A strain of Pichia pastoris from Norway and its application in reducing ethyl acetate production during baijiu brewing.

By using Norwegian Pichia pastoris GJX001 in combination with brewing yeast during the baijiu brewing process, the problem of excessively high ethyl acetate concentration in northern strong-aroma baijiu was solved, the ester ratio was adjusted, the flavor of the liquor was improved, and the production cost was reduced.

CN120574690BActive Publication Date: 2026-04-03BEIJING TECH & BUSINESS UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-23
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

The excessively high concentration of ethyl acetate in strong-aroma baijiu from northern China leads to an imbalance in the ratio of ethyl hexanoate to ethyl acetate, affecting the flavor and market competitiveness of the liquor.

Method used

Pichia norvegensis GJX001 from Norway was mixed with brewer's yeast at a 1:1 ratio and added to the mash for fermentation to reduce the formation of ethyl acetate.

Benefits of technology

It effectively adjusts the ratio of ethyl hexanoate to ethyl acetate, improves the flavor of the wine, reduces production costs, and adapts to the local yeast population structure.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

This invention relates to the field of microbial technology, specifically to a strain of Pichia norvegensis and its application in reducing ethyl acetate formation during the brewing of baijiu (Chinese white liquor). The invention involves adding Pichia norvegensis GJX001 and Saccharomyces cerevisiae to the baijiu brewing process for fermentation. The resulting fermented mash is then distilled to obtain the base liquor, which significantly reduces the concentration of ethyl acetate, thereby effectively adjusting the ratio of ethyl hexanoate to ethyl acetate, while having little impact on other important flavor compounds in the base liquor. Furthermore, this Pichia norvegensis GJX001 strain was selected under local conditions in northern China, adapting to the local yeast population composition, thus greatly reducing costs compared to purchasing strains from southern wineries.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a strain of Pichia norvegensis GJX001 and its application in reducing ethyl acetate production during the brewing of baijiu (Chinese liquor). Background Technology

[0002] Baijiu (Chinese white liquor) is generally made from grains such as sorghum, corn, wheat, and glutinous rice, using yeast, active dry yeast, and saccharifying enzymes as saccharifying and fermenting agents. It is an alcoholic beverage produced through cooking, saccharification, fermentation, distillation, aging, and blending. Through continuous innovation in brewing techniques and technological advancements, baijiu has now initially formed 12 aroma types: strong aroma, sauce aroma, light aroma, rice aroma, medicinal aroma, phoenix aroma, soy sauce aroma, special aroma, mixed aroma, old-style baijiu aroma, sesame aroma, and rich aroma. Among these, strong aroma baijiu has consistently dominated the baijiu industry in terms of both production volume and sales revenue.

[0003] Due to differences in geographical environment, brewing raw materials, and production processes, the brewing environment and related factors affect the flavor and quality of baijiu (Chinese liquor). Even baijiu of the same aroma type can have significant differences in flavor characteristics. Therefore, based on aroma characteristics and regional distribution, strong-aroma baijiu is further divided into Jianghuai-style strong-aroma baijiu, Sichuan-style strong-aroma baijiu, and Northern-style strong-aroma baijiu. Multiple raw materials, complex processes, and open production methods collectively create the complex micro-component structure of baijiu. The types, contents, and distribution of these micro-components determine the flavor characteristics of baijiu. Among them, ester compounds are the main aroma-producing components, and their content and ratio determine the style and quality of baijiu. For example, the ratio of ethyl hexanoate to ethyl acetate and the ratio of ethyl hexanoate to ethyl lactate are both greater than 1, supplemented with an appropriate amount of ethyl butyrate, which helps to form the typical style of strong-aroma baijiu.

[0004] Studies show that ethyl acetate is mainly synthesized in yeast cells during the early stages of fermentation. Specifically, pyruvate is first decarboxylated to acetaldehyde, then oxidized to acetic acid, and then converted to acetyl-CoA under the action of transacyltransferase. Alternatively, pyruvate is oxidized and decarboxylated to acetyl-CoA. Acetyl-CoA is then converted to acetate with alcohol under the action of alcohol acyltransferase and secreted outside the cell.

