Pupa papaya american population tracing snp molecular marker and application thereof
By screening and designing SNP molecular markers specific to the U.S. population of Papaya Meat Scale, the problem of inaccurate population tracing in existing technologies has been solved, enabling accurate tracing of the Papaya Meat Scale population and improving the accuracy of port quarantine and the security of international trade.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2026-03-24
AI Technical Summary
Existing technologies make it difficult to conduct accurate and rapid detection of quarantine pests at ports of entry, especially lacking effective molecular markers for the genetic differentiation characteristics of the U.S. population of Papaya Mealybug, resulting in unclear population origins and affecting international trade and ecological security.
Population-specific SNP molecular markers of Papaya spp. were screened through whole-genome sequencing. Detection primers were designed and a source tracing detection method was established. The genetic stability of the SNP molecular markers was used to determine the population source.
This has enabled accurate tracing of the American population of Papaya Starch Crab, avoiding trade frictions, improving the targeting of port quarantine, and ensuring the smooth progress of international agricultural trade and ecological security.
Smart Images

Figure FT_1 
Figure FT_2 
Figure SMS_1
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology detection technology, and in particular to an SNP molecular marker technology for tracing the U.S. population of Papaya Meatfly and its application. Background Technology
[0002] Currently, molecular identification of plant quarantine samples intercepted at ports mainly focuses on interspecific species identification, lacking precise and effective detection techniques for the genetic differentiation characteristics of subspecies geographic populations. With the increasing need for precise customs quarantine supervision and technical trade measures, it is necessary to conduct geographic population tracing and identification of important quarantine pests intercepted at ports to clarify the origin of the intercepted populations, including their geographic affiliation and possible transmission routes.
[0003] There are currently four main technical methods related to population tracing: (1) simplified genome sequencing and analysis, (2) detection and analysis of specific barcode gene fragments (mitochondrial and nuclear genes, etc.), (3) microsatellite (SSR) molecular markers and analysis, and (4) SNP molecular marker technology. The first three technologies have significant limitations in population tracing detection, while SNP molecular markers are mainly used for medical disease diagnosis, molecular markers of agricultural breeding traits, and molecular markers for meat tracing in food. Currently, there are no corresponding technologies or applications for developing SNP molecular markers for tracing quarantine pest populations.
[0004] (1) Simplified genome sequencing and analysis
[0005] This technology integrates and analyzes the genetic differentiation characteristics and sources of variation among populations at the genomic level through simplified genome sequencing of samples from different sources. Examples include strain typing and transmission source analysis of COVID-19 based on genome sequence, and research on the rapid expansion mechanism of the invasive weed Mikania micrantha (Liu, Bo; Yan, Jian; Li, Weihua et al. Mikania micranthagenome provides insights into the molecular mechanism of rapid growth. Nature Communications, 2020, 11(1). DOI:10.1038 / s41467-019-13926-4). The advantage of this technology is that it provides comprehensive and accurate population typing information. However, this technology requires the use of second-generation (library construction) or third-generation sequencing technology to sequence and analyze population samples, which is labor-intensive, costly, and time-consuming. It is particularly unsuitable for routine detection of species with large genomic data, such as port insects, and it is difficult to determine the population origin under the condition of a single population sample.
[0006] (2) Detection and analysis of gene fragments (mitochondrial and nuclear genes, etc.)
[0007] Barcode gene fragments are mainly used as molecular markers for species identification and can also be used for preliminary analysis of population genetic structure, such as the analysis of the geographical population genetic structure of the papaya mealybug based on the mitochondrial CO1 gene (Oliveira M RC, Correˆa AS, Souza GA d, Guedes RNC, Oliveira LO D. 2013. Mesoamerican Origin and Pre- and Post-Columbian Expansions of the Ranges of Acanthoscelides obtectus Say, a Cosmopolitan Insect Pest of the Common Bean. PLoS ONE 8(7): e70039) (doi:10.1371 / journal.pone.0070039). However, due to the relative conservation of barcode sequences and the very limited information they can reflect on population genetic differentiation and diversity, coupled with the poor stability of variable marker sites, they are not suitable as molecular markers for tracing the origin of specific populations.
