Use of ospup5 gene or its encoded protein in regulating rice plant type and / or grain type

By regulating the expression level of the OsPUP5 gene or its encoded protein OsPUP5, the problem of regulating rice plant type and grain type has been solved, achieving precise improvement of plant height, leaf type and grain type, and providing theoretical support for breeding.

CN120591331BActive Publication Date: 2026-05-22HUNAN AGRI UNIV +1
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUNAN AGRI UNIV
Filing Date
2025-06-20
Publication Date
2026-05-22

Smart Images

  • Figure HDA0005462358750000011
    Figure HDA0005462358750000011
  • Figure HDA0005462358750000012
    Figure HDA0005462358750000012
  • Figure HDA0005462358750000013
    Figure HDA0005462358750000013
Patent Text Reader

Abstract

The application provides application of an OsPUP5 gene or a coded protein thereof in regulation of rice plant type and / or grain type, and belongs to the technical field of genetic engineering. The application first proposes that overexpression of the OsPUP5 gene or increase of expression amount of the coded protein OsPUP5 can make plants dwarf, can make the length of a panicle of a main tiller, a first downward stem node, a second downward stem node, a third downward stem node and a fourth downward stem node shorter, and can make the length and width of an internode cell, a blade and a second leaf smaller. The application first proposes that knockout of the OsPUP5 gene or decrease of expression amount of the coded protein OsPUP5 can make grain length significantly increase, and grain width and grain thickness significantly decrease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of the OsPUP5 gene or its encoded protein in regulating rice plant architecture and / or grain type. Background Technology

[0002] As a globally important food crop, rice's yield and quality have always been a key research focus in agricultural science. Plant type and grain shape are crucial agronomic traits affecting rice yield and quality. Ideal rice plant type can fully utilize resources such as light and space, improving photosynthetic efficiency and thus increasing yield; while suitable grain shape not only affects the appearance quality of rice but also has a significant impact on processing quality and cooking taste.

[0003] Current research has identified some genes related to the regulation of rice plant architecture and grain form. However, the regulation of rice plant architecture and grain form is a complex network involving numerous genes and their interactions, and our understanding of this regulatory network remains largely incomplete. The functions of many key genes are not fully understood, and the mechanisms of synergistic regulation between genes are even less known. This poses a significant challenge to the precise improvement of rice plant architecture and grain form using traditional genetic engineering methods, making it difficult to achieve the desired results.

[0004] In the field of rice plant architecture and grain type regulation research, research on the rice purine permease family (OsPUP) is still in the exploratory stage. Currently, this family has been confirmed to participate in various physiological processes in rice, but its specific mechanisms of action in plant architecture and grain type and the current status of research and development still need to be explored in depth. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide the application of the OsPUP5 gene or its encoded protein in regulating rice plant architecture and / or grain type.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides the application of the OsPUP5 gene or its encoded protein OsPUP5 in regulating rice plant architecture.

[0008] This invention also provides the application of the OsPUP5 gene or its encoded protein OsPUP5 in regulating rice grain shape.

[0009] Preferably, the plant type includes plant height and leaf type.

[0010] Preferably, the plant height is controlled by adjusting the spike length and internode length.

[0011] Preferably, the leaves include sword-shaped leaves and second leaves from the top.

[0012] Preferably, the leaf shape includes leaf length and leaf width.

[0013] Preferably, the particle shape includes particle length, particle width, and particle thickness.

[0014] Preferably, the effect of reducing plant height is achieved by overexpressing the OsPUP5 gene or increasing the expression level of the encoded protein OsPUP5.

[0015] Preferably, the effect of reducing leaf length and width is achieved by overexpressing the OsPUP5 gene or increasing the expression level of the encoded protein OsPUP5.

[0016] Preferably, knocking out the OsPUP5 gene or reducing the expression level of the encoded protein OsPUP5 can increase grain length, reduce grain width, and reduce grain thickness.

[0017] The beneficial effects of this invention are:

[0018] This invention is the first to propose that overexpression of the OsPUP5 gene or increasing the expression level of the encoded protein OsPUP5 will make the plant shorter, shorten the length of the panicle, the first internode from the bottom, the second internode from the bottom, the third internode from the bottom, and the fourth internode from the bottom, and reduce the length of internode cells, the length and width of the flag leaf and the second leaf from the bottom, thus providing theoretical support for rice plant type breeding.

[0019] This invention is the first to propose that knocking out the OsPUP5 gene or reducing the expression level of the encoded protein OsPUP5 will significantly increase grain length and significantly decrease grain width and thickness, providing theoretical support for rice grain shape breeding. Attached Figure Description

[0020] Figure 1 The expression patterns of OsPUP5 in different tissues of wild-type plants are shown. MR represents mature root, ST represents stem, LB represents leaf, LS represents leaf sheath, and Panicle represents spike. The bar value is the standard deviation. Different letters on the bar indicate significant differences (P < 0.05).

[0021] Figure 2 GUS staining analysis of different tissues of pOsPUP5::GUS transgenic plants: A is coleoptile and seed root; B is lateral root; C is stem cross-section; D is leaf sheath cross-section; E is leaf blade, pulvinus, ligule, and auricle; F is spikelet; G is stigma and ovary; H is anther. Note: Scale bar: 1 cm.

