process.

[0046] 1.1.1 Establishment of random ssDNA libraries.

[0047] The random ssDNA library was established by reviewing relevant literature. The DNA sequences in the library each contain 80 bases, where N represents the 40 random bases in the middle and 20 bases at each end as the binding sites for primers during PCR amplification.

[0048] The initial randomized ssDNA library powder and primer powder were synthesized by Shanghai Bioengineering Co., Ltd. The purification method was HPLC. The ssDNA powder was diluted to a 100 μM solution and the primers were diluted to a 10 μM solution according to the instructions on the tube wall. The solutions were stored at -20℃.

[0049] 1.1.2 PCR amplification reaction.

[0050] In the screening of nucleic acid aptamers, PCR amplification is a key step in the preparation of secondary libraries. Therefore, PCR annealing temperature and cycle number are particularly important parameters in the experiment and need to be optimized first.

[0051] In the optimization experiment of annealing temperature, the target band was bright and single when the annealing temperature was 60.4℃, so 60.4℃ was selected as the optimal annealing temperature; in the optimization experiment of the number of cycles for initial library expansion, the amplification band of the initial library gradually became brighter as the number of cycles increased, so 32 was selected as the optimal number of cycles for initial library expansion.

[0052] 1.1.3. Fixed document library.

[0053] The primer-amplified library has a biotin tag at its 3' end, allowing it to be coupled to streptavidin magnetic beads via the high binding affinity of biotin and streptavidin. This enables the immobilization of random DNA libraries onto the streptavidin magnetic beads. The magnetic beads used for library immobilization are streptavidin magnetic beads from Anhui Angpu Tuomai Biotechnology Co., Ltd.

[0054] 1.1.4. Competitive screening.

[0055] After immobilizing the PCR product onto streptavidin magnetic beads using the method described in 1.1.3, a predetermined amount of target CtIP protein solution and 100 μL of binding buffer were added. The mixture was then incubated at room temperature for 1 hour by rotation. The sequence with high affinity for CtIP was displaced to form a single strand. After magnetic separation for 5 minutes, the supernatant was collected to obtain the CtIP-ssDNA complex. The DNA concentration of the complex solution was measured and recorded. This complex will be used as a template for the preparation of the secondary library in the next round of screening.

[0056] 1.1.5 Reverse screening.

[0057] In the SELEX process, reverse selection is usually introduced to improve the specificity of ssDNA in the library. After the DNA recovery rate of the positive selection gradually increases and tends to stabilize, a round of reverse selection is introduced.

[0058] 1.2 Monitoring of the nucleic acid aptamer screening process.

[0059] During nucleic acid aptamer screening, the total amount of DNA input in each round of screening, the total amount of DNA not immobilized on magnetic beads, and the total amount of DNA in the recovered supernatant were measured and recorded. The DNA recovery rate was calculated, and the trend of the DNA recovery rate could be used to determine whether nucleic acid aptamers were enriched. When the DNA recovery rate reached its peak or showed a downward trend, it indicated that the screening could be completed. See the DNA recovery rate chart below. Figure 1 .

[0060] Because a large amount of protein was used in the first round of screening, the DNA recovery rate decreased slightly in the second and third rounds after reducing the amount of protein. As screening progressed, the DNA recovery rate gradually increased from the fourth round and stabilized in the ninth round. To improve the specificity of the ssDNA library, a reverse screening was introduced in the tenth round using the binding buffer as the reverse screening target. The results showed a significant decrease in DNA recovery rate in the tenth round, possibly because ssDNA specifically bound to certain molecules in the binding buffer was removed during the reverse screening process. Subsequently, rounds 11–13 of positive screening were performed to stabilize library enrichment and DNA recovery rate. The results showed a significant increase in DNA recovery rate in the 11th round, which gradually stabilized in the 12th and 13th rounds, at which point the screening could be concluded.

