Application of NtCYP84A1 gene in tobacco drought tolerance

By knocking out the NtCYP84A1 gene in tobacco and constructing a gene editing vector using CRISPR/Cas9 technology, its function in tobacco drought resistance was identified. This solved the problem of insufficient application of the cytochrome P450 gene in tobacco drought resistance and improved the drought resistance of tobacco under drought stress.

CN120555495BActive Publication Date: 2026-03-24CHINA NATIONAL TOBACCO CORPORATION HUNAN PROVINCIAL CORPORATION
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-12
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

There is limited research on the function of cytochrome P450 genes in plants under abiotic stress, especially their application in tobacco drought resistance has not been fully explored.

Method used

By isolating and knocking out the NtCYP84A1 gene in tobacco, gene editing vectors were constructed using CRISPR/Cas9 technology to obtain knockout lines KO#2 and KO#4, which were then subjected to drought stress treatment to identify their function in tobacco drought tolerance.

Benefits of technology

Tobacco lines with the NtCYP84A1 gene knocked out exhibited higher survival rates and stronger drought resistance under drought stress. Physiological and biochemical indicators such as H2O2, OFR, MDA, EL, and RWC showed that the gene negatively regulated the drought resistance of tobacco, providing breeding resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120555495B_ABST
    Figure CN120555495B_ABST
Patent Text Reader

Abstract

The application discloses application of an NtCYP84A1 gene in tobacco drought resistance and belongs to the technical field of molecular biology.The application discloses the application of the NtCYP84A1 gene in tobacco drought resistance, and the sequence of the NtCYP84A1 gene is shown as SEQ ID NO.1.The NtCYP84A1 gene negatively regulates the tobacco drought resistance, and the exploration and function research of the gene provide a gene resource and a breeding material for cultivating a new tobacco drought-resistant variety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and more specifically to the application of the NtCYP84A1 gene in tobacco drought resistance. Background Technology

[0002] Tobacco, as an important economic crop in my country, is widely cultivated throughout the country. Due to the high sensitivity of tobacco leaf yield and quality formation stages to water, drought has become a key stress factor limiting tobacco production. Therefore, breeding new tobacco varieties with strong drought resistance is of great significance in mitigating the impact of drought. Currently, identifying key functional genes and improving new varieties through molecular breeding techniques such as marker-assisted selection or gene editing is an effective and feasible approach.

[0003] Cytochrome P450 (CYP450) is one of the largest protein superfamilies, named for its highest absorbance at 450 nm after binding with reduced CO. It is widely distributed in plant, microbial, insect, and mammalian cells. The CYP450 gene family is numerous in plant genomes, accounting for approximately 1% of all protein-coding genes. CYP450 proteins are highly conserved evolutionarily, suggesting functional similarities. They typically bind to organelle membranes such as mitochondria, the Golgi apparatus, and the endoplasmic reticulum, and are widely involved in secondary metabolic reactions in various plant life activities, including the synthesis and degradation of terpenes, hormones, phenylpropane, fatty acids, alkaloids, signaling molecules, and flavonoids. They play a crucial role in plant growth and development and enhancing plant adaptability to abiotic stress.

[0004] Overexpression of the apple CYP450 gene MdCYPM1 significantly affected auxin transport and flowering time, resulting in reduced chlorophyll and hypocotyl elongation, indicating that this gene plays an important role in regulating plant growth and development. Studies have found that both CYP86A8 and CYP86A2 genes enhance drought resistance in Arabidopsis by participating in cuticle synthesis. In sorghum, the expression of CYP99A1 and CYP709C1 genes was significantly induced by low temperature, suggesting they may play a role in resisting cold stress. The wheat CYP450 gene TaCYP81D5 mediates the plant's salt tolerance response by participating in the scavenging of reactive oxygen species within the plant. The expression of the Arabidopsis thaliana AtCYP709B3 gene is induced by high salt stress, suggesting that it may function similarly to the wheat TaCYP81D5 gene, also mediating the plant's salt tolerance response. Overexpression of the alfalfa CYP2E1 gene significantly enhanced the plant's resistance to mercury toxicity. Overexpression of the GmCYP82A3 gene significantly enhanced the transgenic soybean's resistance to Phytophthora, and the expression levels of genes related to the JA and ET signaling pathways were significantly upregulated, suggesting that this gene mediates the soybean's disease resistance response by participating in the positive regulation of the JA and ET signaling pathways.

