CrRNA and kit for detecting African swine fever virus gene type I or type II

Abstract

The invention relates to crRNA for detecting an African swine fever virus gene type I or type II and a kit. The kit comprises crRNA-1 for detecting the African swine fever virus gene type I and crRNA-2 for detecting the African swine fever virus gene type II. And the like. The kit has high specificity on African swine fever virus gene type I and gene type II, has no cross reaction with porcine reproductive and respiratory syndrome virus, porcine parvovirus, porcine circovirus and porcine Delta coronavirus, has high detection sensitivity, and can detect 4 copies / [mu] L of ASFV gene type I plasmid and 2 copies / [mu] L of ASFV gene type II plasmid. The kit provided by the invention is simple to operate, does not need large-scale instruments and equipment, and can be used for detecting the African swine fever virus in a field environment; the whole detection process is completed within 40 minutes.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology technology, and in particular to the technical field of crRNA and kits for detecting African swine fever virus gene type I or type II. Background Art

[0002] African swine fever (ASF) is a highly lethal infectious disease caused by the African swine fever virus (ASFV), with a 100% mortality rate. Distinguishing between ASFV genotypes I and II is crucial in daily life. ASFV genotype I originated in Africa, while type II originated in Europe. In epidemic tracing, typing tests can accurately determine the virus's source and analyze its transmission path, providing key clues for prevention and control efforts. The significant differences in pathogenicity and environmental resistance between genotypes I and II allow for the development of more targeted and differentiated prevention and control strategies. Furthermore, continuous virus typing monitoring can keenly capture viral evolutionary trends and provide early warning of potential genetic recombination and drug resistance risks. In practical production, the results of ASFV genotype I and II typing tests can be used to implement precise culling strategies, rationally plan livestock recovery processes, and minimize economic losses.

[0003] Currently, in the absence of an effective vaccine, strict biosafety control measures can reduce the incidence of ASFV. However, the complex ASFV genotypes make ASFV diagnosis and control more difficult. Therefore, the development of a convenient and accurate ASFV detection method is crucial.

[0004] Currently, the main methods for detecting ASFV are real-time fluorescence quantitative PCR and enzyme-linked immunosorbent assay (ELISA). Real-time fluorescence quantitative PCR extracts viral DNA, designs and synthesizes primers and probes, and uses a quantitative PCR instrument for fluorescence quantification. This method is highly sensitive and reliable, but it has disadvantages such as the need for viral nucleic acid extraction and expensive instruments for detection, which limits its application in on-site detection. ELISA currently detects ASFV mainly through antigen-antibody reactions. This method saves time and is easy to operate, but it lacks specificity and sensitivity and is expensive. In summary, traditional ASFV detection methods require specific laboratories, expensive instruments, and professional personnel to implement, and cannot meet the needs of on-site detection at the front line of the epidemic. Summary of the Invention

[0005] The present invention is to solve the above-mentioned problems and defects, and provides a crRNA that can bind to the Cas12a protein and specifically target African swine fever virus gene type I and type II. The method of nucleic acid isothermal amplification and CRISPR / Cas12a is used to detect African swine fever virus, with good specificity and high sensitivity. 4 copies / μL of ASFV gene type I plasmid and 2 copies / μL of ASFV gene type II plasmid can be detected.

[0006] The present invention is implemented by adopting the following technical solutions.

[0007] A crRNA for detecting African swine fever virus genotype 1, wherein the crRNA is crRNA-1. The primers for detecting crRNA-1 are T7-F and T7-IR.

[0008] A kit for detecting African swine fever virus genotype I, comprising crRNA-1 and Cas12a protein.

[0009] A crRNA for detecting African swine fever virus genotype II, wherein the crRNA is crRNA-2. Primers for detecting crRNA-2 are T7-F and T7-II-R.

[0010] A kit for detecting African swine fever virus genotype II, comprising crRNA-2 and Cas12a protein.

[0011] In the kit of the present invention, the protein concentration of the Cas12a protein is 240nM or 280nM or 300nM or 350nM.

[0012] When the kit is used, the concentration ratio of Cas12a:crRNA is 4:1 or 5:1 or 2:1.

[0013] When the kit is used, the reaction temperature is 37°C or 42°C.

