Debaryomyces hansenii engineering bacterium as well as construction method and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to a debaryomyces hansenii engineering bacterium as well as a construction method and application thereof. According to the invention, on the basis of wild debaryomyces hansenii, GAL4 coding is ineffective to obtain an engineering bacterium; it is found that the thallus biomass of the engineering bacterium Dh delta GAL4 is remarkably improved compared with that of wild debaryomyces hansenii. The invention provides a debaryomyces hansenii engineering strain, and provides a new strategy for low-cost and efficient industrial production of microbial protein. Meanwhile, the invention also discloses a new function of the GAL4 gene in microbial biomass regulation and control, and provides a new gene modification target for developing high-yield single-cell protein industrial strains.

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and in particular relates to an engineered strain of Debaryomyces hansenii, a construction method thereof, and an application thereof. Background Art

[0002] Livestock and poultry manure, with its high organic matter content, represents a carbon source with significant potential. Anaerobic fermentation, converting it into clean energy sources such as methane and hydrogen, is an effective means of reducing livestock and poultry manure and utilizing it as a resource. However, while achieving waste reduction and biogas / biogas production, this also produces large amounts of biogas slurry, which is high in ammonia and nitrogen.

[0003] The high ammonia nitrogen content and low carbon-nitrogen ratio in biogas slurry limit its utilization by microorganisms. While some technologies utilize microorganisms to process biogas slurry and produce single-cell protein, these still suffer from drawbacks such as long fermentation times, low ammonia nitrogen utilization rates, and low single-cell protein production or yields, making them difficult to put into practical production applications. In their prior patent, "An Alkali-Resistant Yeast and Its Application in Producing Single-Cell Protein from Biogas Slurry," the inventor's research team proposed a strain of Debaryomyces hansenii that can assimilate biogas slurry ammonia nitrogen to produce single-cell protein. However, this is still some distance from commercial application, and further increases in bacterial biomass are needed.

[0004] Therefore, if the Debaryomyces hansenii can be improved in a targeted manner and an engineered strain of Debaryomyces hansenii that can more efficiently utilize ammonia nitrogen to produce bacterial proteins is provided, it will have good application prospects. Summary of the Invention

[0005] The purpose of the present invention is to provide an engineered strain of Debaryomyces hansenii and a construction method and application thereof.

[0006] To achieve the above object, the technical solution adopted by the present invention is: the transcription factor GAL4 is obtained by making the original transcription factor GAL4 coding ineffective, and the nucleotide sequence of the original transcription factor GAL4 is shown in SEQ ID No: 1.

[0007] Accordingly, the DNA encoding the transcription factor GAL4 according to claim 1.

[0008] Correspondingly, a recombinant plasmid containing nucleotides expressing the corresponding amino acids of the transcription factor GAL4. Correspondingly, an expression plasmid containing the DNA.

[0009] Accordingly, the transcription factor GAL4 or the DNA is used to improve ammonia nitrogen utilization and / or microbial biomass and / or bacterial protein production of a microorganism, and the microorganism is Debaryomyces hansenii.

[0010] Correspondingly, an engineered bacterium of Debaryomyces hansenii is obtained by making the original transcription factor GAL4 coding ineffective or knocking out the transcription factor GAL4 coding gene on the basis of the wild-type Debaryomyces hansenii. The wild-type Debaryomyces hansenii was deposited in the China General Microbiological Culture Collection on July 15, 2021, and the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is: CGMCC No. 22903; or; a strain of Debaryomyces hansenii is obtained by replacing the original transcription factor GAL4 in Debaryomyces hansenii with the transcription factor GAL4.

[0011] Accordingly, the use of the engineered Debaryomyces hansenii in biogas slurry treatment or ammonia nitrogen treatment involves inoculating the engineered Debaryomyces hansenii into the biogas slurry to be treated or the ammonia nitrogen environment to be treated. Alternatively, the use of the engineered Debaryomyces hansenii in producing bacterial protein may be described.