[0005] Currently, there is limited research on the function of cytochrome P450 genes in plants under abiotic stress. Therefore, providing information on the application of the NtCYP84A1 gene in tobacco drought tolerance is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides the application of the NtCYP84A1 gene in tobacco drought resistance.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] Application of the NtCYP84A1 gene in tobacco drought resistance, wherein the NtCYP84A1 gene sequence is shown in SEQ ID NO.1.

[0009] Furthermore, the application of knocking out the NtCYP84A1 gene in the positive regulation of drought resistance in tobacco, the NtCYP84A1 gene sequence is shown in SEQ ID NO.1.

[0010] Furthermore, the application of biomaterials with NtCYP84A1 gene expression knockout in the positive regulation of drought resistance in tobacco, wherein the NtCYP84A1 gene sequence is shown in SEQ ID NO.1;

[0011] The biomaterial is any one of the following:

[0012] A: An expression cassette capable of silencing the NtCYP84A1 gene with a nucleotide sequence as shown in SEQ ID NO.1;

[0013] B: A recombinant vector containing the expression cassette described in A;

[0014] C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

[0015] Furthermore, the application of the NtCYP84A1 gene in tobacco breeding, the NtCYP84A1 gene sequence is shown in SEQ ID NO.1.

[0016] Furthermore, the application of the NtCYP84A1 gene in the selection and breeding of drought-resistant tobacco germplasm, wherein the NtCYP84A1 gene sequence is shown in SEQ ID NO.1.

[0017] As can be seen from the above technical solution, compared with the prior art, this invention discloses the application of the NtCYP84A1 gene in tobacco drought resistance. A drought-responsive gene, NtCYP84A1, was isolated from tobacco. The CDS length of this gene is 1584 bp, encoding 527 amino acids. Phylogenetic analysis revealed that NtCYP84A1 is most closely related to NtoP45084A1T in Tobacco velutipes. Using K326 as a background, two knockout lines, KO#2 and KO#4, of this gene were obtained using CRISPR / Cas9 technology. Mannitol-simulated drought and natural drought treatments were applied to the wild-type and the two knockout lines. Phenotypic identification results showed that after 5 hours of mannitol treatment, K326(WT) wilted more than the two knockout lines; natural drought results showed that the survival rate of the two knockout lines was significantly higher than that of K326(WT) plants. Physiological and biochemical results showed that under drought stress, the levels of H2O2, OFR, MDA, and EL in the two knockout lines were significantly lower than those in the wild type. RWC results showed that the levels in the two knockout lines were significantly higher than those in the wild type. In ROS staining, the stained area and color of the WT plants were deeper than those in the two knockout lines. These results indicate that NtCYP84A1 negatively regulates drought tolerance in tobacco. The discovery and functional study of this gene provide genetic resources and breeding materials for cultivating new drought-resistant tobacco varieties. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0019] Figure 1 Phylogenetic analysis of NtP45084A1;

[0020] Among them, (Nt) Nicotiana tabacum; (Nto) Nicotianatomentosiformis; (Na) Nicotiana attenuata; (Ns) Nicotiana sylvestris; (Le) Lycopersicon esculentum; (Lb) Lycium barbarum; (Lf) Lycium ferocissimum; (Ss) Solanum stenotomum; (St) Solanumtuberosum; (Sv) Solanum verrucosum; (Sp) Solanum pennellii; (Sl) Solanumlycopersicum; (Ca) Capsicum annuum; (Ce) Centaurium erythraea;

[0021] Figure 2 For NtCYP84A1 protein sequence homology comparison analysis;

[0022] Figure 3 For sequence alignment and peak plot analysis near the target site;