[0061] Since nucleic acid aptamer libraries contain short-stranded DNA less than 100 bp, conventional gel extraction and purification methods have very low recovery efficiency, making it difficult to meet the required amount of DNA library. Therefore, after each round of screening, 20 μL of amplification product is taken for agarose gel electrophoresis to identify whether the PCR product contains the target band. The remaining PCR products are used as secondary libraries for the next round of nucleic acid aptamer screening.

[0062] Finally, the supernatant of the ssDNA-CtIP complex from rounds 6, 9, and 13 was used as a template for PCR amplification. The PCR amplification products were recovered, purified, and sent to Shanghai Sangon Biotech Co., Ltd. for nucleic acid aptamer sequencing.

[0063] 1.3 Nucleic acid aptamer sequencing and sequence analysis.

[0064] Nucleic acid aptamer sequencing results removed the primer binding sequences at both ends and retained the 40bp random sequence in the middle. The results showed that most of the sequences in the library were 40bp in size, which was consistent with the expected results.

[0065] The sequencing results from rounds 6, 9, and 13 were processed. Nucleic acid aptamer sequences with >5 repeats in round 6, ≥5 repeats in round 9, and ≥4 repeats in round 13 were selected. Sequences with <25 bases were removed. Homology analysis was performed on the selected sequences, resulting in 40 sequences with ≥60% homology. Among these, three sequences had identical bases and a total of 163 repeats, leading to 38 preliminary candidate sequences. The results are shown in Table 1, which lists the 38 preliminary candidate sequences selected from the three sequencing rounds and their repeat counts.

[0066] Table 138 Preliminary Candidate Nucleic Acid Aptamer Sequences and Repeat Numbers

[0067]

[0068]

[0069] 1.4 Prediction and analysis of the secondary structure of nucleic acid aptamers.

[0070] Preliminary analysis identified 38 candidate sequences based on sequence repeat count and sequence homology. However, it is not true that sequences with higher repeat counts necessarily have better binding affinity to the target. Research indicates that unique higher-order conformations are crucial in aptamer-target interactions. Therefore, the secondary structures of the 38 candidate aptamers were simulated using RNA structure software, and these 38 nucleic acid aptamers were classified into 5 different families based on the similarity of their secondary structures.

[0071] Each of the 38 candidate sequences exhibited stem-loop or raised-loop structures in its secondary structure. In more complex aptamers, hairpin structures are always used to connect stem-loops and raised-loops. These special structures often contain DNA active sites that can specifically bind to the target. Generally, the stem plays a role in stabilizing and supporting the spatial structure of the aptamer, while the loop folds through hydrophobic interactions, base stacking, and hydrogen bonding to form binding sites that interact with the target.

[0072] Furthermore, studies have shown that the lower the ΔG value of the aptamer's secondary structure, the more stable the secondary structure of the aptamer. Therefore, it is also very important to predict the ΔG value of nucleic acid aptamers. The predicted ΔG values ​​of candidate aptamers are shown in Table 2.

[0073] Table 238 Preliminary Candidate Nucleic Acid Aptamer Family Classifications and ΔG Value Prediction

[0074]

[0075]

[0076] Since the secondary structure stability of aptamers and their enrichment in the library are important screening indicators, five representative sequences were selected from the 38 candidate sequences based on both the number of repeats and the magnitude of the ΔG value. (See below) Figure 2 The five sequences are: A13-32 from family I, A9-2 from family II, A6913 from family III, A6-17 from family IV, and A13-10 from family V. The affinity of these five nucleic acid aptamers will be further tested in the future.

[0077] 1.5 Nucleic acid aptamer affinity and specificity analysis based on ssDNA binding rate.

[0078] Five nucleic acid aptamers with biotin-modified 5' ends were synthesized. The affinity and specificity of the five aptamers were detected using streptavidin magnetic beads to immobilize them. Results are as follows: Figure 3 As shown in the figure. Compared with the control group BSA, the four nucleic acid aptamers A6913, A6-17, A9-2, and A13-32 showed significantly higher affinity for the target protein CtIP than BSA. Although A13-10 had a high affinity for CtIP, the difference from the BSA group was not significant, indicating that aptamer A13-10 had poor specificity. Therefore, the detection of A13-10 will be removed in subsequent experiments. Figure 3 In the text, "***" represents p < 0.001, and "ns" represents p > 0.05.