[0008] (3) Microsatellite (SSR) molecular markers and analysis
[0009] Microsatellites, also known as short tandem repeats (STRs) or simple sequence repeats (SSRs), are simple repetitive sequences uniformly distributed throughout the genomes of eukaryotes. They consist of tandem repeats of 2–6 nucleotides. Due to the high variability and abundance of repeat units among individuals, microsatellites are widely used as molecular markers for population genetics. Microsatellite loci are typically amplified by PCR, and the amplification products are analyzed by electrophoresis to separate alleles based on size for detection. However, microsatellites, as molecular markers of genetic variability, also suffer from poor stability, lack reliable molecular markers for specific populations, and require large population samples for routine detection. The origin of a population cannot be determined under single-sample conditions. Furthermore, the reliability of determining allele differences through electrophoretic mapping is poor.
[0010] (4) SNP molecular markers and detection
[0011] SNP (Single Nucleotide Polymorphism) molecular marker technology refers to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level. These variations may occur as single base transitions (e.g., C←→T) or transversions (e.g., C←→A), or as insertions or deletions. SNPs have wide applications in biology, medicine, agriculture, and many other fields. In medicine, SNP research helps in the localization, cloning, and identification of disease genes, and can be used for disease diagnosis, prediction of pathogenicity risk, pharmacogenomics, and the discovery of new drugs. In agriculture, SNP analysis helps breeders better understand crop genetic diversity and accelerates the development of superior varieties. In the food industry, SNP molecular markers can be used to trace the varieties of meat sold. In plant quarantine, SNP molecular markers are not currently used for population tracing of quarantine pests. Because SNP molecular marker detection and application lack universality, specific SNP molecular marker technologies require screening genomic data for specific species and research subjects to develop and establish.
[0012] Currently, routine molecular identification of quarantine pests and diseases both domestically and internationally primarily focuses on species identification, lacking precise and rapid detection technologies for identifying the genetic differentiation characteristics of intraspecific (infraspecific) geographical populations. It is noteworthy that intraspecific genetic differentiation within the same species, resulting from long-term geographical segmentation, can lead to genetic differences under corresponding ecological backgrounds (such as biotype and geographical population). Furthermore, the encounter of dissimilar infraspecific units (biotype and geographical type, etc.) may produce hybrid vigorous populations with stronger ecological adaptability than the original geographical populations themselves, generating new pathogenic potential. Therefore, species-level identification cannot accurately identify the genetic differentiation characteristics of geographical populations. It is necessary to develop molecular detection and identification technologies at the infraspecific level that can be used to identify the genetic backgrounds of different geographical species, enabling accurate tracing and tracking of their dispersal origins and helping to solve the tracing challenges of quarantine pests in international trade.
[0013] The quince mealybug (Paracoccus marginatus, Hemiptera: Thyrocota: Mealycidae) is a newly emerging invasive alien pest in my country. In recent years, this insect has spread rapidly in parts of South China, Hunan, and Guangxi. It damages more than 20 plant species, including guava, sweet potato, eggplant, chili pepper, pea, pomegranate, fiddle-leaved coral, hibiscus, rose of Sharon, and frangipani. The number of plant species it damages and its geographical distribution range are expanding year by year, posing a serious threat to garden crops and vegetables in southern China. Native to Central America, this insect has rapidly spread to tropical Caribbean regions, Indian and Pacific islands, Africa, and Southeast Asia since the 1990s. It was first discovered in Mexico in 1955, and by 1994, it was found in 14 Caribbean countries. In 1998, it was discovered in Florida, USA, and subsequently spread rapidly throughout Central America, invading Hawaii in 2006. In 2008, this insect was discovered damaging papayas in the Java region of Indonesia. In the same year, it was also found in India and Sri Lanka. Currently, it has spread throughout Taiwan and is rapidly spreading in Southeast Asia, including Thailand, Cambodia, and the Philippines.
[0014] The papaya mealybug is a piercing-sucking insect that feeds primarily on sap-rich parts of its host plant, such as stems, the undersides of leaves, flowers, and fruits. It also transmits viruses or injects toxins into the plant, causing leaves to wither and turn yellow, the plant to stunt, leaves to curl and deform, flowers and fruits to drop, and producing large amounts of honeydew that can lead to sooty mold, ultimately resulting in plant death. This insect reproduces sexually, completing up to 11 generations annually in India. Nymphs can migrate to neighboring plants by crawling, be passively dispersed by wind, or attach to clothing, equipment, or the bodies of animals. Given the high risk of transmission and the severity of its potential damage, the European Union has identified this insect as a potential quarantine pest, and targeted phytosanitary measures can reduce the risk of its introduction and spread.