[0023] Figure 4 For sequence alignment of NtCYP84A1 protein in knockout lines and WT;

[0024] Figure 5 To identify the drought resistance phenotype of knockout lines;

[0025] Wherein, A: mannitol simulated drought; B: natural drought experimental phenotype; C: natural drought survival rate statistics;

[0026] Figure 6 Analysis of changes in H2O2 content (A) and OFR content (B) after 3 days of mannitol treatment;

[0027] Figure 7 Analysis of changes in MDA(A), EL(B), and RWC(C) content after 3 days of mannitol treatment;

[0028] Figure 8 The results of DAB and NBT staining of two knockout lines and WT plants under simulated drought stress. Detailed Implementation

[0029] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0030] The NtCYP84A1 CDS sequence is shown in SEQ ID NO.1.

[0031] ATGAAAGAGATGATAATGCAAAACAATATGAGCACTACTCTTCTTGAAGCTTTTACAAGCTATGACCATGCTATTCTTCTTCGTTATCCCTCTCTTCTTCTTATTCCTTCTCTCCAAATCT CGCCGTAAACGTTTGCCTCCAGG TCCAACTGGTTGGCCTCTGATTGGTAACATGATGATGATGGACCAGTTAACTCACCGTGGCCTTGCCAAACTAGCCCAAAAATATGGTGGCGTTTTTCACCTCAAAATGGGTTATGTCCACAAAATTGTAGTCTCCGGTCCAGACGAAGCTCGCCAAGTATTACAGGAACACGACATCATATTTTCGAACCGT CCAGCGACCGTAGCCATAAGTTACCTAACATACGACCGTGCAGACATGGCGTTTGCTGACTATGGACTCTTCTGGCGTCAGATGAGAAAACTATGTGTTATGAAACTCTTCAGCCGCAAACGAGCTGAGTCATGGGATTCAGTTCGTGACGAAGTGGATTCCATGGTTAGAATTGTAACAACCAACACAGGCACAGCTGTCAACTTAGGTGAACTTGTGTTCAGTCTCACTCGTAATATTATCTACAGAGCTGCTTTTGGAACTTGTTCTGAAGATGGACAAGACGAGTTCATTAAAATTATGCAAGAATTTTCGAAGCTATTTGGTGCGTTCAATATAG CTGATTTTATTCCATGGCTAGGGTGGATTGGTAAGCAGTCTAAATATTAGACTTGCTAAGGCTAGAGCATCGCTTGATGGGTTCATTGATTCGATTATTGATGACCATATTATGAGAAAGAAAGCTAATGTTAATGGTAGAACTGATGATGGTGTGTAGAGAAACTGATATGGTTGATGAGCTTTTAGCTTTTTACAGTGAGGAAGCAAAAGTAACTGAGTCCGAAGATTTGCAGAATGCCATCAGGCTTACTAAGGATAATATCAAAGCTATCATCATGGATGTTTGGAGGGACAGAAACAGTGGCTTCTGCAATAGAATGGGCCATGGCAGAGCTTATGAGGAGTCCTGACGACCTTAAAAAAGTACAACAAGAGCTGGCCAACGTTGTCGGACTCAACAGAAAAGTTGAAGAATCTGACTTTGAAAAATTAACGTACTTAAAATGTTGTCTAAAAGAAACTCTACGACTTCACCCTCCAATCCCTCTCCTACTTCATGAAACCGCCGAGGAATCCACCGTCACCGGCTACCATATTCCGGCAAAGTCACACGTTATTATAAATTCATTTGCCATTGGACGTGACAAAAATTCATGGGAAGATCCTGAAACTTACAAACCTTCTAGGTTTCTCAAAGAAGGTGTGCCAGATTTTAAAGGAGGTAACTTTGAGTTTTTACCATTCGGGTCGGGTCGGAGGTCTTGCCCCGGTATGCAACTTGGGCTTTATGCATTAGAAATGGCAGTGGCCCATCTTCTTCTTTGCTTTACTTGGGAATTGCCAGATGGTATGAAACCAAGTGAGCTTAAAATGGATGATATTTTTGGACTCACTGCTCCAAGAGCTAATCGACTCGTGGCTGTGCCTAGTCCACGTTTGTTGTGCCCACTTTATTAA; SEQ ID NO.1.