[0079] 1.6 Determination of the nucleic acid aptamer dissociation constant Kd based on ssDNA binding rate.

[0080] The dissociation constant of nucleic acid aptamers was determined by immobilizing them with streptavidin magnetic beads. The results are as follows: Figure 4 As shown in the figure, the dissociation constant fitting curves of the aptamers reveal that aptamer A6-17 has the largest dissociation constant, while A9-2 has the smallest. A6913 and A13-32 fall between the two. A lower dissociation constant indicates a stronger and more stable binding affinity between the aptamer and the target. Therefore, based on the dissociation constants, the binding affinity of the four aptamers to the CtIP protein is: A9-2 > A13-32 > A6913 > A6-17. To verify whether the four selected aptamers can improve the integration efficiency of exogenous genes, subsequent experiments will use these four aptamers in CRISPR / Cas9 gene targeting experiments.

[0081] Example 2

[0082] An application of DNA aptamers based on CtIP protein to improve the integration efficiency of CRISPR / Cas9-mediated exogenous genes is as follows:

[0083] 1. Construction of HMEJ donor vector for site-directed integration of EGFP gene.

[0084] The HMEJ homologous recombination donor vector was designed according to experimental needs. This invention adds SA upstream of the exogenous gene to ensure correct post-transcriptional mRNA splicing and cleavage, while the aptamer sequence is located between the homologous arms at both ends and the sgRNAs at both ends. See [link to documentation]. Figure 5 .

[0085] 1.1 Design of donor vector homologous arm and PCR amplification.

[0086] The target site was selected by reviewing the literature. The target site is located in the intron between the first and second exons of Rosa26, and the sgRNA sequence is shown in SEQ ID NO.39. The left and right homologous arms were designed based on the genomic sequence near the sgRNA.

[0087] SEQ ID NO.39: GTCGAGTCGCTTCTCGATTA TGG The underlined TGG sequence is a PAM sequence.

[0088] The left homologous arm, abbreviated as LA, has the sequence shown in SEQ ID NO.40; the right homologous arm, abbreviated as RA, has the sequence shown in SEQ ID NO.41.

[0089] SEQ ID NO.40:

[0090] AAGCTCCTGTCAGTTACGCCGTCGGGAGTACGCAGCCGCTTAGCGACTCTCGCGTTGCCCCCTGGGTGGGGCGGGTAGGTAGGTGGGGTGTAGAGATGCTGGGTGTGCGGGCGCGGCCGGCCTCCTGCGGCGGGAGGGGAGGGTCAGTGAAATCGGCTCTGGCGCGGGCGTCCTCCCACCCTCCCCTTCCTTCGGGGGAGTCGGTTTACCCGCCGCCTGCTTGTCTTCGACACCTGATTGGCTGTCGAAGCTGTGGGACCGGGCCCTTGCTACTGGCTCGAGTCTCACATGAGCGAAACCACTGCGCGGGGCGCGGGGGTGGCGGGGAGGCGGGCGTTGGTACGGTCCTCCCCGAGGCCGAGCGCCGCAGTGTCTGGCCCCGCGCCCCTGCGCAACGTGGCAGGAAGCGCGCGCTGGAGGCGGGGGCGGGCTGCCGGCCGAGACTTCTGGATGGCGGCGGCCGCGGCTCCGCCCCGGGTTCCCACCGCCTGAAGGGCGAGACAAGCCCGACCTGCTACAGGCACTCGTGGGGGTGGGGGAGGAGCGGGGGTCGGTCCGGCTGGTTTGTGGGTGGGAGGCGCTTGTTCTCCAAAAACCGGCGCGAGCTGCAATCCTGAGGGAGCTGCGGTGGAGGAGGTGGAGAGAAGGCCGCACCCTTCTGGGCAGGGGGAGGGGAGTGCCGCAATACCTTTATGGGAGTTCTCTGCTGCCTCCCGTCTTGTAAGGACCGCCCTGGGCCTGGAAGAAGCCCTCCCTCCTTTCCTCCTCGCGTGATCTCGTCATCGCCTCCATGTCGAGTCGCTTCTCGA。