[0015] The papaya mealybug, a rapidly spreading invasive pest, shows no significant genetic differentiation in its populations in Southeast Asia and the United States according to conventional mitochondrial molecular markers, indicating that the origin of its spread remains unclear, highlighting the limitations of traditional markers in tracing its source. This invention targets the papaya mealybug population in the United States, a key distribution area, and establishes a method for tracing and identifying the source of this insect by screening SNP markers in the population genome to analyze genetic differences. This provides a reference for port quarantine and control. Summary of the Invention
[0016] To address the shortcomings of existing population tracing technologies, this invention develops and applies a SNP molecular marker for tracing the US population of Paracoccus marginatus from its genome sequence. By sequencing the genomes of Paracoccus marginatus population samples from different geographical origins, a geographically specific SNP molecular marker for tracing the US population of Paracoccus marginatus is developed from comparative analysis of the genome sequence data. This marker serves as an identification indicator for its specific geographical population origin, forming a detection method applicable to tracing the US population.
[0017] To obtain the source SNP loci for the *Papaver rhoeas* population, this invention first performed whole-genome sequencing of the insect, providing a reference genome for screening SNP loci for population tracing. The whole genome was sequenced using next-generation sequencing technology, yielding a total sequencing volume of 750.18 G (after filtering), with an average coverage depth of 41.3X and an average alignment rate of 85.1% with the reference genome (GCA-900065295.1). Based on this, further sequencing was performed on 81 samples (including 19 mixed samples) from Guangdong, Yunnan, Hainan, Jiangxi, Fujian, Cambodia, and Mozambique (Table 1). Through bioinformatics analysis, one specific SNP marker and one pair of primers for detecting the *Papaver rhoeas* population from the United States were successfully screened and verified from approximately 299,423,000 SNP loci in each population's genome.
[0018] To achieve the above-mentioned objectives, this invention provides a molecular marker for tracing the origin of the Papaya Meat Scale population in the United States. For the US population, the 1356th base position on chromosome FIZT01001240.1 of the Papaya Meat Scale reference genome is A; the corresponding base position in non-US populations is not A.
[0019] Specifically, the bases at the corresponding loci from populations in Guangdong, Yunnan, Hainan, Jiangxi, Fujian, and Cambodia are G.
[0020] The present invention also provides detection primers for detecting the SNP molecular markers for population tracing of the aforementioned Papaya mealybug.
[0021] Specifically, the detection primers are: the sequence of the forward primer 1356-F is TCAGCACCACTTCACGTTCA, and the sequence of the reverse primer 1356-R is AGAGGTACAGGCAGCAGAAG.
[0022] This invention also provides the aforementioned SNP molecular markers for tracing the population of Papaya Meat Scale, and the application of the aforementioned detection primers in the tracing or identification of the geographical population of Papaya Meat Scale in the United States.
[0023] This invention also provides a method for tracing and detecting the population origin of Papaya mealybug, which includes the following steps: extracting genomic DNA from a single Papaya mealybug sample and amplifying it using the detection primers; sequencing or performing amplification peak diagrams based on the amplification products and determining the origin of the population to be tested by referring to the genotype of a specific population tracing site;
[0024] The test results show that if the 1356th base position on chromosome FIZT01001240.1 of the Papaya scabra reference genome is A, it indicates a US population; otherwise, it indicates a non-US population.
[0025] Specifically, the method for extracting genomic DNA from a single Papaya mealybug sample was performed using a kit suitable for micro-sample extraction.
[0026] More specifically, the amplification conditions were as follows: pre-denaturation at 94°C for 4 min before cycling; denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 30 s, 30 cycles, and a final extension at 72°C for 5 min. The system temperature was then lowered to 12°C to end the PCR amplification.
[0027] Specifically, for a 25µL amplification system, the concentration of genomic DNA was 10 ng / µL to 100 ng / µL, the template volume was 1µL, and the upstream and downstream primers were 0.3µL each with a concentration of 20µM.
[0028] In a specific implementation, the target region is determined on the sequencing peak map based on the flanking sequence (typically 10 bp) of the locus P shown in the amplification product, and the sample origin can be determined based on the SNP type. More specifically, by comparing the amplification peak map of the locus with the genotype of the locus in a US population, it can be determined whether the population being tested originated from the United States.