[0032] The NtCYP84A1 protein sequence is shown in SEQ ID NO.2.

[0033] ;SEQ ID NO.2.

[0034] Example 1: Gene Sequence Feature Analysis

[0035] The CYP84A1 protein sequence involved in this invention (as shown in SEQ ID NO.2) was obtained from the National Center for Biotechnology Information website (http: / / www.ncbi.nlm.nih.gov / BLAST / ). Gene homology was analyzed using MEGA11.0 software and a phylogenetic tree was constructed using the neighbor-to-neighbor merging (NJ) method. Protein similarity was compared using DNAMAN software.

[0036] Phylogenetic analysis revealed that NtCYP84A1 is most closely related to NtoCYP84A1 (XP_070051355.1) of Nicotiana pubescens. Figure 1 Homology analysis of the protein sequence revealed that the protein sequence possesses a typical Cytochrome P450 (CYP) domain and shows high homology with NtoCYP 84A1 from Nicotiana flavescens and NsCYP 84A1 from Nicotiana scabra. Figure 2 ).

[0037] Example 2: Functional identification of NtP45084A1 in tobacco drought resistance

[0038] 1) Construction of gene editing vectors

[0039] (1) Target design

[0040] Using the online analysis tool at http: / / crispor.tefor.net / , targets were designed on gene exons, and the following two specific targets were obtained through analysis:

[0041] Target1: CGCCGTAAACGTTTGCCTCCAGG; SEQ ID NO.3;

[0042] Target2: TAACTTATGGCTACGGTCGCTGG; SEQ ID NO.4.

[0043] Then, primers for the CRSIPR vector were designed, and their sequence information is as follows:

[0044] F1(+): cagtGGTCTCatgcaCGCCGTAAACGTTTGCCTCC; SEQ ID NO.5;

[0045] R1(-): cgatGGTCTCaaaacGCGACCGTAGCCATAAGTTA; SEQ ID NO.6.

[0046] (2) PCR amplification

[0047] Prepare a 50 μL system according to Table 1 and perform the amplification reaction according to the procedure in Table 2.

[0048] Table 1 PCR system

[0049]

[0050] Table 2 PCR Procedure

[0051]

[0052]

[0053] The target fragment (approximately 270 bp) was recovered by gel extraction. The recovered DNA was dissolved in 30 μL of water. After verification, it was ligated into the vector.

[0054] (3) Enzyme digestion and ligation

[0055] The enzyme digestion and ligation system is shown in Table 3, and the reaction conditions are shown in Table 4.

[0056] Table 3 Enzyme digestion and ligation system

[0057]

[0058] Table 4 Enzyme digestion and ligation reaction conditions

[0059]

[0060] (4) Transformation and identification

[0061] Transform 5-10 μL of the ligation product into competent E. coli cells, following the instructions (Fast-T1 chemocompetent cells, Novizan, catalog number: C505-03). Plate the transformed cells onto 50 μg / mL kanamycin-resistant LB agar plates and incubate at 37°C for 12 hours. Perform colony PCR identification.

[0062] Primer information is as follows:

[0063] F2: gtaaaacgacggccagt; SEQ ID NO.7;

[0064] R2: ccagaaattgaacgccgaag; SEQ ID NO. 8.

[0065] Ten single colonies were selected for PCR identification. The identification system and reaction conditions are shown in Tables 5 and 6.

[0066] Table 5 Colony PCR Reaction System

[0067]

[0068]

[0069] Table 6 PCR reaction procedures

[0070]

[0071] The target band is a fragment of approximately 800bp.

