Application of ZmMYB61 protein and coding gene thereof in plant resistance to cold and drought combined stress

Abstract

The invention discloses application of ZmMYB61 protein and a coding gene thereof in plant cold and drought composite stress resistance, and belongs to the technical field of biology. The technical problem to be solved is how to improve the resistance of plants to cold and drought composite stress. The invention discloses a ZmMYB61 protein, which is a protein as shown in A1), A2) or A3): A1, a protein with an amino acid sequence as shown in SEQ ID No: 2 in a sequence table; a2, a protein which is obtained by substitution and / or deletion and / or addition of amino acid residues on the amino acid sequence shown in SEQ ID No: 2 in the sequence table, has 80% or more of identity with the protein shown in A1) and has the same function as the protein shown in A1); and A3, a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of A1) or A2). After the corn ZmMYB61 gene is over-expressed in corn, the cold and drought composite stress resistance of the corn is improved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of ZmMYB61 protein and its encoding gene in plant resistance to combined cold and drought stress. Background Art

[0002] The frequent occurrence of dual stresses of drought and early spring chilling damage seriously affects seed germination, seedling growth and yield. The current means of coping with the combined stress of low temperature and drought are mainly to improve cultivation measures and cultivate stress-resistant varieties. Improving cultivation measures such as field water and fertilizer management, mulching, and the use of plant growth regulators can effectively increase crop yields under combined stress, but there are also some drawbacks, such as microplastic pollution and potential harm to human health caused by residues of plant growth regulators. Therefore, studying the genes that enable plants to resist the combined stress of drought and chilling damage in order to improve their water use efficiency and resistance to low temperatures has become an urgent problem to be solved. It is of great production significance to analyze the molecular genetic mechanism of corn's resistance to combined cold and drought stress and cultivate excellent corn varieties that are resistant to combined cold and drought stress to ensure high and stable corn yields.

[0003] Plant transcription factors can regulate the expression of multiple stress-resistant genes, respond rapidly to environmental changes, and interact with other regulatory mechanisms to form sophisticated regulatory networks to jointly cope with abiotic stresses. However, when plants resist drought or cold stress, different complex signal regulatory networks are involved. Many stress-resistant genes have functional specificity in regulating drought and low temperature stress, and their positive and negative regulatory characteristics also show significant differences. Currently, most research around the world focuses on the regulation of a single adversity, and which factors can simultaneously enhance maize's resistance to combined drought and cold stress has not yet been reported. Therefore, discovering transcription factors that simultaneously enhance maize's resistance to combined drought and cold stress is of great significance for breeding high-quality maize varieties resistant to combined cold and drought stress to ensure high and stable maize yields. Summary of the Invention

[0004] The technical problem to be solved by the present invention is how to improve the resistance of plants to combined cold and drought stress.

[0005] To solve the above technical problems, the present invention first provides a protein ZmMYB61 related to resistance to combined cold and drought stress, wherein the protein ZmMYB61 is the following protein A1, A2 or A3:

[0006] A1, the amino acid sequence is the protein shown in SEQ ID No: 2 in the sequence listing;

[0007] A2. A protein having more than 80% identity with the protein shown in A1) and having the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No: 2 in the sequence listing;

[0008] A3: A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1) or A2).

[0009] In the above-mentioned proteins, identity refers to amino acid sequence identity. Amino acid sequence identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, using Advanced BLAST 2.1, blastp can be used as the program, with the Expect value set to 10, all filters set to OFF, BLOSUM62 as the matrix, and the Gap existence cost, Per residue gap cost, and Lambda ratio set to 11, 1, and 0.85 (default values), respectively. The identity of a pair of amino acid sequences can be calculated and the identity value (%) can be obtained.

[0010] In the above proteins, the 80% or greater identity may be at least 81%, 85%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

[0011] The above proteins can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0012] Among the above proteins, the protein ZmMYB61 can be derived from corn.

[0013] The present invention also provides biological materials related to ZmMYB61, which also fall within the protection scope of the present invention.