[0029] The SNP marker loci developed in this invention exhibit good genetic stability and reliable detection results. The peak diagram obtained after amplification using SNP marker primers accurately determines the population's affiliation and origin. Specifically, SNP (single nucleotide polymorphism) molecular markers are used. By collecting geographical population samples of *Papaver rhamnoides* from both domestic and international sources, population-specific SNP marker loci are screened from the sample genome sequencing sequences. A detection method for *Papaver rhamnoides* population SNP marker loci is established to identify the population origin of samples intercepted at ports. This invention and its application help clarify the population origin of intercepted *Papaver rhamnoides*, avoiding trade frictions that may result from misjudgments of the insect source, improving the targeting of port quarantine for imported beans, effectively ensuring the smooth conduct of international agricultural trade, and safeguarding national ecological and agricultural security. Attached Figure Description
[0030] Figure 1The verification sequence of the SNP at position 1356 of chromosome FIZT01001240.1 of the US population. Where position 1356 is 'a' representing the US population and 'g' representing a non-US population.
[0031] Figure 2 Verification and identification of the origin sites of the Papaya Starch Crab in the United States. Detailed Implementation
[0032] The present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the embodiments.
[0033] Unless otherwise specified, the experimental materials, reagents, instruments and methods used in the following examples are all conventional experimental materials, reagents, instruments and methods in the art, and can be purchased through commercial channels.
[0034] Example 1: Discovery of the source sites of the Papaya Mealybug population and design of primers.
[0035] 1. Sequencing of Papaya-type mealybug population samples for tracing its origin.
[0036] This invention sequenced the genomes of 81 samples from the *Papaya spp.* population (Table 1). The samples came from four countries: China, the United States, Cambodia, and Mozambique. The sequencing was performed in two batches by BGI Genomics Co., Ltd. (Shenzhen) and Novogene Biotechnology Co., Ltd. (Beijing). BGI Genomics completed 19 pooled samples (samples from the same sampling location were pooled to meet the DNA template requirements for library construction), while Novogene completed 62 samples. The data quality analysis of the constructed libraries is shown in Table 2.
[0037] Table 1. Information on the source of Papaya spp. sequencing samples
[0038]
[0039]
[0040] Table 2. Statistics on the quality of sequencing library construction data for Papaya spp.
[0041]
[0042]
[0043] Note: Samples with numbers starting with the letter M are from BGI sequencing results, where the numbers in parentheses indicate the number of mixed samples; the rest are from Novogene sequencing results.
[0044] Referring to the reference genome of *Papaya spp.*, SNP screening analysis was performed on the sequencing data of the above 81 geographical population samples of *Papaya spp.*. VCFtools software was used for SNP filtering, removing genotype-deleted sites and retaining sites with a quality value greater than 30. A total of 2,994,230 SNP sites related to population origin were screened. Based on this, focusing on Guangdong, Guangxi, Yunnan, Hainan, Jiangxi, Fujian, Cambodia, and the United States as population units, the optimal specific SNP site (100% specific SNP) at base 1356 of chromosome FIZT01001240.1 of the US population and its flanking sequences of approximately 300 bp (used for designing SNP site amplification primers) were further screened. Through site sequence amplification and verification, the SNP molecular markers of *Papaya spp.* originating from the US population were finally obtained, as shown in Table 3. Figure 1 As shown. Among them. Figure 1 The sequence is used for verification. It shows that in the SNP site, 'a' represents the US population and 'g' represents the non-US population. The upstream and downstream positions are marked with the positions corresponding to the designed primer sequences.
[0045] Table 3. Geographical population sample size and source SNP information of Papaya spp. in the United States
[0046]
[0047] The SNP traceability marker sites and their detection primers for the papaya mealybug population were thus established (4).
[0048] Table 4. Primer sequences for detecting SNP combination sites in the geographical population of Papaya pygmy centipede.
[0049]
[0050] Example 2: Application and Verification of SNP Molecular Markers for Population Tracing of Papaya Mealybug
[0051] Based on the source tracing detection sites (Table 3) and their detection primers (Table 4), genomic DNA was extracted from a single Papaya mealybug population sample that may cover the present invention; the population source tracing detection primers (Table 4) provided by the present invention were used to amplify (PCR) the sample sequence of the Papaya mealybug population to be tested.
[0052] The specific steps are as follows:
[0053] 1. Sample collection: The sample must be an insect or tissue whose DNA has not been degraded and which has not been infected by pathogens.
[0054] 2. Genomic DNA extraction
[0055] Use a commercial kit suitable for micro-sample extraction (such as QIAGEN's DNeasy Blood and Tissue Kit (50)) or other equivalent kits. Refer to the instructions for use for extraction method. Extract single worm bodies. Before eluting the DNA purified by the separation column, try to remove organic solvents such as alcohol. After elution, test the DNA concentration and quality of the solution.
