Application of small-molecule inhibitor targeting ZNF24 in preparation of antitumor drugs

Abstract

The invention provides an application of a targeted ZNF24 inhibitor in preparation of antitumor drugs, and belongs to the technical field of medical treatment. According to the invention, on the basis of a protein structure of ZNF24, a computer virtual drug screening technology is utilized, and small molecules with relatively high scores are screened out from a biological activity screening library Bioactive Screening Libraries. The binding capacity of the small-molecule inhibitor and ZNF24 protein is determined through a surface plasmon resonance technology, and finally, it is determined that the small-molecule inhibitor has a remarkable anti-tumor effect on KRAS mutant lung cancer cells through a series of in-vivo and in-vitro anti-tumor activity experiments. The small-molecule inhibitor is expected to be used as a lead compound for treating lung cancer tumors with KRAS mutation and ZNF24 abnormal expression.

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to the use of small molecule inhibitors targeting ZNF24 in the preparation of anti-tumor drugs. Background Art

[0002] ZNF24, also known as zinc finger protein 24, was first discovered in 1998. Knockout of ZNF24 leads to premature death at various points during development, suggesting that ZNF24 plays a key role in regulating organ development. ZNF24 has been shown to play distinct roles in different cancer types, suggesting that it is a pleiotropic transcription factor. For example, in liver cancer cells, ZNF24 directly binds to the CTNNB1 promoter, activating the expression of β-catenin and its downstream target gene, cyclin D1, and promoting cell proliferation. ZNF24 is upregulated in prostate cancer and promotes epithelial-to-mesenchymal transition through Twist1. In gastric cancer, microRNA-940 inhibits ZNF24 expression and promotes malignant cell proliferation. In breast cancer, EZH2 negatively regulates ZNF24 to promote VEGF expression. As a transcription factor regulating tumor growth and proliferation, no studies have yet linked it to tumor PD-L1 expression and immune evasion. If the hypothesis in this study is confirmed, it will be a breakthrough in the study of ZNF24 in tumor immune evasion.

[0003] Previous research results have shown that both ZNF24 and SLC7A5 are highly expressed in KRAS-mutated lung adenocarcinoma. ZNF24 and SLC7A5 are two new genes downstream of the RAS / MEK / ERK pathway, and ZNF24 can upregulate SLC7A5 expression at the protein level. In addition, studies have shown that SLC7A5 is positively correlated with PD-L1 expression in breast cancer. In lung adenocarcinoma, KRAS mutations inhibit CD8 in the tumor microenvironment through the ZNF24 / SLC7A5 / PD-L1 axis. + T cell activity, promoting tumor immune escape, and inhibiting ZNF24 can downregulate SLC7A5 and PD-L1 expression, thereby enhancing CD8 + T cell activation hinders immune escape in KRAS-mutant lung adenocarcinoma. Therefore, ZNF24 is theoretically a potential target for tumor therapy. However, there are currently no commercially available anti-ZNF24 drugs. The development of ZNF24 inhibitors is expected to provide new treatment options for addressing clinical challenges such as immunotherapy resistance in KRAS-mutant lung adenocarcinoma. Summary of the Invention

[0004] In order to solve the above technical problems, the present invention aims to provide an inhibitor targeting ZNF24 for use in the preparation of anti-tumor drugs.

[0005] The first aspect of the present invention provides a small molecule inhibitor targeting ZNF24, the name of the small molecule inhibitor is daptomycin, English name: Daptomycin, English abbreviation DAPT. CAS number: 103060-53-3, molecular formula: C 72 H 101 N 17 O 26 , molecular weight: 1620.67. The specific structural formula is shown on the APExBIO official website, Catalog No. A1206, https: / / www.apexbio.cn / daptomycin.html .

[0006] The second aspect of the present invention provides the use of the small molecule inhibitor targeting ZNF24 in the preparation of a drug for treating tumors with high ZNF24 expression, such as lung cancer.

[0007] The third aspect of the present invention provides a drug for treating lung cell carcinoma, wherein the active ingredient of the drug is the ZNF24 small molecule inhibitor daptomycin.

[0008] Furthermore, the medicine also includes pharmaceutical excipients.

[0009] Furthermore, the drug preparation forms include injections, tablets, capsules, aerosols, suppositories, films, controlled release or sustained release or nano preparations.