[0014] The biological material related to the protein ZmMYB61 provided by the present invention is any one of the following B1) to B4):

[0015] B1) a nucleic acid molecule encoding ZmMYB61;

[0016] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0017] B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0018] B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).

[0019] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0020] In the above biological material, the nucleic acid molecule in B1) is a nucleic acid molecule whose coding sequence of the coding chain is SEQ ID No: 1.

[0021] In the above-mentioned biological material, the expression cassette containing the nucleic acid molecule (ZmMYB61 gene expression cassette) described in B2) refers to a nucleic acid molecule capable of expressing ZmMYB61 in a host cell. This nucleic acid molecule may include not only a promoter that initiates transcription of the ZmMYB61 gene, but also a terminator that terminates transcription of ZmMYB61. Furthermore, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to, constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP," Chao et al. (1999) Plant Physiology 120:979-992); the chemically inducible promoter from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); the tomato proteinase inhibitor II promoter (PIN2) or the LAP promoter (both inducible by methyl jasmonate); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (China Patent No. 2007)). 10099169.7)), seed storage protein-specific promoters (e.g., promoters of phaseolin, napin, oleosin, and soybean beta-conglycin (Beachy et al. (1985) EMBO J. 4: 3047-3053)). These can be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators (see, for example, Odell et al. (1996) EMBO J. 4: 3047-3053). 985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0022] Available existing plant expression vector construction contains the recombinant expression vector of described ZmMYB61 gene expression cassette.Described plant expression vector comprises binary agrobacterium vector and can be used for the carrier etc. of plant microprojectile bombardment.As pBCXUN, pCAMBIA1300, pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA company) etc.Described plant expression vector can also comprise the 3 ' end non-translational region of foreign gene, promptly comprise polyadenylic acid signal and any other DNA fragmentation that participates in mRNA processing or gene expression. The polyadenylic acid signal can guide polyadenylic acid to be added to the 3' end of the mRNA precursor, such as the non-translated region transcribed at the 3' end of Agrobacterium crown gall induction (Ti) plasmid gene (such as nopaline synthase gene Nos) and plant gene (such as soybean storage protein gene) all have similar functions. When using the gene construction plant expression vector of the present invention, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, but must be identical to the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The source of the translation control signal and the start codon is extensive and can be natural or synthetic. The translation initiation region can come from the transcription initiation region or the structural gene. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be modified to include genes encoding enzymes or luminescent compounds that can be expressed in plants (such as the GUS gene, luciferase gene), antibiotic marker genes (such as the nptII gene, which confers resistance to kanamycin and related antibiotics; the bar gene, which confers resistance to the herbicide phosphinothricin; the hph gene, which confers resistance to the antibiotic hygromycin; the dhfr gene, which confers resistance to methatrexate; and the EPSPS gene, which confers resistance to glyphosate), chemical resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes, which provide the ability to metabolize mannose. For the safety of transgenic plants, it is possible to omit any selectable marker genes and directly screen transformed plants using stress.

[0023] In the above-mentioned biological materials, the recombinant microorganisms can specifically be yeast, bacteria, algae and fungi.

[0024] The present invention also provides an application of a substance for increasing the content of the protein ZmMYB61 or a substance for promoting the expression of a gene encoding the protein ZmMYB61, wherein the application is any one of the following:

[0025] P1. Application in improving plant resistance to combined cold and drought stress;

[0026] P2. Application in reducing leaf damage area of ​​plants under combined cold and drought stress;

[0027] P3. Application in reducing the ion leakage rate of plant leaves under combined cold and drought stress;

[0028] P4. Application in plant breeding.

[0029] In the above application, the breeding goal is to breed plants that are resistant to combined cold and drought stress.

[0030] The present invention also provides a method for improving plant resistance to combined cold and drought stress, comprising the steps of promoting the expression of the gene encoding the protein ZmMYB61 in a recipient plant to obtain a plant having higher resistance to combined cold and drought stress than the recipient plant.

[0031] The plant mentioned above may be any of the following:

[0032] C1) Dicotyledons;

[0033] C2) Monocots,

[0034] C3) Gramineae,

[0035] C4) plants of the order Poaceae,

[0036] C5) Zea mays;

[0037] C6) Corn.