[0091] SEQ ID NO.41:

[0092] TTATGGGCGGGATTCTTTTGCCTAGGCTTAAGGGGCTAACTTGGTCCCTGGGCGTTGCCCTGCAGGGGAGTGAGCAGCTGTAAGATTTGAGGGGCGACTCCGATTAGTTTATCTTCCCACGGACTAGAGTTGGTGTCGAGGTTATTGTAATAAGGGTGGGGTAGGGAAATGGAGCTTAGTCATTCACCTGGGGCTGATTTTATGCAACGAGACTGCGGATTATCACTACTTATCATTTTTGGAGCATTTTTCTAGAGACAGACATAAAGCATGATCACCTGAGTTTTATACCATTTGAGACCCTTGCTGCACCACCAAAGTGTAGCATCAGGTTAAATCTTAATAGAAAAATTTTAGCTTTTGCTTGAGAAACCAGTGCTTCCCTCCCTCACCCTCTCTCCCCAGGCTCTCTACCCCTTTGCATCCCTACCAGGCATCTTAGCAACTCTCACTCATACTTGATCCCATTTTCCATTTGTTGTACTTGCTCCTCTAGTATTCAGACATAGCACTAGCTTTCTCCCTCTCTTGATCTTGGGTAGCCTGGTGTCTCGCGAAACCAGACAGATTGGTTCCACCACAAATTAAGGCTTGAGCTGGGGCTTGACTCTTACCCAGCAGTGCTTTTATTCCTCCCTAGTTCACGTTCTTAAATGTTTATCTTGATTTTCATTTTATCCTTTTTCCTTAGCTGGGATTCTGTCCCTGACCGTCTTCACAGTCCAGGTGATCTTGACTACTGCTTTACAGAGAATTGGATCTGAGGTTAGGCAACATCTCCCTTTTTCTTCCTCTAAATACCTCTCATTTCTGTTCTTACCAGTTAGTAACTGATCTCAGATGCCTGTGTGATAGCTTCCAA。

[0093] Using the HEK-293T cell genome as the template for PCR amplification, the homologous arms on both sides of the donor vector were prepared.

[0094] The primers were designed as shown in Table 3 below, where the aptamers were A6913, A6-17, A9-2, and A13-32, respectively.

[0095] Table 3. PCR amplification primers for the left and right homologous arms of the HMEJ donor vector.

[0096]

[0097] Note: The aptamers in Table 3 represent the sequences A6913, A6-17, A9-2, and A13-32.

[0098] After PCR, the correctly sized target fragment was recovered, treated with A, and then TA cloned using the pMD19-T vector. Following transformation, single colony picking, and sequencing, the following vectors were obtained: the left homologous arm vector Rosa26-LA-19T, containing both aptamer and sgRNA sequences; and the right homologous arm vector Rosa26-RA-19T, containing both aptamer and sgRNA sequences. Since four aptamer sequences were provided, a total of four homologous arm vectors and one control group without aptamers were constructed.

[0099] 1.2 PCR amplification of promoter-free exogenous genes and selection markers.

[0100] The EGFP gene was selected as the exogenous gene, and its expression was initiated using the human Rosa26 endogenous promoter. Using the pNRAMP1-eGFP-P2A-Puro plasmid, previously constructed and preserved in the laboratory, as a template, the exogenous gene EGFP and the puromycin resistance gene EGFP-P2A-Puro-polyA were cloned. To ensure normal expression of the promoterless exogenous gene, an SA sequence was added before the EGFP-P2A-Puro-polyA sequence. The SA sequence was added to the upstream primer, and PCR amplification was performed to prepend the SA sequence to the exogenous gene; the product was named SEPPA. The SA sequence stands for Spliceacceptor.