[0010] Beneficial effects of the present invention:

[0011] Based on the ZNF24 protein structure, the present invention uses a virtual drug screening platform to screen small molecule compounds from bioactive screening libraries. Bioactive screening libraries are readily available chemical libraries used for drug discovery, laboratory drug screening, drug target identification, and other pharmaceutical applications. Highly-scoring small molecules are screened for experimental validation. The binding ability of the small molecule inhibitors to ZNF24 is verified using SPR. A series of in vitro and in vivo experiments confirm that the small molecule inhibitors can effectively inhibit tumor growth, ultimately achieving an anti-tumor effect.

[0012] The present invention combines computer simulation screening with experiments to quickly and effectively screen small molecule inhibitors against ZNF24, shortening the experimental cycle. The screened inhibitor has been confirmed to have significant anti-tumor activity against ZNF24 mutated lung cancer cells through in vitro and in vivo experiments, and is a potential promising drug for the treatment of lung cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The results of computer simulation docking between daptomycin (DAPT) and ZNF24 molecules;

[0014] Figure 2 This is the SDS-PAGE identification image of ZNF24 after prokaryotic expression and purification;

[0015] Figure 3 The affinity determination curve and fitting curve of ZNF24 protein and DAPT;

[0016] Figure 4 Western blot was used to detect the expression changes of ZNF24, SLC7A5 and PD-L1 in lung cancer cells after adding DAPT;

[0017] Figure 5 CCK-8 was used to detect the killing ability of DAPT on ZNF24 abnormal lung cancer cells;

[0018] Figure 6 The cell scratch assay was used to detect the changes in the migration ability of lung cancer cells after the addition of DAPT;

[0019] Figure 7 The clone formation experiment was used to detect the changes in the number of lung cancer cell colonies formed after the addition of DAPT;

[0020] Figure 8 Transwell assay was used to detect changes in the invasion ability of lung cancer cells after the addition of DAPT;

[0021] Figure 9 The in vivo mouse transplant tumor experiment was used to detect the growth changes of lung cancer transplant tumors after injection of DAPT. DETAILED DESCRIPTION

[0022] In order to more clearly understand the above-mentioned objects, features and advantages of the present invention, the solutions of the present invention will be further described below. It should be noted that, in the absence of conflict, the embodiments of the present invention and the features therein can be combined with each other.

[0023] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein; it is obvious that the embodiments in the specification are only part of the embodiments of the present invention, not all of the embodiments.

[0024] In the following examples, experimental methods without specific conditions and reagents without formulas were all based on conventional conditions.

[0025] Example 1 Computer simulation screening of small molecule inhibitors targeting ZNF24

[0026] (1) ZNF24 crystal structures were screened from the PDB protein database, with human proteins being selected, with a preference for crystal structures with higher resolution. The ZNF24 protein crystal structure was then optimized using software DS, with water molecules and ligand molecules removed, and hydrogenation and charge addition performed to obtain a ZNF24 protein structure that was close to in vivo activity. Computer simulations were then performed to predict the surface binding sites of the ZNF24 protein, identifying the "molecular pocket" where drugs bind to the ZNF24 protein.

[0027] (2) Use the computer LibDock module to simulate the screening of small molecule compounds in the small molecule compound database. Small molecule compound database: Use the Bioactive Screening Libraries (https: / / www.apexbt.com / screening-library) to screen small molecule compounds.

[0028] (3) Finally, 15 small molecules that can dock with ZNF24 and their corresponding scores are obtained, see Table 1. Binding energy represents the energy change between the protein receptor and the small molecule ligand before and after docking. The smaller the binding energy (i.e., the larger the absolute value), the greater the energy reduction, indicating that the structure of the protein receptor after binding with the small molecule ligand is more stable. 1-3 small molecules with low binding energy and high comprehensive scores are selected as candidate molecules for computer molecular simulation docking. Among them, daptomycin (DAPT) has a low binding energy and the highest LibDock score. After reviewing the literature, it was found that DAPT is not currently used in lung cancer. Therefore, DAPT was first selected for three-dimensional docking with the spatial structure of ZNF24 protein (using AutoDockTools-1.5.7 software for molecular simulation docking); the docking results showed that ZNF24 can specifically bind to DAPT (see Appendix). Figure 1 ), the above results show that DAPT can specifically bind to the target protein ZNF24 in computer simulation docking. Based on this, the best candidate small molecule inhibitor for ZNF24 protein was determined to be Daptomycin (DAPT).