[0038] The protein provided by the present invention is derived from maize and is a transcription factor named ZmMYB61. Experiments have demonstrated that overexpressing the maize ZmMYB61 gene in maize can improve its resistance to combined cold and drought stress. This invention has significant application value in crop molecular modification and has important theoretical and practical significance for improving crop resistance to combined cold and drought stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is the observation of the cold-drought combined stress resistance phenotype of the ZmMYB61 overexpression materials ZmMYB61-OE3 and ZmMYB61-OE4 in Example 2 of the present invention, and the control is the wild type ND101. Figure 1 A is the relative expression level detection of ZmMYB61 gene in ZmMYB61 gene overexpression lines ZmMYB61-OE3 and ZmMYB61-OE4, and the internal reference gene is ZmUBQ. Figure 1 B is the phenotypic observation result of ZmMYB61 overexpression material.

[0040] Figure 2The leaf damage area of ​​ZmMYB61-overexpressing materials ZmMYB61-OE3 and ZmMYB61-OE4 in Example 2 of the present invention was compared with wild-type ND101 as a control. Results are presented as mean ± SD (n = 5). Different lowercase letters indicate significant differences between treatments using one-way ANOVA and Tukey's multiple comparison method (P < 0.05).

[0041] Figure 3 Results of leaf ion leakage testing for ZmMYB61-overexpressing materials ZmMYB61-OE3 and ZmMYB61-OE4 in Example 2 of the present invention, with wild-type ND101 as the control. Results are presented as mean ± SD (n = 5). Different lowercase letters indicate significant differences between treatments as determined by one-way ANOVA and Tukey's multiple comparisons (P < 0.05). DETAILED DESCRIPTION

[0042] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0043] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0044] The quantitative tests in the following examples were performed three times unless otherwise specified, and the results were averaged.

[0045] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials and reagents used in the following examples are commercially available unless otherwise specified.

[0046] The maize inbred line used in the following examples is ND101 (PI 612589). Germplasm information can be found on GRIN-Global at https: / / npgsweb.ars-grin.gov / gringlobal / search.

[0047] The corn material in the embodiment of the present invention is cultivated in a potted manner:

[0048] Corn seeds were germinated in the dark at 28°C for 2 days, and corn seeds with similar germination degrees were moved to a potting system with soil completely soaked (photoperiod: 16h / 8h (28±3°C), humidity: 45%, light intensity: 400μmol / m 2The substrate is a 1:1 mixture of peat soil and vermiculite. Before sowing, a high-nitrogen nutrient solution is applied once, completely soaking the soil and discarding any excess. Corn is grown in the pot system for 21 days without watering, allowing the soil moisture content to drop to 40%-50%. The plants are then subjected to a 4-day low-temperature treatment at 4°C, then returned to 28°C and rehydrated for another 4 days before observing phenotypes.

[0049] In the following examples, the pBCXUN expression vector is described in the non-patent document "Yazhen Guo et al., The clade F PP2C phosphatase ZmPP84 negatively regulates drought tolerance by repressing stomatal closure in maize, New Phytologist (2023) 237: 1728–1744)", which can be obtained from the applicant to repeat the experiments of this application.

[0050] Example 1: Construction and detection of maize ZmMYB61 overexpression material

[0051] 1. Construction of ZmMYB61 overexpression material

[0052] The amino acid sequence of the ZmMYB61 protein in corn B73 is SEQ ID No: 2 in the sequence listing, the nucleotide sequence of the ZmMYB61 gene coding chain is SEQ ID No: 1 in the sequence listing, and its genomic DNA sequence is SEQ ID No: 3 in the sequence listing.