[0022] Figure 3The study investigated the effects of different forms of cytokinins (CKs) on the transcriptional levels of OsPUP5 in wild-type roots and shoots. In Figure A, the effect of different forms of CKs on the transcriptional levels of OsPUP5 in wild-type roots was shown; in Figure B, the effect of different forms of CKs on the transcriptional levels of OsPUP5 in wild-type shoots was shown. Note: The experiment was conducted in 3 biological replicates. The error bar is the standard deviation. Different letters indicate differences, and the same letter indicates no differences.

[0023] Figure 4 Subcellular localization of OsPUP5 protein, where A is the subcellular localization of OsPUP5 in tobacco leaves and B is the subcellular localization of OsPUP5 in rice protoplasts. Note: Bright field; Merged; Scale bar, 10 μm.

[0024] Figure 5 Phenotypic analysis of OsPUP5 overexpressing lines: A compares the plant morphology of wild-type and overexpressing lines OE1 and OE2; B shows the expression level of OsPUP5 in overexpressing lines; C shows plant height statistics; D shows the number of effective panicles. Note: Expression level detection was performed in 3 biological replicates, and plant height and effective panicle counts were performed in 24 biological replicates. The error bar is the standard deviation. Scale bar: 29 cm. ** indicates extremely significant difference (P<0.01).

[0025] Figure 6 Phenotypic analysis of stem segments in OsPUP5 overexpression lines, where A represents a comparison of spikelet length and stem segment length between wild-type and overexpression lines OE1 and OE2, and Panicle represents spikelet length. st ln represents the last stem node, 2 nd ln represents the second-to-last stem node, 3 rd ln represents the third stem node from the bottom, 4 th ln represents the fourth node from the bottom, and B represents the statistical data of spike length and node length; Note: The experiment was set up with 6 biological replicates, and the error bar is the standard deviation; Scale bar, 10cm, * indicates significant difference (P<0.05), ** indicates extremely significant difference (P<0.01);

[0026] Figure 7 Cell length analysis was performed on longitudinal sections of the first node from the bottom of OsPUP5-overexpressing plants. Figure A shows a tissue section of the first node from the bottom of OsPUP5-overexpressing plants; Figure B shows a statistical graph of cell length in the first node from the bottom of OsPUP5-overexpressing plants. Note: 1000 cells were observed (random fields of view from sections of the first node from the bottom of 3 different plants), and the error bar is the standard deviation. Scale bar: 100 μm; * indicates significant difference (P<0.05), ** indicates extremely significant difference (P<0.01).

[0027] Figure 8Morphological analysis of the flag leaf and second-to-last leaf of OsPUP5 overexpressing lines was performed. A represents a comparison of flag leaf morphology between wild-type and overexpressing lines; B represents statistical data on flag leaf length; C represents statistical data on flag leaf width; D represents a comparison of the second-to-last leaf morphology between wild-type and overexpressing lines; E represents statistical data on the length of the second-to-last leaf; and F represents statistical data on the width of the second-to-last leaf. Note: Six biological replicates were set up, and the error bar is the standard deviation; scale bar: 10 cm; * indicates significant difference (P<0.05), ** indicates extremely significant difference (P<0.01).

[0028] Figure 9 This study analyzed the ear morphology of OsPUP5 overexpressing lines. A represents a comparison of ear morphology between wild-type and overexpressing lines; B represents statistical data on primary branches; C represents statistical data on secondary branches; D represents statistical data on the number of grains per ear; and E represents statistical data on the seed setting rate. Note: The experiment was conducted with 6 biological replicates, and the error bar is the standard deviation. Scale bar: 10cm. * indicates significant difference (P<0.05), ** indicates extremely significant difference (P<0.01).

[0029] Figure 10 The analysis included grain morphology of OsPUP5 overexpressing lines. A represents a comparison of grain morphology between wild-type and overexpressing lines; B represents statistical data on grain length; C represents statistical data on grain width; and D represents statistical data on grain thickness. Note: Grain morphology statistics were performed with 60 biological replicates; the error bar is the standard deviation; the scale bar is 1 cm; ** indicates extremely significant differences (P < 0.01).

[0030] Figure 11 Phenotypic analysis of OsPUP5 knockout mutant plants, where A represents the mutation type of OsPUP5, B represents the comparison of morphology between wild-type and knockout mutant plants, C represents the statistical data of plant height, and D represents the statistical data of effective panicle number; Note: The experiment was set up with 6 biological replicates, and the error bar is the standard deviation; Scale bar, 29cm; * indicates significant difference (P<0.05).

[0031] Figure 12 Phenotypic analysis of stem and node lengths of OsPUP5 knockout mutant lines, where A compares ear length and stem and node length between wild-type and knockout lines; B presents statistical data on ear length and stem and node length, where Panicle represents ear length. st ln represents the last stem node, 2 nd ln represents the second-to-last stem node, 3 rd ln represents the third stem node from the bottom, 4 th ln represents the fourth stem node from the bottom; Note: The experiment was set up with 6 biological replicates, and the error bar is the standard deviation; Scale bar, 10cm;

[0032] Figure 13Morphological analysis of the flag leaf and second leaflet from the top of the OsPUP5 knockout lineage was performed. A represents a comparison of flag leaf morphology between wild-type and knockout mutant lines; B represents statistical data on flag leaf length; C represents statistical data on flag leaf width; D represents a comparison of the second leaflet from the top of the OsPUP5 knockout mutant lines; E represents statistical data on the length of the second leaflet from the top of the OsPUP5 knockout mutant lines; F represents statistical data on the width of the second leaflet from the top of the OsPUP5 knockout mutant lines. Note: The experiment was conducted with 6 biological replicates, and the error bar is the standard deviation; scale bar: 10 cm.

