Tryptophan response type promoter as well as construction method and application thereof

Abstract

The invention discloses a tryptophan response type promoter as well as a construction method and application thereof. A tryptophan specific biosensor is created by constructing a tryptophan response type hybrid promoter, and a tryptophan high-throughput screening platform is established in combination with a flow cytometry sorting technology. And the mutant strain TrpES94N beneficial for improving the yield of the L-tryptophan is successfully screened from a random mutation library of the key enzyme TrpE for synthesizing the L-tryptophan. The strain is over-expressed in an engineering strain TRP30, and after the strain is cultured in a 5L fermentation tank for 48h, it is determined that the yield of L-tryptophan is increased to 50.8 g / L and is increased by 19.53% compared with the yield of L-tryptophan of a control strain.

Description

Technical Field

[0001] The present invention relates to a tryptophan-responsive promoter and a construction method and application thereof, belonging to the technical field of bioengineering. Background Art

[0002] Due to the inherent complexity of cellular metabolic networks and limited understanding of the synthesis and regulation of target chemicals, it is difficult to construct effective microbial biosynthetic systems using traditional metabolic engineering strategies (such as overexpression or knockout of several genes), making it difficult to achieve economically viable yields, productivity, and production intensity. However, evolutionary engineering can overcome these limitations by creating diverse mutant libraries and using phenotypic screening methods to introduce non-intuitive beneficial mutations to reshape cellular metabolic networks. With the development of synthetic biology, a variety of effective strategies, including rational transformation, random genome engineering, and automated strain engineering, have been developed and applied to rapidly construct large-scale, diverse mutant libraries. Traditional screening methods require intensive manpower and have low throughput, making it difficult to screen high-yield microbial cell factories from large mutant libraries. Therefore, the development of efficient high-throughput screening technologies is crucial for rapidly screening candidate strains or enzyme preparations with excellent performance, thereby promoting the industrialization of target biotechnology applications.

[0003] L-tryptophan is an important aromatic amino acid that plays a vital role in growth and endocrine regulation. Humans and animals cannot synthesize L-tryptophan and must absorb it from food and feed. The L-tryptophan biosynthesis pathway includes the shikimate pathway and the L-tryptophan branch pathway, which are tightly regulated by various mechanisms, such as feedback inhibition, repression, and attenuation. Anthranilate synthase TrpE is a key, rate-limiting enzyme in L-tryptophan synthesis, and its activity is closely correlated with the level of intracellular L-tryptophan synthesis. Directed evolution, a breakthrough technology, can optimize the catalytic performance of enzymes, effectively overcoming the limitations of natural enzymes as biocatalysts for metabolic engineering. Therefore, directed evolution of the key enzyme TrpE, coupled with the use of a high-throughput tryptophan screening platform to rapidly screen for high-performance enzyme mutants, is an effective strategy for increasing L-tryptophan production. Summary of the Invention

[0004] In order to solve the above technical problems, the present invention uses promoter P 105mut Based on the negative transcriptional regulatory factor TrpR, an 18 bp sequence that binds to the tryptophan promoter was inserted into the promoter P 105mut A tryptophan-responsive hybrid promoter P was constructed at three locations: upstream of the -35 region, between the -10 and -35 regions, and downstream of the +1 region. 105mut-1 、P 105mut-2 and P 105mut-3The above promoter was inserted before GFP on the vector pUC19 and transformed into TrpR + A tryptophan-responsive biosensor was constructed in the strain and characterized to screen for the best performing biosensor. A mutation library was constructed by random mutagenesis of the key enzyme TrpE using error-prone PCR. Finally, a combination of biosensors and flow cytometry was used to identify mutants that favored L-tryptophan synthesis.

[0005] The present invention is achieved through the following technical solutions:

[0006] The first object of the present invention is to provide a tryptophan responsive promoter, wherein the tryptophan responsive promoter is a promoter that binds the negative transcriptional regulatory factor TrpR to the binding sequence P in the tryptophan promoter. trpO Inserted into promoter P 105mut The nucleotide sequence of the tryptophan-responsive promoter is shown in SEQ ID NO.4.

[0007] In one embodiment of the present invention, the promoter P 105mut The nucleotide sequence of the nucleotide sequence is shown in SEQ ID NO.2, and the binding sequence P trpO The nucleotide sequence is shown in SEQ ID NO.3.

[0008] The second object of the present invention is to provide the use of the tryptophan-responsive promoter in screening high-yield L-tryptophan producing strains.

[0009] In one embodiment of the present invention, the application is specifically to introduce the tryptophan-responsive promoter and the expression gene of the fluorescent protein into the L-tryptophan production strain, start the expression of the fluorescent protein through the tryptophan-responsive promoter, and judge the L-tryptophan production according to the expression level of the fluorescent protein.