[0101] After the PCR product was amplified, its size was identified by 1% agarose gel electrophoresis. After purification and recovery, it was subjected to TA cloning, transformation, sequencing, etc. The plasmid that was confirmed to be correct was named SEPPA-19T.

[0102] 1.3. Enzymatic ligation of donor vector elements.

[0103] The successfully constructed Rosa26-LA-19T and SEPPA-19T were digested with restriction endonucleases SpeⅠ and HindⅢ, respectively. After isolation and purification, the SEPPA fragment was ligated into the linearized Rosa26-LA-19T plasmid to obtain the vector Rosa26-LA-SEPPA-19T. The results are shown in the figure. Figure 6 . Figure 6In the assay, lanes 1-3 were the control group; lanes 4-6 were the A6913 group; lanes 7-9 were the A6-17 group; lanes 10-12 were the A9-2 group; and lanes 13-15 were the A13-32 group. The first lane of each vector group was used for double enzyme digestion identification, and the last two lanes were used for single enzyme digestion identification.

[0104] Five vectors were obtained using this method: the ordinary vector Control group without aptamer sequence, the vector with aptamer A6913, the vector with aptamer A6-17, the vector with aptamer A9-2, and the vector with aptamer A13-32.

[0105] After transformation, bacterial selection, restriction enzyme digestion identification, and sequencing, the confirmed plasmid was named Rosa26-LA-SEPPA-19T. The confirmed plasmids Rosa26-LA-SEPPA-19T and Rosa26-RA-19T were double-digested with restriction endonucleases HindIII and EcoRI, and then ligated to obtain the recombinant vector named Rosa26-Aptamer-HMEJ-Donor, i.e., the donor vector. Restriction enzyme digestion identification with HindIII and EcoRI yielded the following results: Figure 7 .

[0106] Figure 7 In the data, lanes 1-3: enzyme digestion identification of the donor vector from the Control group; lanes 4-6: enzyme digestion identification of the donor vector from the A6913 group; lanes 7-9: enzyme digestion identification of the donor vector from the A6-17 group; lanes 10-12: enzyme digestion identification results of the donor vector from the A9-2 group; lanes 13-15: enzyme digestion identification results of the donor vector from the A13-32 group. The first lane of each vector group was used for double enzyme digestion identification, and the last two lanes were used for single enzyme digestion identification.

[0107] The donor vector constructed in this invention contains sgRNA sequences at both ends of the left and right homologous arms, aptamer sequences, left and right homologous arms, and SEPPA sequences, suitable for HMEJ gene targeting strategies. Five Rosa26-Aptamer-HMEJ-Donor donor vectors were constructed using the above method, named Rosa26-Control-HMEJ-Donor, Rosa26-A6913-HMEJ-Donor, Rosa26-A6-17-HMEJ-Donor, Rosa26-A9-2-HMEJ-Donor, and Rosa26-A13-32-HMEJ-Donor.

[0108] 2. Construction of CRISPR / Cas9 expression vector.

[0109] pSpCas9(BB)-2A-Puro is a commonly used starting vector for cleavage vectors in the laboratory. The oligonucleotide sequence targeting the human Rosa26 target site was synthesized, and sticky ends of the BbSI restriction enzyme were added. After digesting pSpCas9(BB)-2A-Puro with the restriction endonuclease BbSI, the sgRNA sequence was ligated into the digested expression vector via annealing, successfully constructing a CRISPR / Cas9 eukaryotic expression vector. The sgRNA sequences with the added BbSI restriction enzyme sites were Top Guideoligo and Bottom Guide oligo. pSpCas9(BB)-2A-Puro, PX459, plasmid#48139.

[0110] SEQ ID NO.46, Top Guide oligo:

[0111] 5'-CACCGGTCGAGTCGCTTCTCGATTA-3'.

[0112] SEQ ID NO.47, Bottom Guide oligo:

[0113] 5'-AAACTAATCGAGAAGCGACTCGACC-3'.

[0114] The bolded bases in SEQ ID NO.46 and SEQ ID NO.47 are the corresponding enzyme cleavage sites.