[0033] Figure 14 The morphology of the panicle of the OsPUP5 knockout line was analyzed, where A is a comparison of the panicle morphology between the wild type and the knockout line; B is the statistical data of primary branches; C is the statistical data of secondary branches; D is the statistical data of the number of grains per panicle; E is the statistical data of the seed setting rate; Note: The experiment was set up with 6 biological replicates, the error bar is the standard deviation, and the scale bar is 10 cm.

[0034] Figure 15 The analysis included grain morphology of the OsPUP5 knockout lines. A represents a comparison of grain morphology between the wild type and the knockout lines; B represents statistical data on grain length; C represents statistical data on grain width; and D represents statistical data on grain thickness. Note: Grain morphology statistics were performed with 60 biological replicates; the error bar is the standard deviation; the scale bar is 1 cm; * indicates significant difference (P<0.05), and ** indicates extremely significant difference (P<0.01).

[0035] Figure 16 This study analyzed the expression levels of CKs-related type A response regulator genes in the first stem node after CK excitation in OsPUP5 overexpression lines. A represents the expression level of type A response regulator 1 (OsRR1); B represents the expression level of type A response regulator 2 (OsRR2); C represents the expression level of type A response regulator 4 (OsRR4); D represents the expression level of type A response regulator 6 (OsRR6); E represents the expression level of type A response regulator 7 (OsRR7); and F represents the expression level of type A response regulator 9 / 10 (OsRR9 / OsRR10). Note: The experiment was performed in triplicate, and the error bar is the standard deviation. * indicates significant difference (P<0.05), and ** indicates extremely significant difference (P<0.01).

[0036] Figure 17Quantification of cytokinins (CKs) in the first stem node after OsPUP5 overexpression in line OE1 and knockout in line KO1 was performed. A represents the correlation between OsPUP5 overexpression and knockout in N6-isopentenyladenine (iP); B represents the correlation between OsPUP5 overexpression and knockout in trans-zeatin (tZ); C represents the correlation between OsPUP5 overexpression and knockout in cis-zeatin (cZ); D represents the correlation between OsPUP5 overexpression and knockout in dihydrozeatin (DHZ); and E represents the total amount of different active forms of cytokinin in OsPUP5 overexpression and knockout lines. Note: The experiment was performed in three biological replicates, and the error bar represents the standard deviation. Different lowercase letters in the figure indicate significant differences (P < 0.05). Detailed Implementation

[0037] This invention provides the application of the OsPUP5 gene or its encoded protein OsPUP5 in regulating rice plant architecture and / or grain type.

[0038] In this invention, the gene number of the OsPUP5 gene is LOC_Os09g38510, and this information can be obtained from the Rice Genome Annotation Project (RGAP) website (http: / / rice.uga.edu / ). The OsPUP5 gene of this invention is located on chromosome 9, with a total length of 2675 bp, containing two exons and one intron, and a CDS length of 1167 bp. In this invention, the CDS sequence of the OsPUP5 gene is shown in SEQ ID NO.12, and the amino acid sequence encoding the OsPUP5 protein is shown in SEQ ID NO.13.

[0039] In this invention, the plant type preferably includes plant height and leaf type. In this invention, the OsPUP5 gene or its encoded protein OsPUP5 regulates the plant height by adjusting the spike length and internode length. In this invention, the leaves preferably include the flag leaf and the second leaf from the top; the leaf type preferably includes leaf length and leaf width. In this invention, the grain type preferably includes grain length, grain width, and grain thickness.

[0040] In this invention, the preferred method for reducing plant height is by overexpressing the OsPUP5 gene or increasing the expression level of the encoded protein OsPUP5. Reducing plant height effectively resists lodging, thereby avoiding yield reduction caused by rice lodging, and also improves the efficiency of mechanical harvesting. In this invention, the preferred expression vector used for overexpressing the OsPUP5 gene is pCAMBIA2301-ACTIN1.

[0041] In this invention, the preferred method is to reduce leaf length and width by overexpressing the OsPUP5 gene or increasing the expression level of the encoded protein OsPUP5. Reducing leaf length and width helps optimize canopy photosynthetic efficiency, enhance stress resistance, increase planting density, and reduce the incidence of pests and diseases.

[0042] In this invention, the preferred method is to increase grain length, reduce grain width, and reduce grain thickness by knocking out the OsPUP5 gene or reducing the expression level of the encoded protein OsPUP5. Increasing grain length and reducing grain width and thickness facilitates mechanized seed production of hybrid rice by utilizing the grain thickness differences between the parent lines. Narrow grain shape can reduce the broken rice rate during milling and increase the head rice rate. Moreover, slender grain shape is an important indicator of high-quality rice and has higher market value.

[0043] The application of this invention will help in rice gene editing, molecular marker-assisted breeding, and other fields, laying the foundation for the development of superior traits in rice.

