Application of rice grain shape regulation gene SMG9

Abstract

The invention provides application of a rice grain shape regulation gene SMG9, and belongs to the technical field of biology. According to the application, the rice grain shape regulation gene SMG9 is over-expressed to improve the grain shape of rice grains, the nucleotide sequence of the rice grain shape regulation gene SMG9 is shown as SEQ ID NO: 1 in a sequence table, and the nucleotide sequence of a coding region of the rice grain shape regulation gene SMG9 is shown as SEQ ID NO: 2 in the sequence table. The invention provides an application of a rice grain shape regulation gene SMG9, the rice grain shape regulation gene SMG9 is used for improving the grain shape of rice grains, and specifically, the grain length, the grain width and the thousand grain weight of the rice grains can be increased.

Description

Technical Field

[0001] The present disclosure relates to the field of biotechnology, and in particular to an application of a rice grain shape regulating gene SMG9. Background Art

[0002] Rice is the staple food for over 50% of the world's population. Over the past few decades, rice breeding has undergone numerous technological innovations, including semi-dwarf rice breeding, hybrid rice breeding, and green super rice cultivation, which have significantly increased rice yields per unit area. Therefore, we must continue to identify key genes that regulate yield traits and promote genetic improvement of yield traits to ensure high and stable rice yields.

[0003] Rice yield is primarily determined by the number of effective panicles, the number of grains per panicle, and grain weight. Grain weight, which is primarily determined by grain shape and grain filling, comprises grain length, width, and thickness. To date, a large number of genes involved in rice grain shape regulation have been discovered and cloned, primarily involving the ubiquitin-proteasome pathway, G protein signaling, mitogen-activated protein kinase (MAPK)-coupled signaling pathway, plant hormone pathways, and transcription factor regulatory pathways. However, relatively few genes have been identified that positively regulate rice grain size through gene editing, significantly limiting the progress of rice grain shape breeding. Therefore, it is necessary to identify more rice grain shape genes to provide more genetic resources and technical insights for rice breeding.

[0004] Public content

[0005] To solve the problems of the prior art, the present disclosure provides an application of the rice grain shape regulating gene SMG9. The technical solution is as follows:

[0006] On the one hand, the present disclosure provides an application of a rice grain shape regulatory gene SMG9, the application comprising: overexpressing the rice grain shape regulatory gene SMG9 for improving the grain shape of rice grains, the nucleotide sequence of the rice grain shape regulatory gene SMG9 being shown in SEQ ID NO: 1 in the sequence listing, and the nucleotide sequence of the coding region of the rice grain shape regulatory gene SMG9 being shown in SEQ ID NO: 2 in the sequence listing.

[0007] Specifically, the improved rice grain shape includes: increasing the length, width and thousand-grain weight of the rice grains.

[0008] Specifically, the application includes: introducing the rice grain shape gene SMG9 into rice callus cells via an overexpression vector pUbi::SMG9-GFP to improve the grain shape of rice grains.

[0009] The beneficial effects brought about by the technical solution provided by the embodiments of the present disclosure are: the present disclosure provides an application of the rice grain shape regulatory gene SMG9, the rice grain shape regulatory gene SMG9 is used to improve the grain shape of rice grains, specifically including increasing the grain length, grain width and 1000-grain weight of rice grains, and the rice grain shape regulatory gene SMG9 provides an effective target gene for the genetic improvement of rice grain shape, which is more conducive to the precise improvement of rice grain shape in future molecular design breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0011] Figure 1 This is a map of the overexpression vector pUbi::SMG9-GFP provided in the embodiments of the present disclosure;

[0012] Figure 2 Statistical graph of the relative expression of SMG9 in the wild-type W31 and overexpression strains OE1, OE2, and OE3 provided in the examples of the present disclosure;

[0013] Figure 3 This is a comparison of the grain phenotypes of the wild-type W31 and the overexpression lines OE1, OE2, and OE3 provided in the examples of the present disclosure, with the scale bar in the figure being 5 mm;

[0014] Figure 4 Statistical graphs of grain length of the wild-type W31 and overexpression lines OE1, OE2, and OE3 provided in the examples of the present disclosure;

[0015] Figure 5 Statistical graphs of grain width of the wild-type W31 and overexpression lines OE1, OE2, and OE3 provided in the examples of the present disclosure;

[0016] Figure 6 1000-grain weight statistics of the wild-type W31 and overexpression lines OE1, OE2, and OE3 provided in the examples of the present disclosure. DETAILED DESCRIPTION

[0017] In order to make the objectives, technical solutions and advantages of the present disclosure more clear, the embodiments of the present disclosure will be further described in detail below with reference to the accompanying drawings.