[0005] In recent years, some strong-aroma baijiu enterprises in northern China have experienced excessive ethyl acetate levels in their raw liquor production. This results in a lack of prominent strong aroma, poor typicality, and poor harmony in the liquor, leading to a low yield of high-quality raw liquor, increased difficulty in liquor design, higher production costs, and a decline in product quality and market competitiveness.

[0006] Because baijiu is a regional product, the soil, water quality, and microorganisms in each brewing region are unique. Similarly, the composition of yeast populations in each region is also unique, participating in the fermentation of the mash through open brewing processes. However, the active dry yeast and other strains purchased by brewing companies from the market are considered exotic strains to the local wild yeast populations, having little impact on the local yeast populations. Furthermore, the strains currently purchased by northern brewing companies from leading southern brewing companies are difficult to establish long-term in the fermentation pits under local environmental conditions. To achieve the desired improvement, it would require long-term, regular, and large-scale purchases of new strains, resulting in significant costs. Summary of the Invention

[0007] Addressing the practical production problem of "excessively high ethyl acetate concentration in Northern-style strong-aroma baijiu, leading to an imbalance in the ratio of ethyl hexanoate to ethyl acetate" in existing technologies, the main objective of this invention is to provide a strain of Pichia pastoris (Norwegian orvegensis) GJX001 and its application in reducing ethyl acetate formation during baijiu brewing. Based on the microbial community of local brewing enterprises in northern China, this invention reduces ethyl acetate formation during the brewing process of Northern-style strong-aroma baijiu, and directionally regulates the ratio of ethyl hexanoate to ethyl acetate in Northern-style strong-aroma baijiu.

[0008] To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows:

[0009] On the one hand, a strain of Pichia norvegensis GJX001 is provided, with the accession number CGMCC NO.34136.

[0010] On the other hand, it provides the application of Pichia norvegensis GJX001 in reducing ethyl acetate formation during the brewing process of baijiu.

[0011] Furthermore, Pichia norvegensis GJX001 cultured to the logarithmic growth phase was mixed with Saccharomyces cerevisiae at a colony count ratio of 1:1.

[0012] Furthermore, Pichia norvegensis GJX001 was mixed with brewer's yeast and added to the mixture at 5% of the volume of the mash and mixed well.

[0013] The beneficial effects of this invention are as follows:

[0014] This invention involves adding Pichia norvegensis GJX001 and Saccharomyces cerevisiae to the baijiu (Chinese liquor) brewing process for fermentation. The fermented mash is then distilled to obtain the base liquor, which significantly reduces the ethyl acetate concentration, thereby effectively adjusting the ratio of ethyl hexanoate to ethyl acetate, while having little impact on other important flavor compounds in the base liquor. Furthermore, this Pichia norvegensis GJX001 strain was selected under local conditions in northern China, adapting to the local yeast population composition, thus greatly reducing costs compared to purchasing strains from southern wineries. Detailed Implementation

[0015] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0016] Example

[0017] Purification and identification of Pichia norvegensis GJX001:

[0018] 10g of each of the mash and mud samples from 60 fermentation pits at a winery in Hebei Province were taken, added to 90ml of sterile water, mixed well, and 20μL was spread onto YPD solid medium and incubated at 28℃ for 24h. White, round, smooth single colonies were picked and further purified by streaking with an inoculation loop, and incubated at 28℃ for 24h, repeated at least three times.