[0012] The present invention has the following beneficial effects: Based on the wild-type Debaryomyces hansenii, the present invention disables normal translation of the GAL4 encoding gene, thereby obtaining the engineered bacterium DhΔGAL4. DhΔGAL4 significantly increases the biomass of the bacterium compared to the wild-type Debaryomyces hansenii. This invention provides a new engineered strain of Debaryomyces hansenii, offering a new strategy for low-cost, efficient industrial production of microbial proteins. Furthermore, this invention reveals a new function of the GAL4 gene in regulating microbial biomass, providing a new genetic modification target for the development of high-yield single-cell protein industrial strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Schematic diagram of the structure of the CRISPR / Cas9 gene editing vector pBP9-GAL4 for GAL4;

[0014] Figure 2 This is the gel electrophoresis image after BbsI digestion of BP9;

[0015] Figure 3 This is the gel electrophoresis diagram of the positive transformants verified by colony PCR;

[0016] Figure 4 This is the sequencing peak diagram of the CRISPR / Cas9 gene editing vector pBP9-GAL4 of GAL4;

[0017] Figure 5 This is the gel electrophoresis image of the sgRNA target sequence region of the PCR-amplified gene GAL4;

[0018] Figure 6 This is the peak diagram of sequencing after CRISPR editing;

[0019] Figure 7 Schematic diagram of the growth curves of wild-type Debaryomyces hansenii and engineered bacteria DhΔGAL4. DETAILED DESCRIPTION

[0020] The present invention provides a novel engineered strain of Debaryomyces hansenii. Wild-type Debaryomyces hansenii was deposited with the China General Microbiological Culture Collection on July 15, 2021, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 22903. This strain is also disclosed in the inventors' group's prior patent CN 113913309B.

[0021] On the basis of the wild-type Debaryomyces hansenii, the original transcription factor GAL4 coding gene is knocked out, or the original transcription factor GAL4 coding is rendered ineffective, to obtain the engineered bacteria. The original transcription factor GAL4 coding failure refers to the inability of the GAL4 gene to normally translate to obtain the corresponding protein, or the protein obtained after translation loses its original normal function; specifically, it can be achieved by knocking out one or some coding bases in GAL4 to terminate the translation early, or it can be achieved by directly knocking out all the GAL4 coding genes. In the embodiment of the present invention, the 163rd base of the GAL4 coding gene is taken as an example to prepare the engineered bacteria. The present invention found that compared with the wild type, the engineered bacteria can more efficiently utilize the ammonia nitrogen in the biogas slurry, increase the bacterial biomass, and obtain bacterial protein.

[0022] The following will be combined with the accompanying drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, rather than all embodiments. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Where not otherwise specified, the data obtained are the average values ​​obtained after at least 3 repetitions, and all the data obtained in each repetition are valid data.

[0023] Example 1: Construction of Debaryomyces hansenii engineered bacteria

[0024] 1. Construct a CRISPR / Cas9 gene editing vector for GAL4. The vector structure is as follows Figure 1 As shown, the specific construction process is as follows:

[0025] (1) Use the EuPaGDT online tool (http: / / grna.ctegd.uga.edu / ) to design the knockout target site; enter the GAL4 gene nucleotide sequence (SEQ ID NO: 1) on the website to generate a 20 bp sgRNA target sequence T1. The T1 sequence is as follows:

[0026] T1: 5'-AATGGAGACCTCACTGTACG-3' (SEQ ID NO: 2)

[0027] The target sequence T1 was used to fill in the sticky ends formed by BbsI digestion of the BP9 plasmid to generate the corresponding oligo sequences GAL4-F (SEQ ID NO: 3) and GAL4-R (SEQ ID NO: 4), as follows:

[0028] GAL4-F: 5'-TGCGCAGAATGGAGACCTCACTGTACG-3'

[0029] GAL4-R: 5'-AAACCGTACAGTGAGGTCTCCATTCTG-3'

[0030] The above GAL4-F and GAL4-R sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (hereinafter referred to as "Sangon Biotech"), and the synthesized GAL4-F and GAL4-R primers were dissolved in water to 100 μM respectively.

[0031] (2) Preparation of oligo dimers: Prepare an annealing reaction system (upstream primer GAL4-F 5 μL, downstream primer GAL4-R 5 μL, ddH2O 40 μL); after all components are mixed, centrifuge instantly, place in 100°C water and cool naturally to renature, and then obtain oligo dimers.

[0032] (3) Preparation of CRISPR / Cas9 linear vector backbone: Use BbsI restriction endonuclease to digest the BP9 plasmid and recover the linear vector backbone.