[0018] Example

[0019] The disclosed embodiments provide an application of the rice grain shape regulatory gene SMG9, which includes overexpressing the rice grain shape regulatory gene SMG9 to improve the grain shape of rice grains, wherein the gDNA nucleotide sequence of the rice grain shape regulatory gene SMG9 is shown in SEQ ID NO: 1 in the sequence listing. The cDNA (coding region) nucleotide sequence of the rice grain shape regulatory gene SMG9 is shown in SEQ ID NO: 2 in the sequence listing.

[0020] Specifically, improving the grain shape of rice grains includes increasing the grain length, grain width and thousand-grain weight of rice grains.

[0021] Specifically, the application includes: introducing the rice grain shape gene SMG9 into rice callus cells by an overexpression vector pUbi::SMG9-GFP to improve the grain shape of rice grains.

[0022] Furthermore, rice genomic DNA was extracted. In this embodiment, the CTAB extraction method was used to extract rice genomic DNA. Specifically, about 0.2 g of rice leaves were placed in a 2 mL centrifuge tube, two steel balls and 500 μL of CTAB extraction solution were added to the centrifuge tube, and the leaves were ground using a plant tissue grinder. After oscillation and mixing, the leaves were lysed at a constant temperature of 65° C. for 30 to 60 minutes; then 500 μL of chloroform was added for sufficient extraction, and the leaves were allowed to stand for 5 to 10 minutes and then centrifuged to obtain a supernatant. 500 μL of the supernatant was taken and transferred to a new 1.5 mL centrifuge tube; 500 μL of anhydrous ethanol was added to the supernatant, and the new centrifuge tube was gently inverted to mix the liquid in the centrifuge tube. The leaves were allowed to stand at -20° C. for 30 to 60 minutes and then centrifuged again. The supernatant was discarded and the precipitate was retained to obtain rice genomic DNA. The precipitate was dried at room temperature; 200 μL of double distilled water was then added to the precipitate for later use.

[0023] To construct the overexpression vector: First, extract total RNA from the rice variety Wuyunjing 31 (W31). Reverse transcribe the total RNA to obtain cDNA. Specifically, extract total RNA from rice panicles using the Axygen Total RNA Miniprep Kit (Cat. No. AP-MN-MS-RNA-250). For detailed procedures, refer to the kit's instructions. Reverse transcription is then performed using the TOYOBO ReverTraAceq PCR RT Master Mix with gDNA remover (Cat. No. FSQ-301) kit according to the kit's instructions to obtain the first-strand cDNA. In this example, W31 is a commercially available rice variety.

[0024] Using the cDNA as a template, PCR (Polymerase Chain Reaction) amplification was performed using forward and reverse primers to obtain an amplified product (the coding region of the rice grain shape gene SMG9, as shown in SEQ ID NO: 2 in the sequence listing). The amplified product fragment is 1824 bp. The sequence of the forward primer is: CTTCTGCAGGAGCTCGATGACCAAAGCTACTCCT, as shown in SEQ ID NO: 3 in the sequence listing, and the sequence of the reverse primer is: TGCTCACCATGGATCCTT GTCCTTTGTCATCATG, as shown in SEQ ID NO: 4 in the sequence listing.

[0025] In this example, the PCR amplification system was as follows: 2 μL cDNA, 25 μL 2× KOD Fx (1 U / μL) PCR buffer, 10 μL 2 mM dNTPs, 1.5 μL forward primer, 1.5 μL reverse primer, 1 μL KOD Fx (1 U / μL), and 9 μL ddH2O. The PCR amplification program is shown in Table 1.

[0026] Table 1 shows the PCR amplification program.

[0027]

[0028] After the amplified product was confirmed to be of correct size by agarose gel electrophoresis, the DNA was recovered using a DNA recovery kit (Promega The PCR amplification product was recovered by gel excision using a genomic DNA purification kit (Cat. No. A1120) to obtain the target fragment.