[0014] When the kit is used, the pH value of the reaction system is 7.5, 7.0 or 8.0.

[0015] If the kit of the present invention includes relevant reagents such as crRNA-1, crRNA-2, Cas12a protein, etc. at the same time, African swine fever virus genotype I and African swine fever virus genotype II can be detected at the same time.

[0016] The full detection process of the present invention includes three parts: viral nucleic acid lysis and release, isothermal amplification and CRISPR / Cas12a detection.

[0017] 1. Viral nucleic acid lysis and release (commercial reagent Zhuhai Huirui Biotechnology Co., Ltd.)

[0018] After dipping the sampling swab in the sample solution to be tested, place the swab in 1.5 mL of nucleic acid lysis buffer, mix up and down 5 to 10 times, and let it stand at room temperature for 2 to 5 minutes.

[0019] 2. Nucleic acid isothermal amplification (commercial reagent purchased from Jiangsu Anpu Future Biotechnology)

[0020] Table 1 Nucleic acid isothermal amplification components

[0021]

[0022] The above components were mixed thoroughly in a 0.2 mL tube and reacted at 37°C for 15 min.

[0023] 3. CRISPR / Cas12a detection (component of the kit of the present invention)

[0024] Table 2 CRISPR / Cas12a reaction system components

[0025]

[0026] Add the above components to a 0.2 mL tube and mix thoroughly to allow the protein to fully bind to the crRNA. Then add 5 μL of the isothermal amplification product, mix well, and react at 37°C for 15 minutes.

[0027] After the Cas12a detection system reaction is completed, equilibrate to room temperature, insert the bottom of the test strip into the Cas12a detection liquid, and observe the results after 5 minutes.

[0028] The present invention provides a crRNA and a kit for detecting African swine fever virus genotype I or II. The method uses nucleic acid isothermal amplification and CRISPR / Cas12a to detect African swine fever virus. The crRNA and kit are highly specific for African swine fever virus genotype I and genotype II, have no cross-reaction with porcine blue ear virus, porcine parvovirus, porcine circovirus, and porcine delta coronavirus, and have high detection sensitivity. 4 copies / μL of ASFV genotype I plasmid and 2 copies / μL of ASFV genotype II plasmid can be detected. The kit provided by the present invention is simple to operate, does not require large-scale instruments and equipment, and can be used to detect African swine fever virus in a field environment. The entire detection process is completed within 40 minutes.

[0029] The present invention will be further explained below with reference to the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 African swine fever virus detection operational flow chart.

[0031] Figure 2 Electrophoresis of the purified Lb-Cas12a protein (M represents protein Marker, from top to bottom are 250kDa, 150kDa, 100kDa, 70kDa, 50kDa, 40kDa, 30kDa, 20kDa, 15kDa and 10kDa, 1-6 protein lanes are TM Prime Plus protein purification machine).

[0032] Figure 3 Figure 2. Result of crRNA screening.

[0033] Figure 4 Effect of Cas12a protein concentration on the fluorescence intensity of the CRISPR / Cas12a detection system.

[0034] Figure 5 Effect of the ratio of Cas12a to crRNA on the fluorescence intensity of the CRISPR / Cas12a detection system.

[0035] Figure 6 Effect of temperature on the fluorescence intensity of CRISPR / Cas12a detection system.

[0036] Figure 7 Effect of pH on the fluorescence intensity of CRISPR / Cas12a detection system.

[0037] Figure 8 Isothermal amplification primer screening results for typing detection. (A) ASFV genotype I primer amplification; (B) ASFV genotype II primer amplification (horizontal axes 1, 2, and 3 represent F1 / R1, F2 / R2, and F3 / R3 amplification primers, and the vertical axis represents fluorescence intensity).

[0038] Figure 9 Genotype-specific test results. (A) ASFV genotype I test results; (B) ASFV genotype II test results (1-7 represent enzyme-free water, ASFV genotype I, ASFV genotype II, porcine reproductive and respiratory syndrome virus (PRRSV), porcine parvovirus, porcine circovirus, and porcine coronavirus, respectively).

[0039] Figure 10 ASFV genotype I test strip sensitivity test results. (A) From left to right, NC, 1, 2, 3, 4, and 5 represent blank control, 2 copies / μL, 4 copies / μL, 6 copies / μL, 8 copies / μL, and 10 copies / μL, respectively; (B) Fluorescence test results.