[0044] This invention is the first to propose that OsPUP5 specifically participates in the transport of iP-type cytokinins (CKs), influencing longitudinal internode cell elongation and grain development by regulating the spatial distribution of CKs. Its function is tissue-specific and may affect overall CK homeostasis through root-crown signaling. Experimental results from this invention show that increased CK content in the penultimate stem node of overexpressing lines negatively impacts cell elongation, leading to a defective form with shorter stem nodes. This may be because OsPUP5 affects other hormonal pathways or inhibits the expression of genes related to cell growth and development, resulting in negative feedback regulation. In summary, the cell membrane-localized protein OsPUP5 regulates local CK homeostasis by actively transporting CKs or competitively inhibiting CK efflux.

[0045] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0046] Unless otherwise specified, the following embodiments are all conventional methods.

[0047] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0048] In the following examples, the experimental data are expressed as mean ± SE. Statistical analysis and analysis of variance were performed using DPS 7.05. P < 0.05 represents a significant difference and is marked with * in the figure; P < 0.01 represents a highly significant difference and is marked with ** in the figure. t-tests were performed using GraphPad Prism (8.01). Different lowercase letters in the figure indicate significant differences. Graphs were plotted using GraphPad Prism (8.01).

[0049] The rice plant material used in the following examples is the japonica rice variety Zhonghua 11 (ZH11). All rice materials were grown in suitable field conditions.

[0050] The *Escherichia coli* (DH5α) and *Agrobacterium* (AGL1) used in the following examples were purchased from Shanghai Weidi Biotechnology Co., Ltd. Overexpression vectors were constructed using pCAMBIA2301-ACTIN1, gene knockout was performed using pCHCRISPR / Cas9, GUS vectors were constructed using pCAMBIA2391Z, and subcellular localization vectors were constructed using pCAMBIA2300-35S-GFP and pCAMBIA2300-35S-RFP.

[0051] The rice growth conditions in the following examples were as follows: For rice strains requiring nutrient solution culture, healthy seeds were selected and soaked in water-filled plastic cups at 37°C until germination. Seeds with the same degree of sprouting were used, and the strains were arranged in sections on a bottomless 96-well plate, considered day 0 of the culture. The same amount of water was added to the culture box, and the box was placed in an incubator with uniform light. On the fourth day, the water in the culture box was replaced with Kimura B nutrient solution, and the Kimura B nutrient solution was refreshed every other day. The laboratory had a separate culture room, and the incubator was set to a room temperature of 28°C, with a light intensity of 540 μmol / m² under a 12h light / 12h dark cycle. 2 The relative humidity was 70%. The field conditions were suitable for rice growth, and the field experiment was carried out normally.

[0052] Example 1

[0053] The tissue expression patterns of OsPUP5 in different tissues of wild-type rice ZH11 were analyzed by qRT-PCR, as shown below:

[0054] 1.1 Total RNA extraction from rice

[0055] (1) After placing the mortar in liquid nitrogen for cold treatment, take an appropriate amount of rice sample and place it together with the liquid nitrogen in the mortar, and grind it quickly until it becomes a white and fine powder visible to the naked eye.

[0056] (2) Transfer the sample powder to a 2 mL RNase-free centrifuge tube that has been cooled with liquid nitrogen and labeled. Add 1 mL of Trizol (Invitrogen) to the tube and proceed to the next step in a fume hood. Beforehand, lower the centrifuge temperature to 4 °C, add 0.3 mL of chloroform to the tube, mix thoroughly using a laboratory vortex mixer, and then centrifuge at 12,000 rpm for 10 min.

[0057] (3) Prepare a new 1.5 mL RNase-free centrifuge tube and transfer 0.4 mL of supernatant into the new tube. Add 0.4 mL of isopropanol to the tube, shake to mix, and place it at room temperature or on ice for 30 min. Then, centrifuge the sample at 12000 rpm / min for 10 min at an operating temperature of 4°C.

[0058] (4) Remove the supernatant. First, wash the precipitate with 1 mL of 75% ethanol prepared with DEPC-H2O. After this step, put the sample back into the centrifuge and centrifuge for 5 min under the same operating parameters as before to remove excess washing liquid.

[0059] (5) After removing the supernatant and drying at room temperature, the precipitate in the tube is dissolved with 50 μL DEPC-H2O. After the precipitate is completely dissolved, the sample is placed in a -80℃ refrigerator for long-term preservation.

[0060] 1.2. Reverse Transcription PCR (RT-PCR)

[0061] The following steps were performed using the Novozymes HiScript IIQ Select RT SuperMix for qRT-PCR (+gDNAwiper) reverse transcription kit.

[0062] (1) Remove the RNA sample from -80℃ and place it in an ice box to thaw naturally. Calculate the required amounts beforehand, prepare the reaction system, and gently mix the system using a pipette until homogeneous. Place the system in a PCR instrument and incubate at the set temperature of 42℃ for 2 minutes. This step is to remove genomic gDNA.

[0063] (2) Prepare the reverse transcription solution system by adding 4 μL of 5×HiScriptⅡqRT SuperMixⅡ directly to 16 μL of the solution obtained in step (1) and mixing thoroughly.