[0010] In one embodiment of the present invention, the L-tryptophan producing strain is Escherichia coli TRP30 into which a random mutation library of anthranilate synthase TrpE is introduced.

[0011] In one embodiment of the present invention, the engineered Escherichia coli strain TRP30 is disclosed in the non-patent document “Multidimensional engineering of Escherichia coli for efficient synthesis of L-tryptophan”, and the L-tryptophan yield in a 5L fermenter is 42.5 g / L.

[0012] In one embodiment of the present invention, the tryptophan-responsive promoter and the expression gene of the fluorescent protein are expressed in Escherichia coli via the vector pUC19.

[0013] In one embodiment of the present invention, the anthranilate synthase TrpE random mutation library is expressed in Escherichia coli via the vector pACYCDeut.

[0014] The third object of the present invention is to provide a method for increasing the L-tryptophan production in Escherichia coli, wherein the method is to overexpress anthranilate synthase mutant trpE in L-tryptophan producing bacteria. S94N .

[0015] In one embodiment of the present invention, the anthranilate synthase mutant trpE S94N The nucleotide sequence is shown in SEQ ID NO.1.

[0016] In one embodiment of the present invention, the method specifically uses pACYCDeut as an expression vector to express the anthranilate synthase mutant trpE in Escherichia coli TRP30. S94N .

[0017] Beneficial effects of the present invention:

[0018] The present invention provides a method for creating a tryptophan-specific biosensor by constructing a tryptophan-responsive hybrid promoter and establishing a tryptophan high-throughput screening platform by combining flow cytometer sorting technology. The method also successfully screened a mutant strain TrpE that is beneficial to increasing L-tryptophan production from a random mutation library of the key enzyme TrpE in L-tryptophan synthesis. S94N The gene was overexpressed in the engineered strain TRP30 and cultured in a 5L fermenter for 48 hours. The L-tryptophan production was found to be increased to 50.8 g / L, which was 19.53% higher than that of the control strain. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 Analyze the engineered strains TRP30 and TRP30 / pTrc99a-trpE for 5 L fermentation tank fermentation S94N Ability to produce L-tryptophan. DETAILED DESCRIPTION

[0021] The present invention is further described below in conjunction with specific examples. These implementation cases are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, after reading the content taught by the present invention, those skilled in the art may make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims appended hereto.

[0022] The Escherichia coli W3110 and JM109 and plasmids pUC19, pACYCDeut and pTrc99a involved in the following examples are all commercially available strains and plasmids.

[0023] The culture medium involved in the following examples is as follows:

[0024] LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.

[0025] LB solid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 15 g / L.

[0026] Competent medium: peptone 16 g / L, yeast extract 10 g / L, NaCl 5 g / L.

[0027] Recovery medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.

[0028] M9 medium: 1 mol / L MgSO4, 1 mol / L CaCl2, 5×M9 salt solution (12.8 g Na2HPO4·7H2O, 3.0 g KH2PO4, 0.5 g NaCl and 1.0 g NH4Cl dissolved in 200 mL of double-distilled water), and 20% glucose solution.

[0029] Seed culture medium: glucose 30 g / L, yeast extract 5 g / L, citric acid 2 g / L, ammonium sulfate 2.5 g / L, dipotassium phosphate 4 g / L, magnesium sulfate heptahydrate 1.5 g / L, ferrous sulfate heptahydrate 2.8 mg / L, manganese sulfate monohydrate 1.2 mg / L, VB1 1 mg / L, VH 1 mg / L, and trace element mixture 1 mL / L.

[0030] Fermentation medium: glucose 30 g / L, yeast extract 3 g / L, citric acid 2 g / L, ammonium sulfate 3 g / L, dipotassium hydrogen phosphate 7 g / L, sodium chloride 1 g / L, magnesium sulfate heptahydrate 1 g / L, ferrous sulfate heptahydrate 30 mg / L, manganese sulfate monohydrate 10 mg / L, VB1 1 mg / L, VH 1 mg / L, and trace element mixture 1 mL / L.

[0031] L-Tryptophan Detection Method: L-tryptophan in the fermentation broth was determined using high-performance liquid chromatography (HPLC) (Agilent 1260 series, CA, USA). UV detection was used. The mobile phase consisted of acetonitrile / water (10:90 v / v), the flow rate was set at 1 ml / min, and the detection wavelength was set at 278 nm.

[0032] Table 1 Primers involved in the following examples

[0033]

[0034]

[0035] The technical solutions of the present invention are described in detail below with reference to specific embodiments. In the following embodiments, unless otherwise specified, the reagents, materials and equipment used can be purchased from commercial sources, or prepared by conventional methods, or are commonly used in the industry.