[0033] The BP9 plasmid refers to Pug6-pTEF1-Cas9-tCYC1-gRNA. The construction process can be found in the literature "A CRISPR / Cas9 method facilitates efficient oligo-mediated gene editing in Debaryomycetes shansenii", DOI10.1093 / synbio / ysab031. The overall construction method is as follows: the two major components of the CRISPR system are the Cas9 protein expression element (pDHTEF1-Cas9-tCYC1) and the sgRNA expression element (pSCR1-tRNA Gly-trac RNA-PolyT). The promoter of the Cas9 gene was determined to be TEF-1, derived from Debaryomyces hansenii, and the terminator was CYC1, derived from Saccharomyces cerevisiae. The Cas9 gene (without introns) was derived from the plasmid Peft-3::Cas9-SV40_NLS::tbb-2_3'UTR (Addgene#46168). The promoters of the sgRNA expression cassette were selected as SCR1 and tRNA Gly Synthetic promoter, terminator is poly-T. The backbone of Escherichia coli and yeast shuttle vectors is pUG6, which contains ampicillin resistance and G418 resistance genes. For the Debaryomyces hansenii in the present invention, the specific construction process has some changes: First: the backbone plasmid of Escherichia coli and yeast shuttle vectors is pUG6, purchased from Miaoling Biology (https: / / www.miaolingbio.com / plasmid / P0104); Second: the promoter of the Cas9 gene is TEF-1, which is derived from the wild-type Debaryomyces hansenii used in the present invention. Specific operations involved: Using a yeast genomic DNA extraction kit, the genomic DNA of Debaryomyces hansenii was extracted, and the promoter pTEF1 was obtained by PCR amplification using pTEF1-KpnI-F and pTEF1-EcoRI-R as primers.

[0034] SEQ ID NO: 5, pTEF1-KpnI-F (origin: D. hansenii):

[0035] 5'-AGAGCAGATTGTACTGAGAGTGCACGGTACCACAGCCATAACAACATATAGATACA-3'

[0036] SEQ ID NO: 6, pTEF1-EcoRI-R (origin: D. hansenii):

[0037] 5'-CGTGAATGTAAGCGTGACATAACTAATTACATGATTTGCTTAAT-3'

[0038] Prepare the enzyme digestion reaction system on ice (BbsI 1μL, FastDigest Green Buffer 2μL, BP9 plasmid (647ng / μL) 1.54μL, ddH2O 15.46μL), gently pipette to mix, centrifuge briefly, incubate at 37℃ for more than 6h, and recover the vector backbone (large fragment) according to the instructions of the AxyPrep DNA gel recovery kit after agarose gel electrophoresis to obtain the CRISPR / Cas linear vector backbone. The gel electrophoresis image after BbsI digestion of BP9 is shown in the figure below. Figure 2 shown. Figure 2 From left to right are wells 1 to 8; Well 1: The band sizes of Marker 10000 are 100bp, 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, 3000bp, 5000bp, and 10000bp, respectively; Wells 2 to 7: BP9 after enzyme digestion, the vector backbone band size after enzyme digestion is 9448bp; Well 8: Marker 15000.

[0039] (4) Constructing the oligo dimer into the CRISPR / Cas9 linear vector backbone: Prepare the ligation reaction system on ice (0.61 μL CRISPR / Cas9 linear vector backbone, 0.22 μL oligo dimer, 2 μL 10×T4 DNA ligase buffer, 0.5 μL T4 DNA ligase, and finally add ddH2O to 20 μL), mix well, centrifuge instantly, incubate at 37°C overnight, and inactivate at 65°C for 10 min.

[0040] (5) Transform the above reaction system into Escherichia coli: take out the competent E. coli cells E. coli DH5α (Beijing Qingke Biotechnology Co., Ltd.) from the -80℃ freezer and place them on ice to melt; take 50μL of competent cells, add 5μL of the reaction system prepared in step (4), mix gently, and incubate on ice for 30min; then place in a 42℃ water bath, heat shock for 45s, and immediately place on ice to cool for 2-3min; then add 800μL of antibiotic-free LB liquid culture medium, shake and culture in a constant temperature shaker (37℃, 200rpm) for 1h, centrifuge at 5000rpm for 5min, and discard part of the supernatant; resuspend the bacteria with the remaining 100μL culture medium, gently spread it evenly on an LB plate containing 100μg / mL ampicillin with a sterile spreading stick, and culture in an inverted manner at 37℃ incubator until colonies appear.