[0064] (3) The mixed system was subjected to reverse transcription reaction in the order of 50℃ for 15 min and 85℃ for 5 sec.

[0065] 1.3 cDNA quality testing

[0066] Prepare the PCR reaction solution and set the required PCR reaction program. After the reaction program stops, verify the results by agarose gel electrophoresis. If bright bands are observed, the cDNA can be used for subsequent experiments, such as qRT-PCR. Dilute each cDNA tube with 80 μL of ddH2O, mix thoroughly, and store at -20°C in the corresponding compartment.

[0067] 1.4 Quantitative Real-time PCR (qRT-PCR)

[0068] In the qRT-PCR operation, UBIQUITIN2 was used as an internal control for expression analysis of all samples, and subsequent data processing was performed using the Comparative Ct method. In the qRT-PCR reaction, the primer pairs for qRT-OsPUP5 were CTGGTTCCATGACCCCATGA (SEQ ID NO.1) and CCAACCATGTAGGAGCCGAA (SEQ ID NO.2), and the primer pairs for the internal control UBIQUITIN2 were GAGCCCTCTGTTCGTCAAGTA (SEQ ID NO.3) and ACTCGATGGTCCATTAAACC (SEQ ID NO.4).

[0069] Three replicates were used for each sample loading, and the qRT-RCR reaction was carried out according to the procedure of 95℃, 15 min; 95℃, 10 sec; 60℃ extension for 30 sec; 35-40 cycles.

[0070] The experiment was set up with 3 biological replicates, and the results are as follows: Figure 1 As shown, OsPUP5 is expressed to varying degrees in mature roots, stems, leaves, leaf sheaths, and spikes of different lengths (1-2 cm, 3-4 cm, 4-5 cm, 10 cm, and 15 cm). The relative expression level of OsPUP5 is highest in mature roots and lowest in stems. Furthermore, its expression level is not uniform across the spike.

[0071] Example 2

[0072] A GUS expression vector driven by the promoter region 2000 bp upstream of the OsPUP5 start codon ATG was constructed and transformed into wild-type rice ZH11. The method is as follows:

[0073] First, the promoter sequence of OsPUP5 was found through the NCBI website, and GUS primers TACGCCAAGCTTGGCTGCAGTCTGGCTGTTCATGGGTTTA (SEQ ID NO.5) and CCGGGGATCCGTCGACCTGCCGCCGCCGCCGTCGGT (SEQ ID NO.6) were designed. PCR amplification was performed using rice ZH11 genomic DNA as a template. The GUS vector constructed using pCAMBIA2391Z was analyzed by agarose gel electrophoresis. After the reaction, the target fragment was obtained by gel recovery, and the vector was subsequently digested with enzymes and subjected to homologous recombination.

[0074] GUS staining was performed on tissues of the transgenic plants, including coleoptiles, young roots, stems, leaf sheaths, leaves, pulvinus, ligules, auricles, spikelets, stigmas, ovaries, and anthers. A GUS staining kit (Coolaber Biosciences) was used for the staining. A high-powered microscope was used for observation; the magnification was adjusted until the image was completely clear. Any blue areas were photographed for documentation; the GUS expression sites are the areas that appear blue.

[0075] The results are as follows Figure 2 As shown, OsPUP5 is expressed in all tissues.

[0076] Example 3

[0077] Response analysis of OsPUP5 to cytokinins (CKs)

[0078] N6-Isoprene adenine (iP), trans-zeatin (tZ), and cis-zeatin (cZ) are three bioactive CKs that can be synthesized endogenously in rice. To investigate whether OsPUP5 responds to CKs, the expression of OsPUP5 in wild-type ZH11 rice treated with different CKs was analyzed. The specific methods are as follows:

[0079] Wild-type (ZH11) plants grown hydroponically at room temperature for 10 days were treated with exogenous CKs. The control culture box used Kimura B nutrient solution, while the other three culture boxes used solutions containing Kimura B nutrient solution supplemented with iP, tZ, and cZ exogenous hormones, respectively, ensuring a hormone concentration of 1 μM in each box. To ensure treatment only on the seedling roots, the solution volume in the culture boxes was only 2 / 3 of the box volume. Four hours after root treatment, samples were taken from the aboveground and underground parts (three biological replicates per group) and analyzed using qRT-PCR.

[0080] The results are as follows Figure 3 The results show that, compared with the control group which contained only nutrient solution in the hydroponic box, cZ significantly downregulated the mRNA abundance of OsPUP5 in the roots. Figure 3 In A), while iP significantly induced the expression of OsPUP5 in the aboveground parts ( Figure 3 (B in the middle).

[0081] Example 4

[0082] OsPUP5 is located on the cell membrane.

[0083] Subcellular localization of proteins is crucial for their function. To analyze the subcellular localization of OsPUP5, the OsPUP5 protein was labeled with a green fluorescent protein (GFP) tag, and the OsPUP5 subcellular localization vector GFP-OsPUP5 was constructed as follows:

[0084] Primers for subcellular localization based on the OsPUP5 CDS sequence were designed as follows: CAAGGAGCTCGGATCCATGGAGAGGAACCAGCACCG (SEQ ID NO.7) and GCAGGTCGACTCTAGATCAATTTGTG GATGCTTTCT (SEQ ID NO.8). PCR amplification was performed using rice ZH11 cDNA as a template. The restriction endonucleases used to construct the subcellular localization vector were BamHI and XbaI, which were used to digest the vector pCAMBIA2300-35S-GFP, followed by homologous recombination. The marker for co-localization, OsPUP4-RFP, was provided by Professor Xiao Yunhua of Hunan Agricultural University.