[0115] After transformation, bacterial selection, enzyme digestion identification, and sequencing, the correct plasmid was finally named Cas9-Rosa26-sgRNA, which is the cleavage vector.

[0116] 3. Liposome transfection.

[0117] This experiment requires co-transfection of one of the donor vectors and the Cas9-Rosa26-sgRNA cleavage vector. The mass ratio of Rosa26-Aptamer-HMEJ-Donor to Cas9-Rosa26-sgRNA transfection is 2:1. Due to the different donor vectors, this experiment has a total of 5 experimental groups: the Control group (without aptamer sequence), A6913 group, A6-17 group, A9-2 group, and A13-32 group.

[0118] 4. Screening of positive clones that integrate the EGFP gene at a specific site.

[0119] The identification strategy for the site-specific integration of exogenous genes in positive monoclonal cells obtained in this invention is described in [reference needed]. Figure 8 .

[0120] 4.1 Screening of positive clones.

[0121] Plasmids Rosa26-Aptamer-HMEJ-Donor and Cas9-Rosa26-sgRNA were co-transfected into HEK-293T cells with approximately 70% confluence. One day after transfection, the culture medium was changed, and puromycin was added to a final concentration of 2 μg / mL for drug screening. Cells were observed and the medium was changed every two days. After 15 days of puromycin screening, clumps of monoclonal cells could be observed under a microscope. During fluorescence observation, these monoclonal cell clumps all exhibited the expected green fluorescence. A cell scraper was used to gently scrape the monoclonal cell clumps from a cell culture dish and collect them in a centrifuge tube to obtain a mixed clonal sample. The sample was centrifuged at 1050g for 5 min, and the supernatant was discarded. Genomic DNA was extracted from the mixed clonal cells using a blood / cell / tissue genomic DNA extraction kit from Tiangen Biotech Co., Ltd. for junction PCR identification in subsequent experiments.

[0122] 4.2 Junction PCR was used to detect the integration of mixed clones.

[0123] The genomes of the aforementioned hybrid cloned cells were identified by junction PCR. Wild-type HEK-293T cells were used as the negative control (WT group). Using the extracted genomic DNA from the hybrid cloned cells as a template, PCR amplification was performed using primers 5' Junction-F and 5' Junction-R, yielding a 596 bp band, demonstrating successful integration of the 5' insert of Rosa26-Aptamer-HMEJ-Donor into the upstream homologous arm of the Rosa26 genome. PCR amplification using primers 3' Junction-F and 3' Junction-R yielded a 722 bp band, demonstrating successful integration of the 3' insert of Rosa26-Aptamer-HMEJ-Donor into the downstream homologous arm of the Rosa26 genome. The Rosa26-Aptamer-HMEJ-Donor insert accurately integrated into the expected region of the Rosa26 site via homologous recombination, verifying that the insertion was site-directed rather than random. The agarose gel electrophoresis results of the junction PCR detection are shown below. Figure 9 As shown.

[0124] Figure 9 In lane A, lane 1: WT; lane 2: Control; lane 3: A6913; lane 4: A6-17; lane 5: A9-2; lane 6: A13-32; Figure 9In lane B, lane 1: WT; lane 2: Control; lane 3: A6913; lane 4: A6-17; lane 5: A9-2; lane

[0125] 6: A13-32.

[0126] Sequencing analysis can more directly detect whether a foreign gene has been integrated at the expected site of the Rosa26 locus on the genome of the hybrid clone cells. Therefore, after the above products were isolated and purified, they were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing analysis. The sequencing results showed that the DNA sequence was consistent with the amplification product expected during primer design, proving that the foreign gene was successfully integrated at the target site.

[0127] Further results showed that the monoclonal cells obtained after drug screening had integration of the exogenous gene at the target site in their genome, and the exogenous EGFP gene could be observed to express green fluorescence under a fluorescence microscope. Figure 10 .

[0128] 5. Detection and analysis of green fluorescent protein expression using fluorescence microscopy.