[0029] The plant binary expression vector pUbi::GFP was digested with KpnI, and after complete digestion was detected by agarose electrophoresis, it was recovered and purified to obtain the digested vector. The target fragment was ligated into the KpnI digestion site of the digested vector pUbi::GFP by homologous recombination to obtain the overexpression vector pUbi::SMG9-GFP driven by the Ubi promoter. The map of the overexpression vector pUbi::SMG9-GFP is shown in FIG. Figure 1 The ligation reaction system is as follows: 1.5 μL of target fragment, 1 μL of enzyme-digested vector, and 2.5 μL of the mixture from the Homologous Recombination Seamless Cloning Kit (Cat. No. CU101-01). Ligation is performed at 50°C for 15 minutes, followed by the addition of commercially available E. coli DH5α for transformation.

[0030] genetic transformation

[0031] Callus induction: Rice immature embryos were used to induce callus tissue. Rice seeds (W31) were hulled and disinfected, and then plated on N6D solid induction medium without antibiotics. The culture was carried out at 28°C with continuous light for 15 to 20 days until callus tissue grew.

[0032] Agrobacterium infection: The overexpression vector pUbi::SMG9-GFP was transformed into Agrobacterium tumefaciens EHA105 (commercially available) by electroporation to infect rice callus tissues and co-cultivated at 28°C in the dark for 3 days.

[0033] Resistant callus screening: The co-cultured callus tissue was evenly spread on N6DS screening medium containing 500 mg / L hygromycin B and 400 mg / L carboxybenzyl, and cultured at 28°C with continuous light for 15 to 20 days until new resistant calli grew.

[0034] Differentiation induction: The selected resistant calli were transferred to RE-III medium containing 50 mg / L hygromycin B and 250 mg / L carbobenzyl for differentiation induction and cultured at 28°C with continuous illumination until seedlings differentiated. The differentiated seedlings were transferred to HF rooting medium containing 50 mg / L hygromycin B and 250 mg / L carbobenzyl and cultured at 28°C with continuous illumination until the root system was strong. The plants were then identified as positive for primers to obtain homozygous and stably inherited overexpression strains OE. In this example, three overexpression OE strains (OE1, OE2, and OE3) were selected for subsequent testing.

[0035] qPCR (quantitative polymerase chain reaction) was used to detect the SMG9 gene in the transgenic plants with overexpression of SMG9, and wild-type rice W31 was used as the control group. The specific situation of the SMG9 gene is as follows Figure 2 Compared with W31, the expression levels of SMG9 in SMG9-overexpressing transgenic plants OE1, OE2, and OE3 were significantly increased.

[0036] like Figure 3 As shown, the grain phenotype analysis was performed in combination with the wild type W31. The results showed that compared with W31, the grain length of the three overexpression lines OE1, OE2 and OE3 increased significantly by 11.85%, 14.75% and 13.48%, respectively. Figure 4 ; Grain width increased significantly by 20.28%, 23.91% and 22.03% respectively. Figure 5 ; Thousand-grain weight increased significantly by 20.10%, 23.74% and 21.45% respectively. Figure 6 The above results indicate that the rice grain shape regulatory gene SMG9 can be used as a new gene to improve rice grain morphology, specifically including increasing rice grain length, grain width and 1000-grain weight.

[0037] The above description is merely an optional embodiment of the present disclosure and is not intended to limit the present disclosure. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present disclosure shall be included in the scope of protection of the present disclosure.

Claims

1. An application of the rice grain shape regulating gene SMG9, characterized in that: The application includes: overexpressing the rice grain shape regulatory gene SMG9 to improve the grain shape of rice grains, the nucleotide sequence of the rice grain shape regulatory gene SMG9 is shown in SEQ ID NO: 1 in the sequence list, and the nucleotide sequence of the coding region of the rice grain shape regulatory gene SMG9 is shown in SEQ ID NO: 2 in the sequence list.

2. The use according to claim 1, characterized in that The improved rice grain shape includes: increasing the grain length, grain width and thousand-grain weight of the rice grain.

3. The use according to claim 1, characterized in that The application includes: introducing the rice grain shape gene SMG9 into rice callus cells by using an overexpression vector pUbi::SMG9-GFP to improve the grain shape of rice grains.

Images