[0085] The corresponding vectors were introduced into tobacco epidermal cells and rice protoplasts for analysis. GFP-OsPUP5 was first transformed into tobacco epidermal cells using Agrobacterium, and the fluorescence signal was detected using confocal laser scanning microscopy. The results are as follows: Figure 4 As shown, the fluorescence signal of OsPUP5 is uniformly distributed in the cell membrane region, preliminarily confirming that OsPUP5 is located in the cell membrane. Figure 4 (A in the original text). To further verify this result, the cell membrane marker protein fused with the known red fluorescent protein RFP-OsPUP4 was co-expressed in rice protoplasts. The results showed that the green fluorescence signal of the OsPUP5 fusion protein highly matched the red fluorescence signal of the OsPUP4 fusion protein. Figure 4 (B in the text). The results showed that OsPUP5 is located in the cell membrane, which is consistent with the protein prediction.

[0086] Example 5

[0087] Effects of OsPUP5 overexpression on rice growth and development

[0088] 1. Overexpression of OsPUP5 affects rice plant height

[0089] To investigate the regulatory function of the OsPUP5 gene in rice growth and development, transgenic plants overexpressing OsPUP5, driven by the strong promoter ACTIN1, were created using wild-type (ZH11) as the background. After pure line screening using G418 and positive identification, two positive overexpression lines were selected for further research. These two OsPUP5 overexpression lines are abbreviated as OE1 and OE2. The transcriptional level of OsPUP5 in the overexpression lines was detected by qRT-PCR (same as in Example 1). The specific method for constructing the OsPUP5 overexpression vector is as follows:

[0090] First, CDS sequences were searched on the RGAP website, and primers CCGGGGATCCTCTAGAATGGAGAGGAACCAGCACCG (SEQ ID NO.9) and AAAGCAGGGCATGCCTGCAGTCAATTTGTGGATGCTTTCT (SEQ ID NO.10) were designed and used to construct the OsPUP5 overexpression vector. OsPUP5-OE was amplified by PCR using rice ZH11 cDNA as a template. After the reaction, the results were analyzed by agarose gel electrophoresis imaging, and the target fragment was obtained by gel recovery. The vector pCAMBIA2301-ACTIN1 was digested with restriction endonucleases XbaⅠ and PstⅠ, followed by homologous recombination.

[0091] The method for screening pure lines of overexpression plants is as follows: Prepare clean petri dishes and line them with filter paper. Soak the seeds to be screened for purity in advance to allow them to germinate naturally. Label the petri dishes, and select no fewer than 30 fully sprouted seeds from each dish. Pour in a 100 mg / L G418 solution to completely submerge the seeds. After preparation, set the temperature to a constant 30℃ and wait for it to stabilize before transferring the petri dishes to a constant-temperature environment to allow them to grow. Observe daily to ensure the solution in the petri dishes has completely evaporated to prevent the seeds from drying out due to lack of solution. After about one week, calculate the seedling rate. Use the complete seedling emergence of all seeds in the petri dish as the standard for screening pure lines.

[0092] The results are as follows Figure 5 As shown, wild-type (WT) cells overexpressed both OE1 and OE2. Specifically, OE1 expression was increased by 1033.6 times compared to WT, and OE2 was overexpressed by 954.4 times. Figure 5 By measuring the plant height and effective panicle number of mature plants under normal field growth conditions, the results showed that compared with the wild-type plant WT, the plant height of OE1 was reduced by 29.63% and the plant height of OE2 was reduced by 31.28%. The plant height of the two overexpression lines OE1 and OE2 was significantly reduced compared with WT, while the effective panicle number did not change significantly.

[0093] 2. Shortened panicle length and internode length in rice lead to shorter plant height in OsPUP5 overexpression lines.

[0094] To investigate the possible reasons why OsPUP5 overexpression leads to dwarfing, the length of some stem segments in mature wild-type plants and two overexpression lines was measured. The results are as follows: Figure 6 As shown, the spike length, length of the first, second, third, and fourth internodes of the main tillers of OE1 and OE2 were all significantly lower than those of WT.

[0095] 3. Overexpression of OsPUP5 shortens the internode length due to shortened stem cells.

[0096] To analyze the possible reasons for the shortened internodes at the cellular level, longitudinal sections of the first internode from the bottom of the wild-type and overexpression lines were prepared and analyzed using paraffin sectioning techniques. The cell lengths in longitudinal sections of the first internode from the bottom of ZH11 and the overexpression lines (OE1, OE2) were measured. Results are as follows: Figure 7 As shown, compared with WT, the cell length in the first internode of the overexpressing lines was significantly reduced, indicating that OsPUP5 overexpression leads to shorter internode cell length in rice plants.

[0097] 4. Overexpression of OsPUP5 affects the length and width of the flag leaf and the second leaf from the top in rice.