[0029] Table 1. Results of docking ligands using LibDock

[0030]

[0031]

[0032] Example 2 SPR determination of the binding ability of ZNF24 protein and small molecule inhibitors

[0033] (1) To further verify the authenticity of the computer-simulated docking results through experiments, the present invention used surface plasmon resonance technology (SPR) to verify the binding activity of DAPT and ZNF24. First, the CDS sequence of the ZNF24 gene (GenBank ID: NM_006965.4) was chemically synthesized into the pET-28a prokaryotic expression vector (completed by Kunming Qingke Biological Co., Ltd.), the constructed ZNF24 clone plasmid was transformed into Escherichia coli DH5α and streaked. The LB / Kana culture dish was inverted and placed in a 37° constant temperature incubator overnight. Then, a single clone was picked for amplification and the plasmid was extracted using the plasmid extraction kit (DP103, see the instructions for specific steps) from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0034] (2) Take one BL21 (DE3) competent cell (purchased from Kunming Qingke Biotechnology Co., Ltd.) and melt it on ice, add 2 μL of ZNF24 expression plasmid, and let it stand on ice for 30 minutes. Heat shock at 42°C for 60 seconds, transfer to ice, and let it stand for 2.5 minutes. Add 700 μL of sterile LB liquid medium without antibiotics to the centrifuge tube, mix well, and place it in a shaker for 60 minutes (37°C, 200 rpm). Pipette 200 μL of the recovery solution and add it to the LB solid medium containing 50 μg / mL kanamycin resistance. Place the culture dish upside down in a constant temperature incubator at 37°C and culture overnight. Pick out the single colony that has grown the next day for PCR identification.

[0035] (3) Use a 10 μL pipette tip to pick a single colony from the LB medium, dissolve it in 20 μL ddH2O, and use it as a PCR template. The PCR amplification system was added in the following volume: 2 μL ZNF24 template, 0.25 μL rTaq DNA polymerase, 2.5 μL 10× PCR buffer, 2 μL dNTP Mixture, 1 μL T7F primer (TAATACGACTCACTATAGGG), 1 μL T7R primer (GCTAGTTATTGCTCAGCGG), 16.25 μL ddH2O; PCR reaction conditions were: 94°C for 5 min; (94°C for 50 s; 55°C for 1 min; 72°C for 45 s; 30 cycles) 72°C for 10 min. Agarose gel electrophoresis confirmed that the recombinant expression bacteria had been successfully constructed.

[0036] (4) Take 10 μL of bacterial solution and add it to 2 mL of LB / Kana medium. Shake the bacterial solution at 37°C and 200 rpm until OD 600 is between 0.5 and 0.8. Inoculate the bacterial solution into 100 mL of LB / Kana medium at a ratio of 1:100 and culture at 37°C and 200 rpm for 5 h. Then add IPTG to induce protein expression. The induction conditions are 37°C, 4 h, 200 rpm. SDS-PAGE is used to identify the expression of the target protein. (5) Collect the bacteria from the previous step by centrifugation, add 17 mL of PBS, resuspend the bacteria on ice for 10 min, and centrifuge at 12000 rpm for 15 min. Discard the supernatant, collect the bacteria and weigh them. Add an appropriate amount of PBS at a ratio of 30 mL of bacterial lysis solution per gram of bacteria, resuspend on ice for 10 min, and ultrasonically disrupt on ice for 30 min (ultrasonication power 60%, ultrasonication 5 s, interval 5 s). Collect the supernatant and precipitate separately. 30 mL of inclusion body washing solution containing 1% (V / V) Triton X-100 was added to each gram of precipitate, incubated on ice for 10 minutes, centrifuged at 12000 rpm for 15 minutes, and the precipitate was collected again. The inclusion body precipitate was resuspended with 30 mL of PBS per gram and centrifuged at 12000 rpm for 5 minutes to obtain the washed inclusion bodies. The obtained inclusion bodies were purified by HisPur TM The eluted ZNF24 protein was identified by SDS-PAGE. The identification results are shown in the attached figure. Figure 2 .

[0037] (6) The ZNF24 protein obtained by expression and purification was commissioned to Beijing Biopsies Biotechnology Co., Ltd. for SPR identification together with the purchased small molecule inhibitor daptomycin (purchased from MCE, product number: HY-B0108). The ZNF24 protein was fixed using a CM5 chip, and then DAPT was diluted 20 times with a dilution reagent to change its DMSO content from 100% to 5%. DAPT was diluted 2 times with running reagent 1. The diluted DAPT was injected into the experimental channel and the reference channel respectively, and the binding and dissociation times were corresponding. The binding and dissociation steps were all performed in running reagent 1. The results showed that when the DAPT concentration was 3.906-62.5μM, it specifically bound to the target protein with an affinity of 1.48×10 -5 μM (see attached Figure 3 ).