[0041] Single colonies of correct morphology and size were selected and transferred to LB liquid medium containing 100 μg / mL ampicillin. After culturing until turbidity, colony PCR was performed to amplify the portion containing the sgRNA expression element. The PCR reaction system was 25 μL, including 12.5 μL of 2×PCR Mix, 1 μL of bacterial cells, 0.5 μL of upstream primer GAL4-F, 0.5 μL of downstream primer T7 promoter-pre-cut-R, and 10.5 μL of ddH2O. The PCR reaction conditions were as follows: 94°C for 2 min; 35 cycles of 94°C for 30 s, 69°C for 30 s, and 72°C for 68 s; and 72°C for 2 min. The upstream primer GAL4-F (SEQ ID NO: 3) and the downstream primer T7 promoter-pre-cut-R (SEQ ID NO: 7) for colony PCR were as follows:

[0042] GAL4-F: 5'-TGCGCAGAATGGAGACCTCACTGTACG-3'

[0043] T7 promoter-pre-cut-R: 5'-GAGACCGGCAGATCCGCGGC-3'

[0044] The PCR products were subjected to agarose gel electrophoresis, and the results were as follows Figure 3 As shown in the figure, wells 1 to 6 are shown from left to right. Well 1: Marker 2000 bands are sized 100bp, 250bp, 500bp, 750bp, 1000bp, and 2000bp, respectively; well 2 is blank; wells 3 to 6: PCR-amplified regions containing the sgRNA expression element. The results indicate that the bands in wells 3 to 5 are of the correct size.

[0045] The bacterial solution of the positive band was sent to Sangon Biotech for Sanger sequencing, and the positive strains were obtained by sequencing screening. The sequencing peak diagram of the GAL4 gene editing vector is shown in the figure. Figure 4 The results showed that the sequencing was correct and the GAL4 gene editing vector was successfully constructed.

[0046] (6) Extract the plasmid and obtain the CRISPR / Cas9 gene editing vector pBP9-GAL4 for GAL4: Take the positive bacterial solution, shake the bacteria, and extract the plasmid (according to the instructions of the OMEGA plasmid extraction kit), and successfully obtain the CRISPR / Cas9 gene editing vector pBP9-GAL4 for GAL4.

[0047] 2. Prepare Debaryomyces hansenii competent cells. The specific process is as follows:

[0048] Wild-type Debaryomyces hansenii was streaked on a YPD plate, and a single colony was picked and inoculated into a test tube containing 5 mL of YPD liquid medium. The culture was cultured overnight at 30°C and 180 rpm until the bacterial solution became turbid. 50 μL of the bacterial solution was inoculated into a 250 mL Erlenmeyer flask containing 50 mL of YPD liquid medium and cultured overnight at 28°C and 180 rpm until the OD 600Once the pH reaches 0.6-1.0, immediately cool rapidly in an ice-water mixing bath for 10 minutes. Centrifuge the cell suspension at 10,000 g for 3 minutes at 4°C, and discard the supernatant. Gently resuspend the pellet in 40 mL of 50 mM PB cell wash buffer (PB cell wash buffer, prepared fresh: 50 mM phosphate buffer (PB), pH 7.5. Before use, add 1 mL of 1 M DTT solution, pH 7.5, to every 40 mL of PB buffer). Incubate at 28°C for 20 minutes, inverting several times. Wash the cells twice with 40 mL of sterile ddH2O and resuspend in 1 mL of pre-chilled 1 M sorbitol. Centrifuge the cell suspension at 10,000 g for 3 minutes at 4°C, aspirate the supernatant with a pipette, and discard. Resuspend the cells in pre-chilled 1 M sorbitol to obtain Debaryomyces hansenii competent cells.