[0036] Example 1: Construction and screening of a mutant library of the constitutive promoter BBa_J23105

[0037] The construction of a tryptophan-responsive promoter requires the insertion of a fragment that binds to the transcription factor TrpR and the tryptophan promoter. However, the insertion of an exogenous fragment often affects the structure of the original promoter, thereby reducing the strength of the promoter itself. Therefore, in order to reduce the effect of the insertion of an exogenous fragment on the strength of the promoter, the promoter P is first BBa_J23105 The strength of the promoter P was optimized. BBa_J23105 Four random mutation libraries (libraries 1-4) were constructed by introducing degenerate bases into the -35 region, the spacer sequence between the -35 region and the -10 region, the -10 region, and the sequence downstream of the -10 region. Using green fluorescent protein (GFP) as a marker, the reporter gene gfp was first amplified by PCR using the primer pair BBa_J23105-library-TY-R1 / BBa_J23105-library-F1. Then, the pTrc99a empty vector plasmid was amplified by reverse PCR using the primer pair BBa_J23105-library-TY-F2 / BBa_J23105-library-R2. The promoter P carrying degenerate bases was introduced into the pTrc99a empty vector. BBa_J23105. The two fragments obtained were homologously recombined and transformed into E. coli JM109 to construct mutant libraries BBa_J23105-library1, BBa_J23105-library2, BBa_J23105-library3 and BBa_J23105-library4 corresponding to the BBa_J23105 interval. The transformants grown on the LB plate were eluted and sorted by flow cytometry to screen mutants with fluorescence intensity significantly higher than that of the control group. The proportion of high fluorescence intensity mutants in library 1 and library 3 was 0.26% and 0.25%, respectively, while the proportion of dominant mutants in library 2 and library 4 was significantly higher than that in library 1 and 2, among which the proportion of dominant mutants in library 4 higher than that of the control group was 3.76%. Therefore, library 4 is more conducive to screening mutants with high fluorescence intensity. Subsequently, 100 mutants with fluorescence intensity significantly higher than that of the control strain were randomly selected from library 4 and inoculated into 96-well plates for a second round of screening. Finally, a mutant P was screened from library 4, whose fluorescence intensity was 10.8 times higher than that of the control strain. 105mut (SEQ ID NO. 2: TTTACGGCTAGCTCAGTCCTAGGTACTATTAGTAA), and used it for the subsequent construction of a tryptophan-responsive hybrid promoter.

[0038] Example 2: Construction of a biosensor based on a tryptophan-responsive promoter

[0039] The screened promoter P 105mut The three positions upstream of the -35 region, between the -10 region and the -35 region, and downstream of the +1 region are marked as positions ①, ②, and ③, respectively, and the binding sequence P trpO (SEQ ID NO.3: GAACTAGTTAACTAGTAC) were inserted into the above three positions respectively to construct the hybrid promoter P 105mut-1 、P 105mut-2 and P 105mut-3 First, the reporter gene gfp was amplified by PCR using the primer pair pUC19-TrpR-U / I / D-F1 / R1, and the pUC19 empty plasmid was amplified by reverse PCR using the primer pair pUC19-TrpR-U / I / D-F2 / R2. 105mut-1 、P 105mut-2 and P 105mut-3 (SEQ ID NO.4: TTTACGGCTAGCTCAGTCCTAGGTACTATTAGTAAAGAACTAGTTAAC TAGTAC) The two fragments were connected by homologous recombination and transformed into E. coli JM109. The plasmid was extracted for PCR and sequencing verification. The verified correct plasmid was transferred into TrpR +The sensor performance was measured in strains. The three strains were inoculated into M9 medium for overnight culture, and 0-12mM L-tryptophan was added to the medium. Finally, the response range of the three hybrid promoters to L-tryptophan was measured using an enzyme marker. 105mut-3 The highest fluorescence intensity was shown, and the response range to L-tryptophan was 0-10 mM. 105mut-3 Used for the subsequent construction of tryptophan-responsive biosensors.

[0040] Example 3: Directed evolution of the key enzyme TrpE based on biosensors

[0041] First, the key gene trpE was PCR amplified using an error-prone PCR kit and then cloned into the vector pACYCDeut to form the mutant library pACYCDeut-P BBa_J23114 -trpE Mut , and transformed into E. coli JM109. All the transformants grown on the LB plate were washed off and the plasmid was extracted. Subsequently, the plasmid extracted from the mixed bacteria was introduced into the recombinant strain TRP30 / pUC19-P 105mut-3 -gfp, the transformants grown from the overnight culture were collected and diluted with PBS buffer to OD 600 After the fluorescence intensity is 0.3, flow cytometry sorting is performed. Mutant strains that are beneficial to L-tryptophan synthesis will show lower fluorescence signals. By screening mutant strains with lower fluorescence intensity than the control strains, false positive strains with no fluorescence signals are eliminated. Candidate strains with the expected phenotype in the top 0.1% are selected for recovery culture and shake flask fermentation experiments, and finally the mutant strain TrpE is screened. S94N (anthranilate synthase mutant trpE S94N