[0019] The purified strain was selected and sequenced using 18S and ITS sequencing. The sequencing sequence is as follows:

[0020] ACCTGCGGAAGGATCATTACTGTGATTTAAACTTCTTTCTTACACCGCGTGAGCGCACAACAACACCTAAACACGAATAACCATGTCACCCAGAGAAAA TCTCAAACGAGAAGAAAG-aaaaaaaTAAAACTTTCAACAACGGATCTCTTGG TTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCTCCGGCATTCCGGGGGGCATGCCTGTTTGAGCGTCGTTTCCTTCTTGCGCAAGCAGAGTTGGGGTT GCCACGGCCCGTGCGGCCTGTGTGTGGCTCCCCGAAACGGAACGGCAGCGGGACTGAGCGAAGTACACAACACTCGCGCTTGGCCCGCCGAACttttttttttAATCTAAGCTCGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAA

[0021] The sequenced sequences were compared with those obtained in NCBI, and the sequence with the highest similarity was selected as the species identification result. The sequence showed a 99.8% similarity to the ITS gene sequence of *Pichia norvegensis*. The strain purified in this example was named *Pichia norvegensis* GJX001, and its accession number is CGMCC NO.34136.

[0022] This embodiment screened out a strain of Pichia norvegensis GJX001 adapted to the local northern environment. The strain reached the logarithmic growth phase in approximately 24 hours at 28°C, with a bacterial concentration of 10... 6 Approximately. General method for activation and expansion of strains: Pick bacteria from solid plates and activate them in 250ml (200ml liquid culture medium) Erlenmeyer flasks at 28℃ and 200rpm for about 24 hours. Then, inoculate 5% by volume into 500ml (400ml liquid culture medium) Erlenmeyer flasks for expansion, 18h for Saccharomyces cerevisiae and 24h for Pichia pastoris GJX001.

[0023] Test case

[0024] Application of Pichia norvegensis GJX001 in reducing ethyl acetate formation during Baijiu brewing:

[0025] The specific steps of the experiment:

[0026] Day 1: (10:00 am) Activate Norwegian Pichia pastoris GJX001, two 200ml bottles of liquid culture medium, labeled (Group 2 Pichia pastoris); (10:00 pm) Activate Saccharomyces cerevisiae (the Saccharomyces cerevisiae involved in this experiment is a commercially available common Saccharomyces cerevisiae), one 200ml bottle of liquid culture medium, labeled (Group 2 Saccharomyces cerevisiae).

[0027] Day 2: (10:00 am) Expand culture (Group 2 Pichia pastoris), twelve bottles of 400ml liquid culture medium, each bottle + 20ml activated bacterial solution; (4:00 pm) Expand culture (Group 2 Brewing), two bottles of 400ml liquid culture medium, each bottle + 20ml activated bacterial solution.

[0028] Day 3: Each tank contained 15kg of fermented mash + 638ml of Pichia pastoris GJX001 culture cultured to the logarithmic growth phase + 112ml of Saccharomyces cerevisiae culture cultured to the logarithmic growth phase (Pichia pastoris GJX001: Saccharomyces cerevisiae colony count 1:1), for a total of six parallel tanks (experimental group).

[0029] The blank control group consisted of 15kg of fermented mash + 750ml of water, with six parallel batches.

[0030] The Norwegian Pichia pastoris control group consisted of 15 kg of fermented mash + 638 ml of Norwegian Pichia pastoris GJX001 culture culture expanded to the logarithmic growth phase + 112 ml of water, with six parallel batches.

[0031] The experimental group, blank control group, and Norwegian Pichia pastoris control group were sealed and stored at room temperature (around 30°C) for one and a half months before distillation. The raw wine was collected, and the ethyl acetate content was determined by direct injection combined with gas chromatography-mass spectrometry (GC-MS).

[0032] Gas chromatography conditions: Carrier gas: He (99.999%) for GC-MS; splitless mode; injection volume: 1 μL; injection port temperature: 250℃; temperature program: initial temperature 35℃, increase to 50℃ at 10℃ / min, hold for 20 min, increase to 70℃ at 1℃ / min, hold for 10 min, then increase to 250℃ at 3℃ / min, hold for 15 min.

[0033] Mass spectrometry conditions: solvent-free delay; electron impact (EI) source; electron energy 70 eV; ion source 250℃; quadrupole temperature 150℃; transfer line temperature 280℃; solvent delay time 6 min; qualitative analysis using Full Scan mode. All of the above were performed in triplicate.