[0072] Select bacterial suspensions corresponding to 1-3 positive bands, take 100μL for sequencing, and inoculate the remaining 400μL of bacterial suspensions into 5-10ml of kanamycin-resistant LB. Shake the test tubes and wait for the sequencing results. Take the tube with the correct sequencing results to extract the plasmid. After extracting the plasmid, preserve the bacterial strain and plasmid.

[0073] 2) Tobacco genetic transformation

[0074] (1) Preparation of Agrobacterium

[0075] Add 1 μL of plasmid to 50 μL of GV3101 Agrobacterium competent cells (refer to the manufacturer's instructions for specific methods). Transform and plate onto LB agar plates containing 50 μg / mL kanamycin resistance, incubate at 28°C for 48 h, and perform colony PCR identification. The amplification primers, reaction system, and reaction procedure are the same as above. Detect the PCR products by gel electrophoresis. If the electrophoretic bands of the positive control (using the correctly sequenced plasmid as a template) and the sample are clear and of the correct size, and the negative control (using water as a template) shows no band, it indicates that the sample can proceed to the next step and can be used to infect tobacco.

[0076] Single colonies were selected and cultured in liquid LB medium containing 25 μg / mL rifampicin and 100 μg / mL kanamycin. The culture was incubated at 28°C for 24 h with shaking. The culture was then centrifuged at 4000 rpm for 10 min, the supernatant was discarded, and the culture was resuspended in a immersion buffer (containing 10 mM MgCl2, pH 5.2, 10 mM 2-(N-morpholine)ethanesulfonic acid (MES), and 0.1 mM acetylsylphenone) and incubated at room temperature for at least 3 h until OD500 was reached. 600 The value is approximately 0.6, which is used as a pre-treatment solution.

[0077] (2) Tobacco genetic transformation

[0078] Select plump and uniform "K326" tobacco seeds, disinfect them with 10% sodium hypochlorite solution for 15 min, rinse them 5 times with sterile water, and slightly dry them with sterile absorbent paper. Sow 4 seeds / bottle on MS medium containing 30 g / L sucrose and 8 g / L agar (pH = 5.8). Incubate at 25℃ under constant light and temperature conditions of 1600 lx light intensity and 16 h (light) / 8 h (dark) photoperiod for 45 days. After the sterile seedlings have grown 4 leaves, cut them into small pieces of about 5 mm x 5 mm and remove the veins. Pre-culture them on MS medium containing 2 mg / L 6-BA and 0.2 mg / L IAA for 2 days, then soak them in Agrobacterium infection solution. The infected explants are then placed in MS medium containing 2 mg / L 6-BA and 0.2 mg / L IAA and cultured in the dark for 2 days. After co-culturing, 50 mg / L kanamycin and 500 mg / L carbenicillin were added to the culture medium for selection to induce the production of resistant callus. The culture conditions were the same as above, with subculturing every 14 days. When the resistant shoots on the callus reached 2 cm, they were transferred to rooting medium (MS + 50 mg / L kanamycin + 500 mg / L carbenicillin + 0.2 mg / L IAA). Rooting occurred in about 7 days. When the seedlings reached about 6 cm, the mouths of the culture bottles were opened for hardening off for 2 days. The seedlings were then transplanted into high-temperature sterilized tobacco-specific substrate (Hunan Tianliang Agricultural Technology Development Co., Ltd.), covered with plastic film to retain moisture, and cultured under light at 25–27℃ for further seed harvesting.

[0079] 3) Sequencing analysis of positive seedlings

[0080] Genomic DNA was extracted from the leaves of positive seedlings using materials from Nanjing Novizan Biotechnology Co., Ltd. The Plant DNA Isolation Mini Kit (catalog number: DC104-01) was used for total plant DNA extraction; detailed instructions were provided in the manual. The knockout material was amplified by PCR using PrimeSTAR MaxDNA Polymerase, a high-fidelity enzyme from Biotech (Beijing) Co., Ltd.

[0081] Primer sequence information is as follows:

[0082] NtCYP84A1-crisp-F1:TATCTCCTATGCTCTCCAGT; SEQ ID NO.9;

[0083] NtCYP84A1-crisp-R1: CTTGCATCAAAGAGTGGTG; SEQ ID NO. 10.