[0129] The successfully constructed donor vector Rosa26-Aptamer-HMEJ-Donor and CRISPR / Cas9 expression vector were co-transfected into HEK-293T cells. The expression of exogenous green fluorescent protein (EGFP) in the cells was observed under a fluorescence microscope to detect the integration efficiency of the exogenous gene. EGFP protein expression was observed under a fluorescence microscope 2, 4, and 6 days after HEK-293T cells were transfected using a liposome transfection method. The results are shown in the figure below. Figure 11 .

[0130] ImageJ software was used to statistically analyze the percentage of green fluorescence area in the corresponding field of view for each group of cells. It was observed that at 2, 4, and 6 days post-transfection, the percentage of green fluorescence area in groups A6913 and A13-32 was significantly higher than that in the control group, while the percentage of green fluorescence area in groups A6-17 and A9-2 was significantly lower than that in the control group. This preliminarily indicates that aptamers A6913 and A13-32 improved the integration efficiency of the exogenous gene EGFP compared to the normal group without aptamer sequences, while A9-2 and A6-17 decreased the integration efficiency of the exogenous gene EGFP. Graphpadprism was used for significance analysis. Results are shown below. Figure 12 .

[0131] ***p<0.001.

[0132] 6. Flow cytometry detection.

[0133] The successfully constructed donor vector Rosa26-Aptamer-HMEJ-Donor and the CRISPR / Cas9 cleavage vector were co-transfected into HEK-293T cells. In addition to the five experimental groups, a blank control group was set up to eliminate background values. Cells were collected on day 6 post-transfection, and the EGFP positivity rate of 293T cells was detected by flow cytometry. Figure 13 As shown. ****p<0.0001, ***p<0.001, **p<0.01.

[0134] The results showed that the positive cell rate in group A6913 was significantly higher than that in group Control, the positive cell rate in group A13-32 was significantly higher than that in group Control, and the positive cell rates in groups A6-17 and A9-2 were significantly lower than those in group Control. These results indicate that aptamers A6913 and A13-32, compared with the standard vector in group Control, improved the integration efficiency of the exogenous gene EGFP, while aptamers A6-17 and A9-2, compared with the standard vector in group Control, reduced the integration efficiency of the exogenous gene EGFP. This trend is consistent with the EGFP protein expression observed under a fluorescence microscope.

[0135] 7. EGFP was expressed in HeLa cells using the Rosa26 endogenous promoter.

[0136] 7.1 Analysis of the expression of exogenous EGFP protein in HeLa cells under a fluorescence microscope.

[0137] The successfully constructed donor vector Rosa26-Aptamer-HMEJ-Donor and the CRISPR / Cas9 cleavage vector were co-transfected into HeLa cells. The expression of exogenous EGFP protein in the cells was observed using fluorescence microscopy to detect the integration efficiency of the exogenous gene. However, due to the low overall transfection efficiency and low overall expression level of green fluorescent protein in the actual experiment, with no difference in expression level between day 6 and day 4, only HeLa cells at 2 and 4 days post-transfection were observed and analyzed. Fluorescence microscopy images were taken at 2 and 4 days post-transfection, and the results are shown below. Figure 14 .

[0138] The results of statistical analysis of the proportion of green fluorescence area in the corresponding field of view for each group of cells using ImageJ software are as follows:

[0139] As observed at 2 and 4 days post-transfection, the proportion of green fluorescence area in groups A6913 and A13-32 was significantly higher than that in the control group, while the proportion of green fluorescence area in groups A6-17 and A9-2 showed no significant difference compared to the control group. This preliminarily indicates that aptamers A6913 and A13-32 improved the integration efficiency of the exogenous gene EGFP compared to the normal group without aptamer sequences. The EGFP expression in groups A6913 and A13-32 was consistent with the trend of EGFP expression in HEK-293T cells. ***p<0.001, ns p > 0.05. See the results below. Figure 15 .