[0053] SEQ ID No: 1

[0054] ATGGGGAGGCCACCGTGCTGCGACAACGGCGTCGGCGTCAAGAAAGGGCCTTGGACGCCGGAGGAGGACATCGTCCTCGTCTCCTACATCCAGCAGCACGGCCCCGGGAACTGGCGGTCCGTGCCAGAGAACACAGGGTTGATGAGGTGCAGCAAGAGCTGCAGGCTGCGGTGGACCAACTACCTGAGGCCTGGGATCAAGCGTGGAAACTTCACTCCTCATGAGGAAGGGATCATCATCCACCTCCAGGCGTTGCTTGGCAACAAGTGGGCAGCCATAGCCTCCTACCTCCCTCAAAGGACTGACAACGACATCAAGAACTACTGGAACACACACCTCAAGAAGAAGGTGAAGAGGCTGCAACAGCCGGCAGCCGACTCCTTCCAGACAACTGCCTCCAATGCAGTCACCTGCAGCCCAAACTACTACAGCCCCAGCAGCAGTCACCACAGCCTCCAAGGAATGCAGCCGATGAGCAGCTACCCCCACACCACCTGCAGCGGCGGAGCCCCAAGCAACAATGAGGCGATGACTGATACTACTACCGGCGTCGTCTCCAACCTCTTCCAGGCATGGATGAGGCCATCACCAGCAGCAGCGACAGCTAACTGCAAAATCGCCATGCAGGAGTTCCAGGAAGAACAAGGCGCTGCAGCAGCAGCCTCAATAGTCTGCAAGGAACAGATGGTGACCTGCGGTGATGTTAACAGGCCGCCGGCGCTGGAGATGGTGGTGGCGCCGGTGATGGGTGCGAGCACTGCCACCTTCTCGCTGCTCGAGGACTGGCTGCTCGATGACATGCCGGGGCAGGCCATGGATGGGTTCATGGGGATCTCCGCCGGTTGCTGTGCGGATCCCATCATGTTCTAG

[0055] SEQ ID No:2

[0056] MGRPPCCDNGVGVKKGPWTPEEDIVLVSYIQQHGPGNWRSVPENTGLMRCSKSCRLRWTNYLRPGIKRGNFTPHEEGIIIHLQALLGNKWAAIASYLPQRTDNDIKNYWNTHLKKKVKRLQQPAADSFQTTASNAVTCSPNYYSPSSSHHSLQGMQPMSSYPHTTCSGGAPSNNEAMTDTTTGVVSNLFQAWMRPSPAAATANCKIAMQEFQEEQGAAAAASIVCKEQMVTCGDVNRPPALEMVVAPVMGASTATFSLLEDWLLDDMPGQAMDGFMGISAGCCADPIMF

[0057] SEQ ID No:3

[0058]

[0059] The pBCXUN expression vector was used to construct the ZmMYB61 gene overexpression material ZmMYB61OE (ZmMYB61-OE3 and ZmMYB61-OE4) corn seeds. The process is as follows:

[0060] Genomic DNA from maize ND101 leaves was extracted and used as a template. PCR amplification was performed using an upstream primer (sequence: 5'-TCTCTTCTCGTTCTTCATCACCTACT-3', identical to positions 41-66 of SEQ ID No: 3) and a downstream primer (sequence: 5'-TAACGGCTTATTACCGGAAACATAG-3', reverse complementary to positions 1605-1629 of SEQ ID No: 3) to obtain a fragment containing the ZmMYB61 gene (sequence: positions 41-1629 of SEQ ID No: 3).

[0061] The pBCXUN vector was digested with restriction endonuclease Xcm I to obtain a linearized pBCXUN vector, which was then ligated with the ZmMYB61 gene fragment obtained above (sequence 41-1629 of SEQ ID No: 3) to construct the ZmMYB61 gene overexpression vector pBCXUN-ZmMYB61. This recombinant vector is capable of expressing the protein with the amino acid sequence shown in SEQ ID No: 2.

[0062] 2. Detection of ZmMYB61 overexpression materials

[0063] pBCXUN-ZmMYB61 was transformed into the maize inbred line ND101 using Agrobacterium tumefaciens strain EHA105, resulting in three T0-generation positive transgenic plants, two of which were designated ZmMYB61-OE3 and ZmMYB61-OE4. The T0-generation positive transgenic plant ZmMYB61-OE3 was serially selfed to obtain the T3-generation positive transgenic line ZmMYB61-OE3; the T0-generation positive transgenic plant ZmMYB61-OE4 was serially selfed to obtain the T3-generation positive transgenic line ZmMYB61-OE4.