[0084] The target fragment is 1713bp in length.

[0085] The PCR amplification system is shown in Table 7, and the PCR amplification procedure is shown in Table 8.

[0086] Table 7 PCR amplification system

[0087]

[0088] Table 8 PCR Procedure

[0089]

[0090] The obtained PCR products were sequenced, and the sequencing peak diagram and sequence alignment analysis were performed using SnapGene Viewer and DNAMAN, respectively.

[0091] Screening results of NtCYP84A1 homozygous knockout lines: Sequencing analysis of 30 positive seedlings revealed two successfully edited lines, KO#2 and KO#4. Furthermore, KO#2 showed an insertion of one base at target site 2, while KO#4 showed a deletion of one base at target site 2. The presence of clean single peaks near the target sites indicates that these two lines are homozygous mutants. Figure 3 Sequence alignment of NtCYP84A1 protein in knockout lines and WT is shown in [link to relevant documentation]. Figure 4 .

[0092] 4) Identification of drought tolerance in knockout strains

[0093] Using K326 as a background, two knockout lines, KO#2 and KO#4, were obtained using CRISPR / Cas9 technology. WT plants and seeds from the two knockout lines KO#2 and KO#4 were cleaned, sterilized, and then subjected to a low-temperature treatment at 4℃ for 48 hours. They were then sown in small square boxes pre-filled with tobacco-specific substrate and fully watered, covered to maintain warmth and humidity, and cultured in an artificial climate chamber (temperature 25℃, relative humidity 75%, light / dark = 16h / 8h) for 30 days until further treatment.

[0094] (1) Mannitol drought simulation experiment: Select tobacco seedlings with uniform growth, and irrigate each seedling with 200mL of 400mM mannitol solution. Observe the phenotype and take pictures for recording. Use 200ml of H2O per seedling as control (CK).

[0095] (2) Natural drought experiment: After 14 days of natural drought and 14 days of rehydration, photos were taken and the survival rate was recorded.

[0096] Functional identification of the NtCYP84A1 gene in tobacco drought tolerance: such as Figure 5 As shown in Figure A, under the control conditions, the knockout lines KO#2 and KO#4 showed no significant difference in phenotype compared to the WT plants. After 5 hours of mannitol treatment, the WT plants exhibited overall wilting, while the leaves of the two knockout lines only showed slight drooping, with no significant change compared to before treatment. These results indicate that the drought tolerance of the two knockout lines was significantly improved compared to WT. After natural drought stress and rewatering treatment, the recovery of the two knockout lines was significantly stronger than that of the WT plants, and their corresponding survival rates were also significantly higher. Figure 5 BC).

[0097] 5) Determination of physiological and biochemical indicators of knockout strains

[0098] Drought resistance was assessed by taking the third leaf (counting from the top down) 3 days after mannitol treatment as a plant sample for physiological and biochemical index testing, with 5 biological replicates for each treatment.

[0099] Malondialdehyde (MDA) content was determined using a plant-based MDA test kit (Nanjing Jiancheng, catalog number: A003-3-1); hydrogen peroxide (H2O2) content was determined using a hydrogen peroxide test kit (Nanjing Jiancheng, catalog number: A064-1-1); and superoxide anion capacity (OFR) was determined using a superoxide anion (Oxygen free radical, OFR) kit (Jiangsu Edison Biotechnology, catalog number: ADS-W-YH008). Specific methods were performed according to the kit instructions.

[0100] Relative conductivity: Take 0.2g of fresh leaf tissue from the fourth true leaf of the seedling (counting downwards from the top leaf) using a round punch, place it in a centrifuge tube containing 25ml of ddH2O, and treat it on a shaker at 37℃ for 24h. Measure the conductivity L1 of the first extravasation. Then, place the EP tube in an autoclave at 120℃ for 15 minutes. After cooling to room temperature, measure the conductivity L2 of the second extravasation. Calculate the relative conductivity EL = L1 / L2 * 100%.