[0049] 3. Electroporation of the GAL4 CRISPR / Cas9 gene editing vector into Debaryomyces hansenii: The plasmid of the GAL4 gene editing vector constructed in step 1 was electroporated into the competent cells of Debaryomyces hansenii from step 2. The specific process of electroporation is as follows: add 1 μg of plasmid to a 1.5 mL pre-cooled centrifuge tube, then add 80 μL of competent cells and let it stand for 5 minutes. Transfer the mixture to a pre-cooled 2 mm electroporation cuvette (BioRad), insert the electroporation chamber, cover it, and immediately perform electroporation at 2.3 kV using a MicroPulser electroporator (BioRad). After a single electroporation, quickly and gently resuspend the cells in 800 μL of pre-chilled resuspension solution (90 mL of resuspension YPD medium: 1 g yeast extract, 2 g peptone, 18.2 g sorbitol, dilute to 90 mL, and sterilize at 115°C for 20 min. Resuspension solution: resuspension YPD medium and 20% glucose in a 9:1 volume ratio). Transfer the culture to a clean 1.5 mL centrifuge tube and incubate at 28°C for 0.5–1 h, inverting the tube several times to mix thoroughly. Centrifuge the culture at 10,000 g for 1 min, discard the supernatant with a pipette, add 100 μL of sterile YPD medium, vortex thoroughly, and gently spread 40 μL onto a YPD selection plate containing G418 resistance. Incubate the plate upside down at 28°C until colonies appear.

[0050] YPD screening plates (450 mL) were prepared by adding glucose before use: 5 g yeast powder, 10 g peptone, and 27.3 g sorbitol, and the volume was adjusted to 450 mL. 90 mL of the liquid was dispensed into 250 mL Erlenmeyer flasks, and 1.5 g agar powder was added per 100 mL. The plates were sterilized by autoclaving at 115°C for 20 min. The plates were melted by microwave before use, cooled to approximately 70°C, and 10 mL of 20% glucose was added per 90 mL. The plates were mixed thoroughly. At temperatures below 60°C, 400 μL of G418 sulfate stock solution (100 mg / mL) was added to a final concentration of 400 mg / L. The plates were then mixed thoroughly and poured onto the plates.

[0051] 4. Obtaining and identifying GAL4 knockout strains: Pick a single colony from the screening plate and culture it in 1.5 mL of YPD liquid medium containing G418 resistance for 2 days. Design and verify primers GAL4-YF and GAL4-YR, PCR amplify the sgRNA target sequence region of the GAL4 gene, and obtain gene knockout yeast after verification by Sanger sequencing. The sequences of the verification primers GAL4-YF and GAL4-YR are as follows:

[0052] GAL4-YF:5'-ACACCCTTATAGAGCAAGCATG-3'(SEQ ID NO: 8)

[0053] GAL4-YR:5'-CGAGTACGATGGTGACTGGG-3' (SEQ ID NO: 9)

[0054] After culturing for 2 days, the yeast was centrifuged at 5000 rpm for 5 minutes, and the bacterial pellet was lysed by alkaline lysis and used as a PCR template. The PCR reaction system was: 25 μL, including 12.5 μL of 2×PCR Mix, 2 μL of bacterial lysate, 0.5 μL of upstream primer GAL4-verification F, 0.5 μL of downstream primer GAL4-verification R, and 9.5 μL of ddH2O. PCR reaction conditions: 94°C for 2 minutes; 94°C for 30 seconds, 59°C for 30 seconds, 72°C for 16 seconds, 35 cycles; 72°C for 2 minutes. The PCR products were subjected to agarose gel electrophoresis, and the results were as follows: Figure 5 As shown. From left to right are wells 1 to 9. Well 1: Marker2000 band sizes are 100bp, 250bp, 500bp, 750bp, 1000bp, and 2000bp; Wells 2 to 8: PCR amplified GAL4 target sequence region; Well 9: CK. PCR products with correct band sizes, clear and clean, and no extraneous bands were sent to Sangon Biotechnology for Sanger sequencing. Sequencing peak diagram after CRISPR editing, as shown Figure 6 The results showed that base A at the sgRNA target sequence was successfully knocked out, as shown in Table 1.

[0055] Table 1 Comparison of wild-type and ΔGAL4 sequences

[0056] strain sequence wild type CCACGTACAGTGAGGTCTCCATT DhΔGAL4 CCACGT-CAGTGAGGTCTCCATT

[0057] The sequencing results were compared with the target gene sequence, and samples in which the bases at the target sequence were sheared and the number of sheared bases was not 3N were cultured and stored in a -80°C refrigerator to obtain the engineered Debaryomyces hansenii: GAL4 knockout strain DhΔGAL4.