[0040] Figure 11ASFV genotype II test strip sensitivity test results. (A) From left to right, NC, 1, 2, 3, 4, and 5 represent blank control, 2 copies / μL, 4 copies / μL, 6 copies / μL, 8 copies / μL, and 10 copies / μL, respectively; (B) Fluorescence test results. DETAILED DESCRIPTION

[0041] The following examples are only a part of the technical solutions of the present invention and are not intended to limit the entire technical solutions of the present invention. The examples of the present invention are provided to further explain and illustrate the details of the technical solutions of the present invention.

[0042] Example 1 African swine fever virus detection kit composition

[0043] 1. CRISPR / Cas12a protein;

[0044] 2. crRNA-1, crRNA-2;

[0045] 3.F5Q (fluorescent probe) / F5B (test paper probe);

[0046] The CRISPR / Cas12a protein was obtained by expression and purification. The specific method is as follows:

[0047] The recombinant prokaryotic expression vector pET-28a / His-LbCas12a was cultured in Kan + Cultured overnight in resistant LB medium at 37°C and 180rpm, transferred to a 400mL LB flask medium at a ratio of 2% (volume ratio) and continued activation culture for 4 hours. Add 1mmol / L IPTG to induce expression for 4 hours. After the culture is completed, the bacterial pellet is obtained by centrifugation at 12000rpm for 10min and resuspended in bacterial lysis buffer at a ratio of 0.1g / mL. The obtained cell suspension is ultrasonically destroyed in an ice bath environment (power 0.2kw, ultrasound, pause time 5sec, 10sec respectively, total time 20min), followed by centrifugation of the lysate at 4°C and 10000rpm for 30min. The lysate supernatant is crudely separated by 5% and 55% saturation ammonium sulfate, and the enriched protein is finally dissolved in the binding buffer. After filtering through a 0.45μm sterile filter membrane, the sample is fully loaded onto the HisTrap of the AKTAPure protein purification system at a rate of 0.5mL / min. TM HP 1mL pre-packed column, and collect the flow-through peak effluent. Then use elution buffer to elute the target protein at a rate of 1mL / min, collect the elution peak and HisTrap TMHP 5mL prepacked column was used for ultrafiltration desalting. The purified protein was dialyzed and the protein concentration was determined using BCA protein quantification kit. The protein purification expression results are shown in Figure 2 shown.

[0048] Bacterial lysis solution: Tris 1.51 g, sodium chloride 14.61 g, dilute to 500 mL, adjust pH to 7.4, filter through a 0.45 μm sterile filter membrane, and store at room temperature.

[0049] Binding buffer: Tris 1.51 g, sodium chloride 14.61 g, imidazole 0.68 g, dilute to 500 mL, adjust pH to 7.4, filter with a 0.45 μm sterile filter membrane, and store at room temperature.

[0050] Elution buffer: Tris 1.51 g, sodium chloride 14.61 g, imidazole 34.04 g, dilute to 500 mL, adjust pH to 7.4, filter with a 0.45 μm sterile filter membrane, and store at room temperature.

[0051] Example 2 African swine fever virus detection kit crRNA synthesis

[0052] The crRNA primer sequences designed in Table 3 were synthesized by Shanghai Shenggong Bioengineering Co., Ltd. According to the instructions, the dry powder primers were diluted to 10 μM with enzyme-free water. Then, the primer PCR reaction was performed. When the PCR product concentration reached about 100 ng / μL, the primers were purified using HiScribe from New England Biolabs. TM T7Quick HighYield RNASynthesis Kit was used for T7 in vitro RNA transcription. The transcribed product was purified by RNAClean&Concentrator from ZYMO RESEARCH. TM -5 kit for RNA purification, and the concentration was measured using NanoDrop 2000. Finally, the crRNA used in the experiment was stored in a -80°C refrigerator.

[0053] Example 3crRNA activity screening

[0054] Protein detection system: Add 10 μL of Cas12a protein, 2.5 μL of crRNA, 2.5 μL of DTT, 5 μL of rCutsmart Buffer, 5 μL of ASFV nucleic acid, and 1 μL of F5Q fluorescent probe, and finally add enzyme-free water to the volume to 50 μL. After the detection system is prepared, centrifuge briefly and mix well in a desktop centrifuge, then use Molecular Devices' SpectraMax iD3 microplate reader, set the machine temperature to 37 ° C, and the time is 30 minutes (read fluorescence every two minutes, read 15 times), and calculate the intensity difference between the end point fluorescence value and the starting fluorescence value.