[0064] Real-time PCR quantitative detection was performed using the transgenic overexpression maize material T3 positive transgenic line ZmMYB61-OE3 and the obtained T3 positive transgenic line ZmMYB61-OE4 as test materials and the corresponding wild-type maize inbred line ND101 as control:

[0065] Total RNA from each organ of the whole plant was extracted using Trizol (Sigma), and the integrity of the RNA was checked by agarose gel electrophoresis. cDNA was synthesized as a template according to the instructions of the reverse transcription kit (Beijing Polymer Biotechnology Co., Ltd.).

[0066] The primer pair targeting the ZmMYB61 gene was composed of ZmMYB61-Primer 1 and ZmMYB61-Primer 2. ZmMYB61-Primer 1 and ZmMYB61-Primer 2 primers (10 μM) were diluted 10 times each and mixed. The reverse transcribed template was diluted 20 times before real-time PCR reaction. The real-time PCR system was: 10 μL SYBR GREEN, 2 μL primers, 8 μL template, a total of 20 μL. After confirming that the melting curve of the primers was a single peak, the primers were loaded onto the machine and finally 2 -△△CT Data were processed. The reference gene was ZmUBQ, and the primer pair for it consisted of ZmUBQ-Primer 1 and ZmUBQ-Primer 2. The relevant primer sequences are as follows:

[0067] ZmMYB61-Primer 1: 5'-GTTGATGAGGTGCAGCAAGA-3';

[0068] ZmMYB61-Primer 2: 5'-TTGCAGCCTCTTCACCTTCT-3'.

[0069] ZmUBQ-Primer 1: 5'-CTGGTGCCCTCTCCATATGG-3';

[0070] ZmUBQ-Primer 2: 5'-CAACACTGACACGACTCATGACA-3'.

[0071] The quantitative detection results showed that the ZmMYB61 gene was overexpressed in the two ZmMYB61-positive transgenic lines (ZmMYB61-OE3 and ZmMYB61-OE4) compared with the wild-type maize inbred line ND101, that is, ZmMYB61-OE3 and ZmMYB61-OE4 were both ZmMYB61 gene overexpression lines ( Figure 1 Middle A).

[0072] Example 2: Low-temperature and drought phenotype detection of ZmMYB61 overexpressing materials

[0073] 1. Planting conditions and treatment

[0074] The maize ZmMYB61 overexpression material T3 generation positive transgenic line ZmMYB61-OE3 and T3 generation positive transgenic line ZmMYB61-OE4 and the wild type control maize inbred line ND101 were planted in an artificial climate chamber.

[0075] Photoperiod: 16h / 8h (28±3℃, humidity: 45%, light intensity: 400μmol / m 2 / s).

[0076] The matrix is ​​a mixture of peat soil and vermiculite in a ratio of 1:1.

[0077] Before sowing, water the soil with a high-nitrogen nutrient solution, completely soaking it and discarding any excess. Corn was grown in the pot system for 21 days without watering, allowing the soil moisture content to drop to 40%-50%. The plants were then subjected to a 4-day low-temperature treatment at 4°C. The temperature was then returned to 28°C and rehydrated for another 4 days. Phenotypes were observed and samples were collected for leaf damage area and ion leakage rate.

[0078] 2. Phenotypic Observation and Statistics

[0079] Phenotypic observations and statistics included drought and low temperature tolerance phenotype observations, leaf damage area detection, and leaf ion leakage rate detection.

[0080] Phenotypic observations showed that ZmMYB61-OE3 and ZmMYB61-OE4 had low temperature and drought tolerance phenotypes ( Figure 1 B).