[0058] Example 2: Growth performance of engineered Debaryomyces hansenii

[0059] The wild-type Debaryomyces hansenii and the GAL4 knockout strain DhΔGAL4 were taken from the -80℃ freezer, activated by streaking on YPD plates, and single colonies were picked and inoculated into a 20mL conical flask of YPD medium. The culture was cultured overnight at 28℃ and 180rpm until the bacterial solution became turbid to obtain the first-level seed solution. The first-level seed solution of the two bacteria was adjusted to OD using sterile YPD medium. 600 The value was 0.85, and the secondary seed solution was obtained. The secondary seed solution was inoculated into the chicken manure biogas slurry culture medium at a 10% (v / v) inoculation rate, and cultured at 28°C and 200 rpm for 72 hours. Each group was repeated 3 times.

[0060] Chicken manure biogas slurry was obtained from a biogas project in Shandong Province, ultrafiltered, and stored in a refrigerator at 4°C. Preparation of the chicken manure biogas slurry culture medium: Sterilize chicken manure biogas at 115°C for 20 minutes. Add the sterilized biogas slurry, sterile water, and glucose according to the specific ammonia nitrogen concentration and C / N ratio, and adjust the pH to the appropriate level with sulfuric acid. Unless otherwise specified, the ammonia nitrogen concentration is 1400 mg / L, the glucose is 16 g / L, the pH is 7.5, and the C / N ratio is 4.57.

[0061] During the above culture process, the absorbance of wild-type Debaryomyces hansenii and DhΔGAL4 at a wavelength of 600 nm was measured at regular intervals using a microplate reader (the results were averaged), and growth curves were drawn. The results are shown in FIG. Figure 7 The results showed that the knockout strain DhΔGAL4 grew faster in chicken manure slurry medium than the wild type. After 72 hours of fermentation, the dry weight (DCW) of the cells was determined by drying and weighing, and the results are shown in Table 2.

[0062] Table 2 Comparison table of bacterial dry weight

[0063] repeat Wild-type bacterial dry weight DhΔGAL4 bacterial dry weight Repeat 1 5.26g / L 7.16g / L Repeat 2 5.26g / L 7.16g / L Repeat 3 5.20g / L 6.73g / L

[0064] The results showed that the biomass of DhΔGAL4 was 30% to 40% higher than that of the wild type.

[0065] Example 3: Demonstration of the ability of engineered Debaryomyces hansenii to utilize biogas slurry

[0066] The fermentation substrate in this embodiment is the chicken manure biogas slurry liquid culture medium of Example 2, but the ammonia nitrogen concentration and the like are adjusted accordingly according to the requirements of each group. If there are no special requirements, the same as in Example 2.

[0067] 1. Effect of inoculation age on single-cell protein production. Seeds of the GAL4 knockout strain DhΔGAL4 were taken from a -80°C freezer, activated by streaking on YPD plates, and single colonies were picked and inoculated into 5 mL YPD medium test tubes. The culture was cultured overnight at 28°C and 180 rpm until the bacterial solution became turbid to obtain the primary seed solution. The primary seed solution was inoculated into YPD medium at a 0.05% (v / v) inoculum and cultured at 28°C and 200 rpm for 12 h, 14 h, 16 h, 18 h, 20 h, 22 h, and 24 h, respectively, to obtain the secondary seed solution. The secondary seed solution was inoculated into chicken manure biogas slurry culture medium at a 10% (v / v) inoculum and cultured in a shaker at 28°C and 200 rpm for 72 h. After 72 h of culture, the pH, DCW, residual ammonia nitrogen content, and reducing sugar (glucose) content were measured. Each group was repeated 3 times, and the results were averaged. The results are shown in Table 3.

[0068] Table 3 Growth of DhΔGAL4 at different inoculation ages

[0069] Vaccination age (h) After the incubation, pH DCW(g / L) Reducing sugar (g / L) Residual ammonia nitrogen (mg / L) 12 7.01 7.71 0.00 492.21 14 8.19 8.34 0.00 331.01 16 8.29 8.89 0.00 277.71 18 8.14 8.86 0.02 293.42 20 8.22 8.68 0.01 288.40 22 8.26 8.60 0.00 314.45 24 8.29 8.75 0.00 300.51

[0070] Table 3 shows that when the seed inoculation age is less than 16 hours, the DCW of DhΔGAL4 in chicken manure biogas slurry medium increases with increasing inoculation age. However, when the inoculation age is greater than 16 hours, the DCW shows a flat or decreasing trend with increasing inoculation age. This indicates that when the inoculation age is 16 hours, the DhΔGAL4 seed inoculation has a moderate cell count and is in an active growth and metabolic phase, making it best adapted to the biogas slurry growth environment and achieving the highest fermentation biomass.