[0098] Functional leaves are crucial for photosynthesis during rice growth and development. Therefore, the length and width of the flag leaf and second leaf from the top of the tillers of the normally growing OsPUP5 overexpressing lines OE1 and OE2 in the field were measured. The results are as follows: Figure 8 As shown, compared with WT, the length and width of the flag leaf, the length of the second leaf from the top, and the width of the second leaf from the top were all significantly reduced in OsPUP5 overexpression plants. This indicates that overexpression of OsPUP5 has a significant impact on the flag leaf and the second leaf from the top in rice, suggesting that overexpression of the OsPUP5 gene can affect the morphological changes of functional leaves in rice.

[0099] 5. Overexpression of OsPUP5 affects rice seed setting rate

[0100] The spikelet traits of the main spikelets of the OsPUP5 overexpressing lines OE1 and OE2 at maturity were measured, and the results are as follows: Figure 9 As shown, compared with WT, OE1 showed no significant differences in primary branches, secondary branches, and the number of grains per ear, but its seed setting rate was significantly lower. Compared with WT, OE2 had fewer primary branches, but no significant differences in secondary branches and the number of grains per ear, and its seed setting rate, like OE1, showed a significantly lower rate.

[0101] 6. Overexpression of OsPUP5 affects rice grain size

[0102] To investigate the effects of OsPUP5 overexpression on grain morphology and weight, the length, width, thickness, and thousand-grain weight of the grains from the OsPUP5 overexpression lines OE1 and OE2 were measured. The results are as follows: Figure 10 As shown, compared with WT, there was no significant difference in grain length between the two overexpression lines OE1 and OE2, but the grain width and thickness of both overexpression lines decreased significantly. Compared with WT, the grain width of OE1 decreased by 7.34% and the grain thickness decreased by 7.78%; the grain width of OE2 decreased by 6.74% and the grain thickness decreased by 7.99%.

[0103] Example 6

[0104] Effects of OsPUP5 gene knockout on rice growth and development

[0105] 1. Knocking out OsPUP5 does not affect rice plant height.

[0106] 2. Using the design website CRISPR-GE (http: / / skl.scau.edu.cn / ), after determining the coding region sequence of the OsPUP5 gene, the sgRNA sequence was designed using the website. The sgRNA sequence is GAGAGGAACCAGCACCGCGA (SEQ ID NO. 11). Two different types of OsPUP5 gene knockout homozygous and mutant lines were created using CRISPR / Cas9 technology, abbreviated as KO1 and KO2. The KO1 mutant has a frameshift mutation due to the insertion of a C base at position 21 bp in the coding region, while the KO2 mutant has a frameshift mutation due to the deletion of a G base at position 20 bp in the coding region (see [link to CRISPR-GE website]). Figure 11 In section A), the method for constructing the CRISPR / Cas9 knockout mutant vector of OsPUP5 is as follows:

[0107] Rice plant height and effective panicle number are closely related to yield. By measuring the plant height and effective panicle number of two gene knockout materials under normal field growing conditions, the results were found to be significantly different from those of the overexpression lines (see...). Figure 11 B in Figure 11 (D in the text). Compared with WT, the plant height of the KO1 mutant did not change significantly, but the number of effective panicles decreased significantly, while the plant height and number of effective panicles of the KO2 mutant did not change significantly. This indicates that knocking out OsPUP5 has little effect on rice plant height.

[0108] 3. No significant changes were observed in spike length and internode length in plants with OsPUP5 knocked out.

[0109] Internode length plays a decisive role in plant height in rice. To further verify that the plant height of KO1 and KO2 did not change significantly compared with WT, the panicle length, the length of the first internode from the bottom, the second internode from the bottom, the third internode from the bottom, and the fourth internode from the bottom of the two mutant plants were further measured. The results are as follows: Figure 12 As shown, the spike length and internode length of KO1 and KO2 did not change significantly compared with WT, which confirms that knocking out OsPUP5 has no significant effect on plant height.

[0110] 4. Knocking out OsPUP5 does not affect the length and width of the flag leaf and the second leaf from the top in rice.

[0111] The photosynthesis of functional leaves in rice plants plays a crucial role in grain filling, ripening, and grain weight. Therefore, the length and width of the flag leaf and the second leaf from the top were measured in rice plants with knockout mutants WT, KO1, and KO2. The results are as follows: Figure 13 As shown, the length and width of the flag leaf and second leaf from the top were not significantly different between the two knockout mutants and the WT mutant. This indicates that knocking out OsPUP5 has no significant effect on the length and width of the flag leaf and second leaf from the top in rice plants.

[0112] 5. Knocking out OsPUP5 does not affect the rice seed setting rate.

[0113] To further investigate whether OsPUP5 knockout affects ear traits, the primary and secondary branches, number of grains per ear, and seed setting rate were measured in WT and knockout lines. The results are as follows: Figure 14 As shown, there were no significant differences between KO1 and KO2 and WT in terms of primary branches, secondary branches, number of grains per ear, and seed setting rate.

[0114] 6. Knocking out OsPUP5 affects rice grain shape

[0115] Further measurements of the grain length, grain width, and grain thickness of the knockout mutants KO1 and KO2 were performed, and the results are as follows: Figure 15 As shown, using WT as a control, the knockout mutants KO1 and KO2 showed significantly increased granule lengths of 5.38% and 5.17%, respectively, while granule width and thickness decreased significantly. Compared to WT, KO1 showed a 2.64% decrease in granule width and a 4.31% decrease in granule thickness; compared to WT, KO2 showed a 2.35% decrease in granule width and a 3.29% decrease in granule thickness.