[0140] 7.2 Flow cytometry analysis of exogenous EGFP protein expression in HeLa cells

[0141] The successfully constructed donor vector Rosa26-Aptamer-HMEJ-Donor and the CRISPR / Cas9 cleavage vector were co-transfected into HeLa cells. Cells were collected on day 4 post-transfection, and the EGFP positivity rate of HeLa cells was detected by flow cytometry. The results are as follows: Figure 16 As shown. ***p<0.001, *p<0.05.

[0142] like Figure 16 As shown, the positive cell rate in group A6913 was significantly higher than that in group Control, the positive cell rate in group A13-32 was significantly higher than that in group Control, and the positive cell rates in groups A6-17 and A9-2 were significantly lower than those in group Control. These results indicate that aptamers A6913 and A13-32 improved the integration efficiency of the exogenous gene EGFP compared to the ordinary vector in group Control, while aptamers A6-17 and A9-2 decreased the integration efficiency of the exogenous gene EGFP compared to the ordinary vector in group Control. This trend is consistent with the EGFP protein expression observed under a fluorescence microscope.

[0143] The A6913 aptamer enhances the transport capacity of the donor vector to the nucleus by integrating nuclear localization signals (NLS) or chromatin opening elements such as UCOE, and promotes the loosening of chromatin structure at the target site, thereby improving the accessibility of the donor template. The A13-32 aptamer may carry homologous recombination enhancement elements, such as the Rad51 binding site, specifically recruiting recombinases to double-strand break (DSB) sites, activating homologous targeted repair pathways, and improving repair precision. The combined effect of A6913 and A13-32 is that A6913 optimizes donor delivery efficiency, while A13-32 enhances recombinase activity, achieving a doubling effect in efficiency. Experiments in this invention demonstrate that the combined use of two donors can increase the integration efficiency of exogenous genes by 3 times compared to a single donor. This increase stems from: expanded homologous region coverage: the two donors optimize the homologous sequences of LA and RA respectively, forming a longer effective recombination region; and activation of the repair pathway: the A13-32 aptamer accelerates homologous strand pairing and template exchange by recruiting recombinases such as Rad51.

[0144] Enhanced specificity and safety: Dual donors reduce non-specific insertion events through competitive binding repair mechanisms. For example, the A6913 donor may preferentially occupy the target site due to high homology, while the A13-32 donor inhibits random integration through functional elements.

[0145] By combining Rosa26-A6913-HMEJ-Donor, Rosa26-A13-32-HMEJ-Donor, and Cas9-Rosa26-sgRNA, this invention innovatively achieves end-to-end optimization of "precise cutting-efficient delivery-synergistic repair." The dual-donor design not only enhances integration efficiency through functional complementarity but also reduces technical risks through redundant templates, providing a highly efficient and reliable new strategy for gene editing. This approach has passed preliminary theoretical validation, and subsequent experiments will further quantify its efficiency advantages and explore broader clinical applications.

[0146] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0147] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. Use of a DNA aptamer, characterized in that, The application refers to: using the DNA aptamer to construct a vector set for the CRISPR / Cas9 gene editing system to improve the integration efficiency of exogenous genes mediated by CRISPR / Cas9; the vector set includes a donor vector and a cutting vector; The donor vector is constructed using pMD19-T as the starting vector and contains the DNA aptamer; the nucleotide sequence of the DNA aptamer is at least one of SEQ ID NO.1 and SEQ ID NO.

10.

2. The application as described in claim 1, characterized in that, The cleavage vector was obtained by digesting pSpCas9(BB)-2A-Puro with enzymes and then ligating it into sgRNA.

3. The application as described in claim 1, characterized in that, The integration efficiency of exogenous genes is improved through the following methods: The donor vector and the cleavage vector were co-transfected into cells and cultured.

4. The application as described in claim 3, characterized in that, The cells include either HEK-293T or HeLa cells.

5. The application as described in claim 3, characterized in that, The mass ratio of the donor carrier to the cutting carrier is 1 to 3:

1.

6. The application as described in claim 5, characterized in that, The mass ratio of the donor carrier to the cutting carrier is 2:1.

Citation Information

Patent Citations

  • Tumor marker HE4 probe as well as construction method and application thereof

    CN115184606A