[0071] 2. Effect of pH on Single-Cell Protein Production. The initial pH of the chicken manure biogas slurry culture medium was adjusted to 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, and 9.0 using H2SO4. 16-hour-old seed liquid was inoculated at a 10% (v / v) inoculum into the chicken manure biogas slurry culture medium at each pH. The cultures were shaken at 28°C and 200 rpm for 72 hours. The results are shown in Table 4.

[0072] Table 4 Growth of DhΔGAL4 at different pH

[0073] Initial pH After the incubation, pH DCW(g / L) Reducing sugar (g / L) Residual ammonia nitrogen (mg / L) 5.5 7.37 4.30 0.00 897.21 6.0 7.36 4.52 0.00 866.42 6.5 7.91 6.57 0.00 543.56 7.0 8.06 7.61 0.00 301.98 7.5 8.19 8.69 0.00 224.03 8.0 8.55 6.74 0.00 658.04 8.5 9.07 0.32 8.25 1026.68 9.0 9.22 0.34 8.75 1089.05

[0074] As can be seen from Table 4, DhΔGAL4 has difficulty tolerant to highly alkaline biogas slurry at pH 8.5 and above, and an overly acidic environment is not conducive to its growth. When the initial pH is 7.5, the DCW content is the highest.

[0075] 3. Effect of Ammonia Nitrogen Concentration on Single-Cell Protein Production. The C / N ratio of the chicken manure biogas slurry culture medium was controlled at 4.57. The initial ammonia nitrogen concentration was adjusted to 800 mg / L, 1000 mg / L, 1200 mg / L, 1400 mg / L, 1600 mg / L, 1800 mg / L, 2000 mg / L, and 2200 mg / L (the amount of glucose in each group was adjusted accordingly to control the C / N ratio). The initial pH was adjusted to 7.5 with H2SO4. 16-hour-old seed liquid was inoculated at a 10% (v / v) inoculum into each of the chicken manure biogas slurry cultures with different ammonia nitrogen concentrations. The cultures were shaken at 28°C and 200 rpm for 72 hours. The results are shown in Table 5.

[0076] Table 5 Growth of DhΔGAL4 under different ammonia nitrogen concentrations

[0077]

[0078] Table 5 shows that DhΔGAL4 has difficulty tolerant to high ammonia nitrogen biogas concentrations of 2000 mg / L and above. At 800 mg / L, ammonia nitrogen utilization efficiency reached a maximum of 98.59%. At 1400 mg / L, DCW reached its highest level, at 8.86 g / L.

[0079] 4. Effect of C / N Ratio on Single-Cell Protein Production. In a chicken manure biogas slurry culture medium containing 1400 mg / L ammonia nitrogen, the C / N ratio was adjusted to 1 / 1, 2 / 1, 3 / 1, 4 / 1, 5 / 1, 6 / 1, 7 / 1, 8 / 1, and 9 / 1 using the addition of anhydrous glucose. The initial pH was adjusted to 7.5 using H₂SO₄. 16-hour-old seed liquid was inoculated at a 10% (v / v) inoculum into each culture medium containing chicken manure biogas slurry with different C / N ratios. Cultures were shaken at 28°C and 200 rpm for 72 hours. The results are shown in Table 6.

[0080] Table 6 Growth of DhΔGAL4 under different C / N conditions

[0081]

[0082]

[0083] Wherein, SCP (%) refers to single cell protein content; substrate cell yield YX / S = ΔX / ΔS; ΔX is the cell dry weight increase (g / L), and ΔS is the substrate consumption (g / L).

[0084] As shown in Table 6, after 72 h of culture, the DCW content reached a maximum of 9.65 g / L at a C / N ratio of 7 / 1. Considering both DCW and cell yield, DhΔGAL4 achieved the best economic benefits at a C / N ratio of 6 / 1, with a DCW content of 9.40 g / L.