[0116] Example 7

[0117] Overexpression of OsPUP5 led to increased expression levels of CKs response genes in the first to last stem node.

[0118] To further verify whether the shortening of stem segments in OsPUP5 overexpression materials is related to changes in CKs, the expression levels of CKs-related type A response regulators (OsRR1, OsRR2, OsRR4, OsRR6, OsRR7, OsRR9 / OsRR10) in the first stem segment from the bottom of WT and OsPUP5 overexpression lines OE1 and OE2 (obtained in Example 5) were detected. The results are as follows: Figure 16 As shown, compared with WT, the expression levels of OsRR1, OsRR2, OsRR4, OsRR6, OsRR7, and OsRR9 / OsRR10 were significantly upregulated in the first stem node after OsPUP5 overexpression, indicating that OsPUP5 overexpression caused changes in the expression of CKs response genes in rice.

[0119] Example 8

[0120] OsPUP5 affects the CKs content in the first-to-last stem node.

[0121] To investigate whether OsPUP5 is involved in CK transport or signal transduction in rice plants, the contents of relevant CK forms in the first stem node from the bottom of wild-type ZH11 (WT), OE1 (obtained in Example 5), and KO1 (obtained in Example 6) plants were determined. Liquid chromatography-tandem mass spectrometry (LC-MS / MS) analysis showed that different variations in the contents of 14 relevant CK forms were quantified in the first stem node from the bottom of WT, OE1, and KO1 rice plants, as shown in Table 1.

[0122] analyze Figure 17 As can be seen from the comparison with WT, the contents of iP, iPR, and iP7G in the first node after the fall of OE1 plants did not change significantly, while the contents of iPRMP, tZ, tZR, tZRMP, cZ, cZR, tZ9G, cZROG, DHZ7G, and DHZROG all increased significantly, and the content of 2MeScZR decreased significantly. Overall, compared with WT, overexpression of OsPUP5 increased the total CKs content in the first node after the fall. Changes in the contents of various forms of CKs in the first node after the fall of rice can enhance or inhibit their function. Compared with the contents measured in the first node after the fall of WT, the contents of tZ, tZR, tZRMP, cZ, cZR, and DHZ7G in the first node after the fall of KO1 plants did not change significantly, while the contents of iP, iPR, iP7G, iPRMP, 2MeScZR, tZ9G, cZROG, and DHZROG all increased significantly. Overall, knocking out OsPUP5 resulted in a lower total CK content in the first-to-last stem node than in the total WT, showing the opposite trend to that of CK in the first-to-last stem node of OE1.

[0123] Table 1. Compounds detected in the last stem node of rice.

[0124] Serial Number English name Abbreviation Chinese name 1 N6-isopentenyladenine IP N6-Isopenteneadenine 2 N6-Isopentenyl-adenine-7-glucoside iP7G Isoprene adenine-7-glucoside 3 N6-isopentenyladenosine IPR Isoprene adenine nucleoside 4 N-6-iso-pentenyladenosine-5'-monophosphate iPRMP N-6-Isopentenyladenosine 5'-monophosphate 5 trans-Zeatin tZ trans-zeatin 6 trans-Zeatin-9-glucoside tZ9G trans-zeatin-9-glycoside 7 trans-Zeatinriboside tZR Zeatin nucleoside 8 9-Ribosyl-trans-zeatin5'-monophosphate tZRMP trans-zeatin-9-glycoside-5'-monophosphate 9 cis-Zeatin cZ cis-zeatin 10 cis-Zeatinriboside cZR cis-zeatin-D-riboglycoside 11 cis-Zeatin-O-glucosideriboside cZROG cis-zein-O-glycoside 12 2-Methylthio-cis-zeatinriboside 2MeScZR 2-Methylthiocis-Zeitin Nucleoside 13 Dihydrozeatin-7-glucoside DHZ7G Dihydrozein-7-glycoside 14 Dihydrozeatin-O-glucosideriboside DHZROG dihydrozeatin-O-glycoside

[0125] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of the OsPUP5 gene or its encoded protein OsPUP5 in regulating rice plant architecture, characterized in that, The CDS sequence of the OsPUP5 gene is shown in SEQ ID NO.12; the plant type includes plant height and leaf type; the leaf type includes leaf length and leaf width; the plant height is reduced by overexpressing the OsPUP5 gene or increasing the expression level of the encoded protein OsPUP5; the leaf length and leaf width are reduced by overexpressing the OsPUP5 gene or increasing the expression level of the encoded protein OsPUP5.

2. The application of the OsPUP5 gene or its encoded protein OsPUP5 in regulating rice grain shape, characterized in that, The CDS sequence of the OsPUP5 gene is shown in SEQ ID NO.12; the grain shape includes grain length, grain width and grain thickness; knocking out the OsPUP5 gene or reducing the expression level of the encoded protein OsPUP5 can increase grain length, reduce grain width and reduce grain thickness.

3. The application according to claim 1, characterized in that, The plant height is controlled by adjusting the spike length and internode length.

4. The application according to claim 1, characterized in that, The leaves include sword-shaped leaves and penultimate leaves.