[0055] The results are as follows Figure 3 As shown, the experimentally designed and synthesized crRNA-1 and crRNA-2 had no cross-reaction in the negative reaction.

[0056] In the detection corresponding to crRNA-1, the crRNA-1 synthesized by primers T7-F / T7-IR can specifically target the ASFV genotype I virus, while the crRNA-1 synthesized by primers T7-F / T7-I-R1 can target the ASFV genotype I while also detecting genotype II; similarly, in the detection of ASFV genotype II, the crRNA-2 synthesized by T7-F / T7-II-R is better than T7-F / T7-II-R1.

[0057] In summary, crRNA-1 and crRNA-2 synthesized by the primer pairs T7-F / T7-IR and T7-F / T7-II-R were finally selected as the subsequent detection crRNAs for ASFV genotype I and genotype II.

[0058] Example 4 Optimization of protein concentration of African swine fever virus detection kit

[0059] Protein detection system 50 μL: dilute the reaction system Cas12a protein concentration to 50nM, 100nM, 150nM, 200nM, 240nM, 280nM, 300nM, 350nM, add 2.5μL of crRNA, 2.5μL of DTT, 5μL of rCutsmartBuffer, 5μL of ASFV nucleic acid, 1μL of F5Q fluorescent probe, and finally add enzyme-free water to the volume of 50μL. After the preparation of the detection system, centrifuge briefly and mix with a desktop centrifuge, and then use Molecular Devices' SpectraMax iD3 microplate reader, set the machine temperature to 37°C, the time is 30 minutes (read the fluorescence every two minutes, read 15 times), and calculate the intensity difference between the end point fluorescence value and the starting fluorescence value. The results are as follows Figure 4As shown, when the Cas12a protein concentration is 240 nM, the fluorescence difference is the largest, indicating that the optimal protein concentration is 240 nM.

[0060] Example 5 Optimization of the protein and crRNA ratio of the African swine fever virus detection kit

[0061] Protein detection system: Adjust the Cas12a:crRNA concentration ratio in the reaction system to 5:1, 4:1, 2:1, 1:1, 1:2, 1:4, add 10μL of Cas12a protein, 2.5μL of DTT, 5μL of rCutsmart Buffer, 5μL of ASFV nucleic acid, 1μL of F5Q fluorescent probe, and finally add enzyme-free water to the volume to 50μL. After the preparation of the detection system, centrifuge briefly and mix with a desktop centrifuge, then use Molecular Devices' SpectraMax iD3 microplate reader, set the machine temperature to 37°C, the time is 30 minutes (read the fluorescence every two minutes, read 15 times), and calculate the intensity difference between the end point fluorescence value and the starting fluorescence value. The results are as follows Figure 5 As shown, when the Cas12a protein concentration is 240nM and the crRNA concentration is 60nM, the fluorescence difference is the largest, indicating that the optimal reaction ratio of protein to crRNA is 4:1.

[0062] Example 6 Optimization of reaction temperature of African swine fever virus detection kit system

[0063] Protein detection system: Add 10 μL of Cas12a protein, 2.5 μL of crRNA, 2.5 μL of DTT, 5 μL of rCutsmart Buffer, 5 μL of ASFV nucleic acid, 1 μL of F5Q fluorescent probe, and finally add enzyme-free water to the volume of 50 μL. After the preparation of the detection system, centrifuge briefly and mix it in a desktop centrifuge, then use Molecular Devices' SpectraMax iD3 microplate reader, set the machine temperature to 25°C, 30°C, 37°C, 42°C, and 50°C, and the time is 30 minutes (read the fluorescence every two minutes, read 15 times), and calculate the intensity difference between the end point fluorescence value and the starting fluorescence value. The results are as follows Figure 6 As shown in the figure, the fluorescence difference is the largest when the incubation temperature is 37°C, and the optimal reaction temperature is 37°C.