[0085] 5. Effect of Fermentation Time on Single-Cell Protein Production. Based on the above experiments, the optimal flask fermentation conditions for DhΔGAL4 in chicken manure biogas slurry were: inoculation age 16 hours, pH = 7.5, ammonia nitrogen concentration 1400 mg / L, and a C / N ratio of 6:1. Under these optimal flask fermentation conditions, culture was performed at 28°C and 200 rpm in a shaker for 120 hours. The culture medium was sampled every 12 hours to determine DCW, pH, ammonia nitrogen concentration, reducing sugar (glucose) concentration, and protein content. The results are shown in Table 7.

[0086] Table 7 Growth of DhΔGAL4 after fermentation for different times

[0087]

[0088] The results showed that DCW gradually increased with increasing culture time, reaching its highest ammonia nitrogen utilization rate at 72 hours, with reducing sugar (glucose) completely consumed at 48 hours. As the culture continued, DCW barely increased, and ammonia nitrogen concentration also slowly increased. This may be because the current environment was no longer suitable for microbial growth and the fermentation broth evaporated to some extent, leading to an increase in ammonia nitrogen concentration.

[0089] 6. Comparison with Wild Type. A secondary seed solution of wild-type Debaryomyces hansenii was prepared using the method described in this example, with an inoculation age of 16 h. This secondary seed solution of the wild-type strain was inoculated into a chicken manure biogas slurry culture medium under the optimal flask fermentation conditions for DhΔGAL4 in chicken manure biogas slurry (conditions of Step 5) for fermentation. The culture times were varied, and the results are shown in Table 8.

[0090] Table 8 Fermentation of wild type in chicken manure biogas slurry medium

[0091]

[0092] The results showed that, under the same conditions, the DhΔGAL4-engineered strain had a stronger ability to utilize ammonia nitrogen, producing more DCW and SCP. Furthermore, a comparison of the residual ammonia nitrogen and reducing sugar levels in the culture medium in Tables 7 and 8 revealed that, at the same fermentation time, the wild-type strain consumed less ammonia nitrogen and relatively more reducing sugars than the engineered strain. This may be because the inactivation of GAL4 translation weakened the strain's "preferential inhibition" of carbon sources—that is, its tendency to preferentially utilize a single fermentable sugar. This enabled the engineered strain to more evenly consume other carbon sources, thereby enhancing the utilization of biogas slurry and ammonia nitrogen.

[0093] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various deformations, modifications, and substitutions made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection determined by the claims of the present invention.

Claims

1. Transcription factor GAL4, characterized in that: The original transcription factor GAL4 coding was inactivated to obtain the gene, and the nucleotide sequence of the original transcription factor GAL4 is shown in SEQ ID No:

1.

2. A DNA encoding the transcription factor GAL4 according to claim 1.

3. A recombinant plasmid containing nucleotides for expressing the amino acids corresponding to the transcription factor GAL4 according to claim 1.

4. An expression plasmid containing the DNA according to claim 2.

5. Use of the transcription factor GAL4 according to claim 1 or the DNA according to claim 2 for improving ammonia nitrogen utilization efficiency and / or increasing microbial biomass and / or bacterial protein production of microorganisms, characterized in that: The microorganism is Debaryomyces hansenii.

6. An engineered strain of Debaryomyces hansenii, characterized by: The engineered bacteria are obtained by making the original transcription factor GAL4 coding ineffective or knocking out the transcription factor GAL4 coding gene on the basis of the wild-type Debaryomyces hansenii. The wild-type Debaryomyces hansenii was deposited in the China General Microbiological Culture Collection Center on July 15, 2021. The deposit address is: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, and the deposit number is: CGMCC No. 22903.

7. An engineered strain of Debaryomyces hansenii, characterized by: The method is obtained by replacing the original transcription factor GAL4 in Debaryomyces hansenii with the transcription factor GAL4 described in claim 1.

8. The use of the engineered Debaryomyces hansenii strain according to claim 6 or 7 in biogas slurry treatment, characterized in that: The engineered Debaryomyces hansenii bacteria are inoculated into the biogas slurry to be treated.

9. Use of the engineered Debaryomyces hansenii strain according to claim 6 or 7 in ammonia nitrogen treatment, characterized in that: The engineered Debaryomyces hansenii bacteria is inoculated into an environment where ammonia nitrogen is to be treated.

10. Use of the engineered Debaryomyces hansenii strain according to claim 6 or 7 in producing bacterial protein.

Images