[0038] Example 3: ZNF24 small molecule inhibitors affect the expression of ZNF24 downstream proteins

[0039] Lung cancer cell lines H2122 and H358 (both purchased from the Shanghai Cell Bank, Chinese Academy of Sciences) were cultured in T75 flasks and co-cultured with the tumor cells in the presence of 20 μM DAPT for 48 hours. Total protein was extracted from each group and measured using a BCA protein quantification kit (purchased from Beyotime Biotechnology Co., Ltd., Cat. No. P0012S). 50 μg of total protein from each group was separated by 12% SDS-PAGE gel electrophoresis and transferred to polyvinylidene fluoride (PVDF) using semi-dry electrophoresis. The cells were then blocked with a blocking buffer containing 5% skim milk powder for 2 hours at room temperature. The cells were incubated with anti-ZNF24 antibodies (Proteintech, Catalog No. 11219-1-AP), SLC7A5 antibodies (Santa Cruz, Catalog No. sc-374232), and PD-L1 antibodies (Abcam, Catalog No. Ab213524) as primary antibodies for 2 hours at room temperature. Horseradish Peroxidase (HRP)-conjugated goat anti-rabbit IgG / goat anti-mouse IgG (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.) were then incubated for 2 hours at room temperature. Finally, bands were visualized by enhanced chemiluminescence (ECL) with β-actin as an internal control.

[0040] WB results showed that DAPT had no effect on the expression of ZNF24 protein itself, but could downregulate the expression of SLC7A5 and PD-L1 proteins. The results are shown in the attached Figure 4 The above results show that DAPT can downregulate the expression of SLC7A5 and PD-L1 proteins by inhibiting the activity of ZNF24.

[0041] Example 4 In vitro experiments to determine the anti-tumor activity of daptomycin in ZNF24-abnormal lung adenocarcinoma

[0042] (1) CCK8 assay for the killing ability of DAPT on tumor cells: Lung cancer cell lines H2122 and H358 cells and normal lung epithelial cells Beas2b (purchased from the cell bank of Kunming Institute of Zoology, Chinese Academy of Sciences) were prepared into single cell suspensions, with 5×10 3 Cells were seeded in a 96-well plate and co-cultured with the tumor cells in 20 μM DAPT for 72 hours. The volume per well was 200 μl. A zero well was set up with culture medium added only without cells. Three replicate wells were set up for each group and each time point. 10 μL of CCK-8 reaction solution (Biyuntian Biotechnology Co., Ltd., Cat. No. C0037) was added to each well and incubated at 37°C for 60 minutes. The absorbance of each well at a wavelength of 450 nm was measured with a microplate reader at 24, 48, and 72 hours. Cell proliferation curves were then plotted using Prism 8.0.

[0043] CCK-8 results showed that DAPT could significantly inhibit the proliferation of lung adenocarcinoma cells, but had little effect on the proliferation of normal lung epithelial cells (Appendix Figure 5 ).

[0044] (2) Cell scratch assay to detect the effect of DAPT on the migration ability of tumor cells: Lung cancer cell lines H2122 and H358 cells and normal lung epithelial cells Beas2b were prepared into single cell suspensions, and 5×10 5 The cells were plated in a 6-well plate, 20 μM DAPT was added and co-cultured with the above tumor cells for 48 hours, and then placed in a 37°C, 5% CO2 cell culture incubator for overnight culture. After 48 hours, when the cell fusion rate reached 100%, the cells were taken out and scratched vertically with a 200ul pipette tip in a clean bench. The healing of the cells after scratching was observed under a microscope at 0 hours, 24 hours, and 48 hours, and photos were taken. The results showed that DAPT could inhibit the lateral migration of lung adenocarcinoma cells at 48 hours (see Figure 2). Figure 6 ).

[0045] (3) Plate cloning experiment to detect the effect of DAPT on the proliferation ability of tumor cells: lung cancer cell lines H2122 and H358 cells and normal lung epithelial cells Beas2b were made into single cell suspensions, and inoculated into 6-well plates with a density gradient of 500 cells, respectively. Each sample was repeated 3 times. 20μM DAPT was added and co-cultured with the above tumor cells for 2 weeks. The culture was terminated when visible clones appeared. The cells were rinsed with PBS buffer, fixed with methanol, and stained with Giemsa stain. The number of clones larger than 50 cells was counted under a microscope to calculate the clone formation rate. Clone formation rate (%) = number of clones / number of inoculations × 100%

[0046] The results showed that DAPT could significantly inhibit the proliferation of lung adenocarcinoma cells (Appendix Figure 7 ).