[0064] Example 7 pH Optimization of African Swine Fever Virus Detection Kit

[0065] Protein detection system: Add 10 μL of Cas12a protein, 2.5 μL of crRNA, 2.5 μL of DTT, 5 μL of rCutsmart Buffer, 5 μL of ASFV nucleic acid, 1 μL of F5Q fluorescent probe, adjust the pH value to 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, and finally add enzyme-free water to the volume of 50 μL. After the preparation of the detection system, centrifuge briefly and mix with a desktop centrifuge, and then use the SpectraMax iD3 microplate reader from Molecular Devices, set the machine temperature to 37 ° C, the time is 30 minutes (read the fluorescence every two minutes, read 15 times), and calculate the intensity difference between the end point fluorescence value and the starting fluorescence value. The results are as follows Figure 7 As shown, when the pH value of the reaction system is 7.5, the fluorescence difference is the largest, indicating that the optimal pH value of the system is 7.5.

[0066] Example 8 Optimization of amplification primer sequences for African swine fever virus detection kit

[0067] Nucleic acid isothermal amplification system: add 29.4 μL of Abuffer, 2 μL of forward amplification primers (F1, F2, F3), 2 μL of reverse amplification primers (R1, R2, R3), 9.1 μL of enzyme-free water, 5 μL of ASFV nucleic acid, and 2.5 μL of B buffer.

[0068] Protein detection system: Add 10 μL of Cas12a protein, 2.5 μL of crRNA, 2.5 μL of DTT, 5 μL of rCutsmart Buffer, 5 μL of ASFV nucleic acid, and 1 μL of F5B test strip detection probe, and finally add enzyme-free water to the volume to 50 μL.

[0069] Test results such as Figure 8 As shown in the figure, the horizontal axes 1, 2, and 3 represent the F1 / R1, F2 / R2, and F3 / R3 amplification primers, and the vertical axis represents fluorescence intensity. A is the result of the screened genotype I amplification primers, and B is the result of the screened genotype II amplification primers. As can be seen from the figure, the three pairs of amplification primers have different amplification effects on ASFV genotype I and genotype II. For ASFV genotype I amplification, the second pair of amplification primers is the best, while for ASFV genotype II amplification, the first pair of amplification primers is obviously more effective than the other two pairs of primers.

[0070] Example 9 African swine fever virus kit specific detection

[0071] Protein detection system: Add 10 μL of Cas12a protein, 2.5 μL of crRNA, 2.5 μL of DTT, 5 μL of rCutsmart Buffer, 5 μL of nucleic acid, 1 μL of F5B test strip probe, and finally add enzyme-free water to the volume to 50 μL. The kit of the present invention was used to detect ASFV genotype I, genotype II, porcine blue ear virus (PRRSV), porcine parvovirus (PPV), porcine circovirus (PCV), and porcine Delta coronavirus. The test results are as follows: Figure 9 As shown, the kit provided by the present invention detects genotype I and genotype II ASFV present in the sample, and has no cross reaction to other viruses, indicating that the kit has good specificity.

[0072] Example 10 Sensitivity Detection of African Swine Fever Virus Kit

[0073] Protein detection system: Add 10 μL of Cas12a protein, 2.5 μL of crRNA, 2.5 μL of DTT, 5 μL of rCutsmart Buffer, 5 μL of ASFV nucleic acid, and 1 μL of F5B test strip probe, and finally add enzyme-free water to the volume to 50 μL. The kit of the present invention was used to detect 2, 4, 6, 8, and 10 copies / μL of ASFV standards. The test results are as follows: Figure 10 、 11 As shown in the figure, 4 copies / μL of ASFV genotype I plasmid and 2 copies / μL of ASFV genotype II plasmid can be detected, indicating that this kit has a high sensitivity.

[0074] In addition to the above technical solutions, the nucleic acid lysis reagent and nucleic acid isothermal amplification reagent mentioned in the present invention can be other commercially available similar products.

[0075] The key point of the present invention is that: the present invention has designed and synthesized crRNA-1 and crRNA-2 for the first time, which can specifically identify ASFV genotype I and genotype II strains. CRISPR / Cas12a forms a complex with the target DNA molecule under the guidance of crRNA. The complex cuts ssDNA labeled with different groups in the system, and the results can be presented in the form of fluorescence or test strips, with high sensitivity and strong specificity.