[0101] RWC determination method: After cutting the leaves, first measure the fresh weight (Wf), then soak the leaves in water until they are fully saturated, and measure the weight at this point as the saturated weight (Wt). Next, place the leaves in an oven and first use 105℃ for blanching for 15 minutes, then bake at 80℃ for about 40 minutes until the leaves are completely dehydrated, and measure the weight as the dry weight (Wd). Calculate the relative moisture content using the formula: RWC = (Wf - Wd) / (Wt - Wd) × 100.

[0102] 3,3'-Diaminobenzidine (DAB) staining: First, prepare 0.1 mg / mL DAB and dissolve it in 50 mM Tris-acetic acid buffer (pH 5.0). Immerse the leaves in the staining solution overnight at room temperature in the dark. Remove the staining solution, add anhydrous ethanol, and incubate in a boiling water bath for 10 minutes (if chlorophyll is difficult to dehydrate, the time can be longer). Finally, transfer the leaves to anhydrous ethanol, photograph and observe them under a microscope or camera, and preserve them.

[0103] Nitrotetrazole blue (NBT) staining: First, prepare an NBT staining solution of 1 mg / mL in 10 mM PBS (pH 7.8). Cut off leaves and place them in the NBT staining solution. Stain under light for 1-2 hours. Once a colorimetric phenotype (leaf turning blue) is observed, destain. Remove the staining solution, add anhydrous ethanol, boil in boiling water for 10 minutes, and store in 70% ethanol. Observe under a microscope or camera.

[0104] Physiological and biochemical results showed that, under control conditions, the contents of H2O2 and OFR in the two knockout lines were not significantly different from those in the WT plants. After 3 days of mannitol stress treatment, the contents of H2O2 and OFR in the two knockout lines were significantly lower than those in the WT plants. Figure 6 ).

[0105] like Figure 7 As shown, before treatment, there were no significant differences in MDA, EL, and RWC between the two knockout lines and WT. After 3 days of mannitol stress treatment, the MDA content in the two knockout lines was significantly lower than that in WT, the EL content was lower than that in WT plants, while the RWC content in the two knockout lines was significantly higher than that in WT.

[0106] ROS histochemical staining was performed on the drought-treated knockout lines and wild-type lines. DAB was oxidized to a brown pigment in the presence of H2O2 and peroxidase. Figure 8 DAB staining results showed no significant difference between the leaves of the knockout lines and the WT leaves before treatment. After drought stress, WT leaves contained larger areas of reddish-brown spots, indicating that the WT lines accumulated more H2O2 than the knockout plants. NBT staining results showed that under normal conditions, both the knockout and WT leaves had slight blue spots, but there was no significant difference between the lines. After drought treatment, the WT plants had a larger staining area and a deeper staining intensity, indicating that the WT plants accumulated more superoxide anions (O2) than the two knockout lines. - ).

[0107] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Knockout NtCYP84A1 The application of genes in improving drought resistance in tobacco is characterized by, The NtCYP84A1 The gene sequence is shown in SEQ ID NO.

1.

2. Knockout NtCYP84A1 The application of gene-expressing biomaterials in improving drought resistance in tobacco is characterized by, The NtCYP84A1 The gene sequence is shown in SEQ ID NO.1; The biomaterial is any one of the following: A: Enables nucleotide sequences as shown in SEQ ID NO.1 NtCYP84A1 Gene silencing expression cassettes; B: A recombinant vector containing the expression cassette described in A; C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

3. Knockout NtCYP84A1 The application of genes in breeding to improve tobacco drought resistance is characterized by, The NtCYP84A1 The gene sequence is shown in SEQ ID NO.

1.

4. Knockout NtCYP84A1 The application of genes in the breeding of tobacco germplasm with improved drought resistance is characterized by, The NtCYP84A1 The gene sequence is shown in SEQ ID NO.1.

Citation Information

Patent Citations

  • Tobacco nicotine conversion rate identification method

    CN117587161A

  • Tobacco drought response gene NtPMT2 and application thereof

    CN117625598A