[0047] (4) Transwell assay to detect the effect of DAPT on the invasive ability of tumor cells: One day before the experiment, a tube of Matrigel (purchased from Corning) was placed in a 4°C refrigerator overnight from -20°C, and the Matrigel melted from a solid state to a liquid state. Hydration of basement membrane: Add 50 μL of 10 g / L BSA serum-free culture medium to each well, 37°C, 30 min. Coating of basement membrane: Aspirate the culture medium in the upper chamber, dilute the Matrigel at 1:8, and add 100 ul of the diluted Matrigel to each upper chamber to coat the upper chamber surface of the bottom membrane of the transwell chamber. Incubate at 37°C for 1 hour to solidify the gel. Conventional trypsin was used to digest cells (lung cancer cell lines H2122 and H358 cells and normal lung epithelial cells Beas2b), wash 1-2 times with PBS to remove the influence of serum, resuspend the cells in serum-free culture medium, and adjust the cell density to 5×10 5 100 μL of cell suspension was added to the upper chamber of the Transwell chamber, and 600 μL of 10% FBS culture medium was added to the lower chamber of the 24-well culture plate. Be careful not to generate bubbles between the lower culture medium and the chamber. The culture plate was placed in a 37°C CO2 incubator, and 20 μM DAPT was added and co-cultured with the above tumor cells for 48 hours. The chamber was removed, the liquid in the upper chamber was aspirated and discarded, and the cells were rinsed twice with PBS. The cells in the upper layer of the microporous membrane of the chamber were carefully wiped off with a cotton swab, and fixed with methanol for 30 minutes in a 24-well plate. Stain with 0.5% crystal violet solution for 15 minutes. Photographs were taken under an inverted microscope. Ten fields of view were randomly counted for each sample, and the average value was calculated for statistical analysis.

[0048] The results of Transwell experiments revealed that DAPT can effectively inhibit the invasion of tumor cells (Appendix Figure 8 ).

[0049] The above results show that DAPT has significant anti-tumor activity against KRAS mutant lung adenocarcinoma cells in vitro.

[0050] Example 5 In vitro assay to determine the antitumor activity of daptomycin in ZNF24-abnormal lung adenocarcinoma

[0051] (1) Twenty 3-4 week old female C57BL / 6 mice (immune-competent mice) were purchased from SPIEF (Beijing) Biotechnology Co., Ltd. and fed under SPF conditions for 3-4 days.

[0052] (2) Mouse Lewis lung cancer cells (LLC) purchased from Hunan Fenghui Biological Company were cultured and expanded to a certain number, and then the cells were digested and counted according to the cell passaging method.

[0053] (3) Use a 1 mL empty needle to inoculate 2 × 10 6cells, about 200 μL cell suspension. After 8 days, 18 mice developed tumors, 2 did not, and 3 of them had smaller tumors and were not included in the random group samples. Finally, 15 mice with tumors of similar size were randomly assigned to 3 groups for subsequent experiments.

[0054] (4) When the tumor grows to 100 mm 3 According to the experimental design, the experiment was divided into PBS group, DAPT group (25 mg / kg), and RGD-KGH-R1scFv group (30 mg / kg, KRAS inhibitor group, positive control). The drugs were administered every other day by multi-point intratumoral injection. The changes in the mouse tumor were recorded with a vernier caliper before administration.

[0055] (5) After 14 days, the mice were killed by cervical dislocation, the tumors were separated, and photos were taken. The tumor weight and tumor volume (tumor volume = long diameter × short diameter) were calculated. 2 ×1 / 2), and Prism 8.0 was used to plot the changes in tumor size and weight.

[0056] The results showed that: From the gross observation of the tumor, it was clear that the tumor volume in the DAPT group was significantly smaller than that in the PBS group. The experimental results showed that DAPT could significantly inhibit the growth of KRAS mutant lung adenocarcinoma transplanted tumors in vivo. (Appendix Figure 9 ).

Claims

1. Application of an inhibitor targeting ZNF24 in the preparation of an anti-tumor drug, characterized in that: The inhibitor targeting ZNF24 is daptomycin, English name: Daptomycin. CAS number: 103060-53-3, molecular formula: C 72 H 101 N 17 O 26 , molecular weight: 1620.

67.

2. The antitumor drug according to claim 1, characterized in that The anti-tumor drug also includes pharmaceutically acceptable excipients or carriers.

3. The antitumor drug according to claim 1, characterized in that The tumor is a tumor with abnormal expression of ZNF24.

4. The antitumor drug according to claim 3, characterized in that The tumor is lung cancer.

Images