[0081] The statistical method for the relative injured area of ​​leaves in this embodiment is as follows: stick the cold-treated corn leaves on A4 paper with a glue stick, then take a photo, put the photo into Image J software for processing, set a ruler, then circle the injured part of the leaf, click "Measure", and record it as A1. Circle the entire circumference of the leaf, click "Measure", and record it as A2. The relative injured area ratio can be calculated by A1 / A2. The relative injured area results of the leaves of wild-type plants and overexpression strains ZmMYB61-OE3 and ZmMYB61-OE4 after recovery from low temperature treatment ( Figure 2 ) showed that compared with the wild-type plants, the relative injured area of ​​leaves in the overexpression lines ZmMYB61-OE3 and ZmMYB61-OE4 was significantly reduced, indicating that overexpression of the ZmMYB61 gene can enhance the drought and frost resistance of corn.

[0082] This embodiment measures the ion leakage rate by measuring the relative conductivity of the leaves: L = (S1-S0) / (S2-S0). The fifth fully expanded leaf of corn after recovery from low-temperature treatment is placed in a 50 mL centrifuge tube containing 30 mL of distilled water, and then placed in a 28°C shaker for 1 hour. After that, the initial conductivity is measured with a conductivity meter as S1. The sample is then placed in a boiling water bath for 15 minutes, taken out and placed in a 28°C shaker for 2 hours, and the conductivity is measured again and recorded as S2. S0 is the conductivity of the blank control distilled water. The results are shown in the figure below. Figure 3 As shown in the figure, compared with the wild-type plants, the ion leakage rates of the overexpression lines ZmMYB61-OE3 and ZmMYB61-OE4 were significantly lower than those of the wild-type plants, indicating that overexpression of the ZmMYB61 gene can enhance the drought and frost resistance of corn.

[0083] The MYB family of transcription factors is an important family of transcription factors in plants, with diverse functions. They play a crucial role in plant resistance to adverse stresses. However, in maize, studies on the role of MYB family transcription factors in resistance to combined cold and drought stress are rare. Therefore, exploring the mechanism of action of MYB transcription factors in resistance to combined cold and drought stress has important theoretical significance and research value for breeding high-quality maize varieties resistant to combined cold and drought stress and ensuring high and stable maize yields.

[0084] The above results all indicate that the drought and cold tolerance of maize overexpressing the ZmMYB61 gene is enhanced.

[0085] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. A protein, characterized in that The protein is the following protein A1), A2) or A3): A1, the amino acid sequence is the protein shown in SEQ ID No: 2 in the sequence listing; A2. A protein having more than 80% identity with the protein shown in A1) and having the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No: 2 in the sequence listing; A3: A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1) or A2).

2. The protein-related biomaterial according to claim 1, characterized in that Any one of the following B1) to B4): B1) a nucleic acid molecule encoding the protein according to claim 1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).

3. The biomaterial according to claim 2, characterized in that B1) The nucleic acid molecule is a nucleic acid molecule whose coding sequence of the coding strand is SEQ ID No:

1.

4. Use of a substance that increases the content of the protein according to claim 1 or a substance that promotes the expression of the gene encoding the protein according to claim 1 in improving plant resistance to combined cold and drought stress.

5. Use of a substance that increases the content of the protein according to claim 1 or a substance that promotes the expression of the gene encoding the protein according to claim 1 in reducing the leaf damage area of ​​plants under combined cold and drought stress.

6. Use of a substance that increases the content of the protein according to claim 1 or a substance that promotes the expression of the gene encoding the protein according to claim 1 for reducing the ion leakage rate of plant leaves under combined cold and drought stress.

7. Use of a substance for increasing the content of the protein according to claim 1 or a substance for promoting the expression of the gene encoding the protein according to claim 1 in plant breeding.

8. The use according to claim 7, characterized in that The goal of the breeding is to breed plants that are resistant to combined cold and drought stress.

9. A method for improving plant resistance to combined cold and drought stress, characterized in that: The method comprises the steps of promoting the expression of the gene encoding the protein according to claim 1 in a recipient plant to obtain a plant having higher resistance to combined cold and drought stress than the recipient plant.

10. The use according to any one of claims 4 to 8, or the method according to claim 9, characterized in that: The plant is any one of the following: C1) Dicotyledons; C2) Monocots, C3) Gramineae, C4) plants of the order Poaceae, C5) Zea mays; C6) Corn.

Images