[0034] The experimental results showed that the ethyl acetate content in the raw wine of the blank control group was 13.96 mg / 100 ml, and the ethyl acetate content in the raw wine of the Norwegian Pichia pastoris control group was 16.07 mg / 100 ml. The ethyl acetate content in the raw wine of the experimental group was 0.8467 mg / 100 ml, which was -93.93% compared with the blank control group. The ethyl hexanoate:ethyl acetate ratio in the raw wine of the blank control group was 0.0804, while the ethyl hexanoate:ethyl acetate ratio in the raw wine of the experimental group was 0.2888.

[0035] The Norwegian Pichia pastoris control group had a higher ethyl acetate content in its raw wine compared to the blank control group. This is because Norwegian Pichia pastoris is also an aroma-producing yeast, capable of producing ethyl acetate and other ester compounds. However, compared to other aroma-producing yeasts, Norwegian Pichia pastoris produces less ethyl acetate, but excessive addition can still lead to increased ethyl acetate accumulation. Furthermore, Norwegian Pichia pastoris and Saccharomyces cerevisiae (brewer's yeast) have a competitive and inhibitory effect on each other; when Saccharomyces cerevisiae decreases, Norwegian Pichia pastoris increases, thus increasing ethyl acetate levels. The method of this invention aims to reduce ethyl acetate levels by appropriately adding Norwegian Pichia pastoris GJX001 to replace other existing high-ethyl acetate-producing strains.

[0036] In summary, the experimental group was supplemented with Pichia pastoris (Norwegian Pichia pastoris). Fermentation was carried out using Norvegensis GJX001 and Saccharomyces cerevisiae. The fermented mash was then distilled to obtain the raw liquor. Compared with the blank control group and the Pichia pastoris control group, the concentration of ethyl acetate was significantly reduced, thus effectively adjusting the ratio of ethyl hexanoate to ethyl acetate, while having little effect on other important flavor substances in the raw liquor (Ethyl hexanoate 0.753 mg / 0.1L in the blank control group, 0.59 mg / 0.1L in the experimental group; Hexanoic acid 6.56 mg / 0.1L in the blank control group, 6.72 mg / 0.1L in the experimental group; Isobutanol 1.97 mg / 0.1L in the blank control group, 2.49 mg / 0.1L in the experimental group; 3-methyl-1-butanol 1.12 mg / 0.1L in the blank control group, 1.00 mg / 0.1L in the experimental group; Ethyl acetal 0.62 mg / 0.1L in the blank control group, 1.26 mg / 0.1L in the experimental group). Furthermore, the Norwegian Pichia pastoris strain GJX001 was selected under local conditions in the north and is adapted to the local yeast population composition, which greatly reduces costs compared to purchasing strains from wineries in the south.

[0037] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from the spirit or essential characteristics of the invention. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, it is intended that all variations falling within the meaning and scope of equivalents of the claims be included within the present invention.

[0038] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A strain of Pichia pastoris from Norway ( Pichia norvegensis GJX001, characterized in that, Its preservation number is: CGMCC NO.34136.

2. The Pichia pastoris as described in claim 1 ( Pichia norvegensis Application of GJX001 in reducing ethyl acetate formation during the brewing process of baijiu (Chinese liquor).

3. The Pichia pastoris according to claim 2 ( Pichia norvegensis The application of GJX001 in reducing ethyl acetate formation during the brewing process of baijiu (Chinese liquor) is characterized by, Pichia pastoris cultured to the logarithmic growth phase ( Pichia norvegensis GJX001 was mixed with brewer's yeast at a ratio of 1:1 based on colony count.

4. The Pichia pastoris according to claim 3 ( Pichia norvegensis The application of GJX001 in reducing ethyl acetate formation during the brewing process of baijiu (Chinese liquor) is characterized by, Norwegian Pichia pastoris ( Pichia norvegensis After mixing GJX001 with brewing yeast, add it to the mash at 5% of the volume and mix well.

Citation Information

Patent Citations

  • Pichia kudriavzevii and application of pichia kudriavzevii in fermentation of aromatic white spirit

    CN112831425A

  • Candida tropicalis mutant strain with hexane increasing and B reducing characteristics and application of candida tropicalis mutant strain

    CN116814451A