[0076] 1.ssDNA probe sequence:

[0077] F5Q (fluorescent probe): FAM-TTATT-BHQ1

[0078] F5B (test strip probe): FAM-TTATT-Biotin

[0079] 2. Primer sequences

[0080] Table 3 ASFV genotype I and II detection crRNA primer sequences

[0081]

[0082] Table 4 Isothermal amplification primer sequences for ASFV genotype I and II detection

[0083]

[0084] 3. ASFV genotype I strain vector insertion sequence crRNA-1 (2042bp):

[0085] GACGAATATTCTTAATCCCCGCAAATTACTTTTTTTTAGGTACTGTAACGCAGCACAGCTGAACCGTTC

[0086] TGAAGAAGAAGAAAGTTAATAGCAGATGCCGATACCACAAGATCAGCCGTAGTGATAGAACCCACGT

[0087] AATCCGTGTCCCAACTAATATAAAATTCTCTTGCTCTGGATACGTTAATATGACCACTGGGTTGGTATTC

[0088] CTCCCGTGGCTTCAAAGCAAAGGTAATCATCATCGCACCCGGATCATCGGGGGTTTTTAATTGCATTGCC

[0089] TCCGTAGTGGAAGGGTATGTAAGAGCTGCAGAACTTTGATGGAAACTTATCGATAAGATTGATACCAT

[0090] GAGCAGTTACGGAAATGTTTTTAATAATAGGTAATGTGATCGGATACGTAACGGGGGCTAATATCCGATAT

[0091] AGATGAACATGCGTCTGGAAGAGCTGTATCTCTATCCTGAAAGCTTATCTCTGCGTGGTGAGTAGGCT

[0092] GCATAATGGCGTTAACAACATGTCCGAACTTGTGCCAATCTCGGTGTTGATGAGGATTTTGATCGGAG

[0093] ATGTTCCAGGTAGGTTTTAATCCTATAAACATATATTCAATGGGCCATTTAAGAGCAGACATTAGTTTTT

[0094] CATCGTGGTGGTTATTGTTGGTGTGGGTCACCTGCGTTTTATGGACACGTATCAGGGAAAATCGAACG

[0095] CGTTTTACAAAAAGGTTGTGTATTTCAGGGGTTACAAACAGGTTATTGATGTAAAGTTCATTATTCGTG

[0096] AGCGAGATTTCATTAATGACTCCTGGGATAAACCATGGTTTAAAGCGTATATTGCGTCTACTGGGGCGT

[0097] CCAGGTATAAAACGCGACTGGCGTATAAAAAGTCCAGGAAATTCATTCACCAAATCCTTTTGCGATGC

[0098] AAGCTTTATGGTGATAAAGCGCTCGCCGAAGGGAATGGATACCGAGGGAATAGCAAGGTTCACGTTC

[0099] TCGTTAAACCAAAAGCGCAGCTTAATCCAGAGCGCAAGAGGGGGCTGATAGTATTTAGGGGTTTGAG

[0100] GTCCATTACAGCTGTAATGAACATTACGTCTTATGTCCAGATACGTTGCGTCCGTAATAGGAGTAATATC

[0101] TTGTTTACCTGCTGTTTGGATATTGTGAGAGTTCTCGGGAAAATGTTGTGAAAGGAATTTCGGGTTGGT

[0102] ATGGCTGCACGTTCGCTGCGTATCATTTTCATCGGTAAGAATAGGTTTGCTTTGGTGCGGCTTGTGCAA

[0103] ATCATGAATGTTGCATAGGAGAGGGCCACTAGTTCCCTCCACCGATACCTCCTGGCCGACCAAGTGCT

[0104] TATATCCAGTCATTTTATCCCCTGGGATGCAAAATTTGCGCACAAGCGTTGTGACATCCGAACTATATTC

[0105] GTCCAGGGAATTTCCATTTACATCGAATCTTACGTTTTCATAAAGTCGTTCTCCGGGGTATTCGCAGTA

[0106] GTAAACCAAGTTTCGGTACGCATTCTTTGTGCCGGGTACAATAGGTCTTCCAAAGGGATCTACAAGCG

[0107] TGTAAACGGCGCCCTCTAAAGGTGTTTGGTTGTCCCAGTCATATCCGTTGCGAGGAAACGTTTGAAGC

[0108] TGACCATGGGCCCCCATCTGGGCCGTGCCCTGAATCGGAGCATCCTGCCAGGACGAATGACATGCAC

[0109] CCAATATATGGTGGCCCACCATATCATGGAAAAAGTCTCCGTACTGGGGAATACCAAAGGTAAGCTTG

[0110] TTTCCCAAGGTGGGGGTACCCGTATGCGGGCGTACTTTATTGTATTCAAACCCTACTGGAACATAAGGC

[0111] TTAAAATGCGCATTAAAATGAACCAAATGTGTTTCTTCGATTTGACTCAAAGTGGGTTCGGGGTCGGG

[0112] TTTCCCATAACTTTTGTTCACATTTTTAATGTTAGAAATCCTGCTATTAAGCAAGTCTTGGGCCAATATA

[0113] ATCTTGTCGGCCTTCCCATCGTTAGCAATAAGACAAAAAGCTCCTCCTGATGCCATATATAATGTTATAA

[0114] AAATAATTTATTGTTTTTATTAAATATGGCGGTTTATGCGAAGGATCTTGAT

[0115] 4. Insertion sequence crRNA-2 (2213bp) of ASFV genotype II strain vector:

[0116] GAAGCCCACAGATCGAACCCATTGTGTTCATTTTTTTTAAAGATGAAGATTTTTTAGATGATTTTTTTTA

[0117] GTTTTTTAAAAGACGAAAAAATTTTTTAAAAGATGAATATTCTTAAACCCCGCAAATTACTTTTTTTTA

[0118] GGTACTGTAACGCAGCACAGCTGAACCGTTCTGAAGAAGAAGAAAGTTAATAGCAGATGCCGATACC

[0119] ACAAGATCAGCCGTAGTGATAGACCCCACGTAATCCGTGTCCCAACTAATATAAAATTCTCTTGCTCTG

[0120] GATACGTTAATATGACCACTGGGTTGGTATTCCTCCCGTGGCTTCAAAGCAAAGGTAATCATCATCGCA

[0121] CCCGGATCATCGGGGGTTTTAATCGCATTGCCTCCGTAGTGGAAGGGTATGTAAGAGCTGCAGAACTT

[0122] TGATGGAAATTTATCGATAAGATTGATACCATGAGCAGTTACGGAAATGTTTTTAATAATAGGTAATGTG

[0123] ATCGGATACGTAACGGGGCTAATATCAGATATAGATGAACATGCGTCTGGAAGAGCTGTATCTCTATCC

[0124] TGAAAGCTTATCTCTGCGTGGTGAGTGGGCTGCATAATGGCGTTAACAACATGTCCGAACTTGTGCCA

[0125] ATCTCGGTGTTGATGAGGATTTTGATCGGAGATGTTCCAGGTAGGTTTTAATCCTATAAACATATATTCA

[0126] ATGGGCCATTTAAGAGCAGACATTAGTTTTTCATCGTGGTGGTTATTGTTGGTGTGGGTCACCTGCGTT

[0127] TTATGGACACGTATCAGCGAAAAGCGAACGCGTTTTACAAAAAGGTTGTGTATTTCAGGGGTTACAAA

[0128] CAGGTTATTGATGTAAAGTTCATTATTCGTGAGCGAGATTTCATTAATGACTCCTGGGATAAACCATGG

[0129] TTTAAAGCGTATATTGCGTCTACTGGGGCGTCCAGCTATAAAACGTGACTGGCGTACAAAAAGTCCAG

[0130] GAAATTCATTCACCAAATCCTTTTGCGATGCAAGCTTTATGGTGATAAAGCGCTCGCCGAAGGGAATG

[0131] GATACTGAGGGAATAGCAAGGTTCACGTTCTCATTAAACCAAAAGCGCAACTTAATCCAGAGCGCAA

[0132] GAGGGGGCTGATAGTATTTAGGGGTTTGAGGTCCATTACAGCTGTAATGAACATTACGTCTTATGTCCA

[0133] GATACGTTGCGTCCGTGATAGGAGTAATATCTTGTTTACCTGCTGTTTGGATATTGTGAGAGTTCTCGG

[0134] GAAAATGCTGTGAAAGAAATTTCGGGTTGGTATGGCTACACGTTCGCTGCGTATCATTTTCATCGGTAA

[0135] GAATAGGTTTGCTTTGGTGCGGCTTGTGCAAATCATGAATGTTGCATAGGAGAGGGCCACTGGTTCCC

[0136] TCCACCGATACCTCCTGGCCAACCAAGTGCTTATATCCAGTCATTTTATCCCCTGGGATGCAAAATTTG

[0137] CGCACAAGCGTTGTGACATCCGAACTATATTCGTCTAGGGAATTTCCATTTACATCGAATCTTACGTTTT

[0138] CATAAAGTCGTTCTCCGGGGTATTCGCAGTAGTAAACCAAGTTTCGGTACGCATTCTTTGTGCCGGGTA

[0139] CAATGGGTCTTCCAAAAGGATCTACAAGCGTGTAAACGGCGCCCTCTAAGGGTGTTTGGTTGTCCCAG

[0140] TCATATCCGTTGCGAGGAAACGTTTGAAGCTGCCCATGGGCCCCCATCTGGGACGTGCCCTGAATCGG

[0141] AGCATCCTGCCAGGATGAATGACATGCACCCAATATATGATGGCCCACCATATCATGGAAAAAGTCTCC

[0142] GTACTGGGGAATACCAAAGGTAAGCTTGTTTCCCAAGGTGGGGGTACCCGTATGCGGGCGTACTTTAT

[0143] TGTATTCAAACCCTACTGGAACATAAGGCTTAAAATGCGCATTAAAATGCACCAAATGTGTTTCTTCGA

[0144] TTTGACTCAAAGTGGGTTCGGGATCGGGTTTCCCATAACTTTTGTTCACATTTTTAATGTTAGAGATCC

[0145] TGCTATTCAGCAAGTCTTGGGCCAATATAATCTTGTCGGCCTTCCCATCGTTAGCAATAAGACAAAAAG

[0146] CTCCTCCTGATGCCATATATAATGTTATAAAAATAATTTATTGTTTTTATTAAATATGGCGGTTTATGCGAA