[0056] 3. SNP source site sequence amplification
[0057] Based on the population samples to be tested, the SNP sites were amplified using the source primers in Table 2.
[0058] 1) Amplification system and conditions: The amplification system is prepared in 25µL as an example (Table 5). If the DNA template concentration is less than 10ng / µL, the amount of template should be increased appropriately.
[0059] Table 5. PCR reaction system mixtures and dosages for tracing source site sequences.
[0060]
[0061] The PCR reaction conditions were as follows: pre-denaturation at 94℃ for 4 min before cycling; denaturation at 94℃ for 30 s, annealing at 57℃ (depending on the specific primers) for 30 s, extension at 72℃ for 30 s, for 30 cycles; final extension at 72℃ for 5 min, and the system temperature was lowered to 12℃ to end PCR amplification.
[0062] 2) Sequencing of amplified products and determination of SNP sites
[0063] The amplified products are generally sent to a sequencing company for sequencing. The ab1 sequencing file is opened using SnapGene to find the flanking sequences of the SNPs. Based on the flanking sequences (usually 10 bp), the target region is determined on the sequencing peak diagram. The population origin of the sample can be determined based on the SNP type. Table 6 shows the verification of SNP source sites in the US population of *Papaya spp.*, and the peak diagram for verifying the site identification is shown below. Figure 2 As shown.
[0064] Table 6. Validation results of SNP detection sites for population tracing of Papaya mealybug.
[0065]
[0066] Note: Verification results: number of genotypes.
Claims
1. A detection primer for detecting a population traceable SNP molecular marker of Pseudaulacaspis pentagona, characterized in that, The detection primers are: the sequence of the forward primer 1356-F is TCAGCACCACTTCACGTTCA, and the sequence of the reverse primer 1356-R is AGAGGTACAGGCAGCAGAAG.
2. The application of the detection primers according to claim 1 in the source tracing or identification of the U.S. geographical population of Papaya spp. is used to identify the presence of a U.S. population in populations in the United States, Guangdong, Yunnan, Hainan, Jiangxi, Fujian and / or Cambodia.
3. A method for detecting the origin of a population of Pseudaulacaspis pentagona, characterized by, Includes the following steps: Genomic DNA was extracted from a single head of a papaya mealybug sample and amplified using the detection primers described in claim 1. The sequence or amplification peak diagram obtained by sequencing the amplification product was used to determine the origin of the population to be tested by referring to the genotype of the specific population source locus. The test results showed that if the base at position 1356 on chromosome FIZT01001240.1 of the Papaya scabra reference genome was A, it was a US population; otherwise, it was a non-US population. The corresponding base at the same position was G for populations from Guangdong, Yunnan, Hainan, Jiangxi, Fujian, and Cambodia.
4. The method of P. laevigata population source detection of claim 3, wherein, Genomic DNA was extracted from a single Papaya mealybug sample using a kit suitable for micro-sample extraction.
5. The method of P. laevigata population source detection of claim 4, wherein, Amplification conditions: Pre-denaturation at 94℃ for 4 min before cycling; denaturation at 94℃ for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 30 s, 30 cycles, final extension at 72℃ for 5 min, system temperature reduced to 12℃ to end PCR amplification.
6. The method for tracing and detecting the population of *Papaya scabra* as described in claim 4, characterized in that, The amplification system was prepared in 25 µL volumes. The concentration of genomic DNA was 10 ng / µL to 100 ng / µL, the template volume was 1 µL, and the upstream and downstream primers were 0.3 µL each with a concentration of 20 µM.
7. The method for tracing and detecting the population of *Papaya scabra* as described in any one of claims 3 to 6, characterized in that, The target region is determined on the sequencing peak map based on the flanking sequences of the site P shown in the amplification products, and the source of the sample can be determined based on the SNP type.
8. The method for tracing and detecting the population of *Papaya scabra* as described in claim 7, characterized in that, The target region is determined on the sequencing peak diagram based on the 10bp flanking sequence of the site P shown in the amplification product, and the sample origin can be determined based on the SNP type.
9. The method for tracing and detecting the population of Papaya spp. mealybug as described in claim 8, characterized in that, By comparing the amplification peaks at the aforementioned loci with the genotypes at those loci in the US population, it can be determined whether the population under test originated from the United States.
Citation Information
Patent Citations
Specific primer and detection method for identifying papaya mealybug
CN109609664A
Primer probe combination for detecting Pseudococcus Jracbeli
CN117512130A