[0042] Example 4: Engineering strain TRP30 / pTrc99a-trpE S94N Fermentation experiment in 5L fermenter

[0043] To treat the mutant strain TrpE S94N For fermentation test, the vector pTrc99a and gene trpE were amplified using primer pair 99a-trpE-F1 / R1 and 99a-trpE-F2 / R2, respectively. After homologous recombination, the recombinant plasmid pTrc99a-trpE was constructed by transforming into E. coli JM109. Subsequently, the plasmid pTrc99a-trpE was constructed by PCR using primer pair 99a-trpEmut-F1 / R1. S94N After digestion with Dpn I for 1 hour, the cells were transformed into E. coli JM109 and cultured overnight. The correct transformants were verified by sequencing. Finally, the recombinant plasmid pTrc99a-trpE was constructed. S94N The cells were transformed into the engineered strain TRP30 for fermentation verification.

[0044] To engineer the strain TRP30 / pTrc99a-trpE S94N To conduct a fermentation level test, the strain was first cultured on LB solid medium at 37°C for 12 hours for activation, and the activated strain was inoculated into a 5L fermenter containing 3L seed medium. The pH of the fermentation medium was maintained at 7.0 by automatically adding ammonia water, and the temperature was maintained at 37°C. The dissolved oxygen was maintained above 30% by changing the stirrer speed and aeration rate. When the OD 600 When it reaches 10-12, the excess fermentation liquid is discharged and only 450mL is left for batch fermentation. During the batch fermentation process, the pH is also maintained at 7.0, the temperature is maintained at 37°C and the dissolved oxygen is maintained at more than 30%. After the initial sugar is consumed, the glucose concentration of the fermentation liquid is controlled below 2g / L. During the subsequent fermentation process, a glucose solution with a concentration of 80% is added to the fermenter at an appropriate rate to maintain bacterial growth and product synthesis. After 48 hours of fermentation, the engineered strain TRP30 / pTrc99a-trpE S94N The yield reached 50.8 g / L, which was 19.53% higher than that of the control strain TRP30.

[0045] The embodiments provided above are not intended to limit the scope of the present invention, nor are the steps described to limit their execution order. Any obvious improvements to the present invention made by those skilled in the art in combination with existing common knowledge shall fall within the scope of protection defined by the claims of the present invention.

Claims

1. A tryptophan-responsive promoter, characterized in that The tryptophan responsive promoter is a binding sequence P that combines the negative transcriptional regulatory factor TrpR with the tryptophan promoter. trpO Inserted into promoter P 105mut The nucleotide sequence of the tryptophan-responsive promoter is shown in SEQ ID NO.

4.

2. The tryptophan-responsive promoter according to claim 1, wherein The promoter P 105mut The nucleotide sequence of the nucleotide sequence is shown in SEQ ID NO.2, and the binding sequence P trpO The nucleotide sequence is shown in SEQ ID NO.

3.

3. Use of the tryptophan-responsive promoter according to claim 1 or 2 in screening high-yield L-tryptophan producing strains.

4. The use according to claim 3, characterized in that The application specifically involves introducing the tryptophan-responsive promoter and the expression gene of the fluorescent protein into an L-tryptophan-producing strain, initiating the expression of the fluorescent protein through the tryptophan-responsive promoter, and determining the L-tryptophan production according to the expression level of the fluorescent protein.

5. The use according to claim 3 or 4, characterized in that The L-tryptophan producing strain is Escherichia coli TRP30 into which an anthranilate synthase TrpE random mutation library is introduced.

6. The use according to claim 3, characterized in that The tryptophan-responsive promoter and the expression gene of the fluorescent protein are expressed in Escherichia coli via the vector pUC19.

7. The use according to claim 3, characterized in that The anthranilate synthase TrpE random mutation library is expressed in Escherichia coli via the vector pACYCDeut.

8. A method for increasing the production of L-tryptophan in Escherichia coli, characterized in that: The method is to overexpress anthranilate synthase mutant trpE in L-tryptophan producing bacteria S94N .

9. The method according to claim 8, characterized in that The anthranilate synthase mutant trpE S94N The nucleotide sequence is shown in SEQ ID NO.

1.

10. The method according to claim 8 or 9, characterized in that The method specifically uses pACYCDeut as an expression vector to express the anthranilate synthase mutant trpE in Escherichia coli TRP30. S94N .

Images