[0147] GGATCTTGATAATAACAAAGAGTTAAACCAAAAATTAATTAACGATCAGCTTAAAATTATTGACACGCT

[0148] CTTGCTGGCAG

[0149] 5. The biological samples and experimental operations involved in the process of this invention were all carried out in a biosafety level 3 laboratory, and the waste generated during the experiment was handled in accordance with relevant regulations.

[0150]

[0151]

[0152] The above are only some specific embodiments of the present invention. The specific contents or common knowledge known in the scheme are not described in detail here (including but not limited to abbreviations, abbreviations, and units commonly used in the art). It should be pointed out that the above embodiments do not limit the present invention in any way. For those skilled in the art, any technical solution obtained by equivalent replacement or equivalent transformation falls within the scope of protection of the present invention. The scope of protection claimed in this application shall be based on the content of its claims, and the specific implementation methods and other records in the specification can be used to interpret the content of the claims.

Claims

1. A crRNA for detecting African swine fever virus genotype I, characterized in that The crRNA is crRNA-1.

2. The primer for detecting the crRNA according to claim 1, characterized in that The primers are T7-F and T7-IR.

3. A kit for detecting African swine fever virus genotype I, characterized in that: The kit includes crRNA-1 and Cas12a protein.

4. A crRNA for detecting African swine fever virus genotype II, characterized in that The crRNA is crRNA-2.

5. The primer for detecting the crRNA according to claim 3, characterized in that The primers are T7-F and T7-II-R.

6. A kit for detecting African swine fever virus genotype II, characterized in that: The kit includes crRNA-2 and Cas12a protein.

7. The kit according to claim 3 or 6, characterized in that The protein concentration of the Cas12a protein is 240nM or 280nM or 300nM or 350nM.

8. The kit according to claim 3 or 6, characterized in that When the kit is used, the concentration ratio of Cas12a:crRNA is 4:1 or 5:1 or 2:

1.

9. The kit according to claim 3 or 6, characterized in that When the kit is used, the reaction temperature is 37°C or 42°C.

10. The kit according to claim 3 or 6, characterized in that When the kit is used, the pH value of the reaction system is 7.5, 7.0 or 8.0.

Images