Application of elicitor peptide MsPep in improving genetic transformation efficiency of Medicago sativa

Abstract

The present application relates to the technical field of elicitor peptide MsPep and its application, and discloses the use of elicitor peptide MsPep in improving the genetic transformation efficiency of alfalfa, wherein the application takes the leaf of alfalfa as an explant, introduces an exogenous gene through Agrobacterium tumefaciens, and adds the elicitor peptide MsPep in each stage of genetic transformation, so as to significantly improve the dedifferentiation rate, the out-growth rate, the differentiation rate, the out-bud rate, the rooting rate and the transformation efficiency, and shorten the transformation period, and the present application has application prospect in improving the genetic transformation of alfalfa and other plants.

Description

Technical Field

[0001] This invention relates to the exciton peptide MsPep and its applications, specifically to the use of the exciton peptide MsPep in improving the genetic transformation efficiency of alfalfa. Background Technology

[0002] Alfalfa, the most widely cultivated and economically valuable legume forage crop globally, is hailed as the "King of Forages" due to its exceptional yield, rich nutritional value, and superior nitrogen-fixing and soil-improving capabilities. It plays a crucial role in the sustainable development of global livestock farming and ecological restoration. To further unlock its production potential and target key agronomic traits for improvement, such as enhancing drought resistance, salt tolerance, cold resistance, and disease and pest resistance, or optimizing its protein and lignin content to improve feed quality, genetic engineering technology has become an indispensable core driving force in modern breeding. Specifically, this involves using Agrobacterium tumefaciens (Agrobacterium tumefaciens)... Agrobacterium tumefaciens Genetic transformation mediated by RNA interference (RNA) involves introducing a target vector into the alfalfa genome for overexpression, RNA interference, or gene editing, and is currently an effective technical approach for creating novel germplasm resources. At present, those skilled in the art have established alfalfa genetic transformation systems, typically using explants such as leaves and hypocotyls, infecting them with Agrobacterium containing the vector, and then conducting multi-stage culture on a series of media containing selection agents and plant hormones. This involves dedifferentiation, callus induction, somatic embryogenesis and differentiation, and seedling rooting and strengthening, ultimately obtaining transgenic or gene-edited positive plants. However, this method suffers from low transformation efficiency and a long transformation cycle.

[0003] Plant elicitor peptides (PEPs) are endogenous danger signaling molecules that play a crucial role in immune regulation. Their expression is induced by biotic or abiotic stresses, enhancing plant stress tolerance; for example, exogenous application of rice OsPep3 significantly improves disease resistance in rice. In recent years, this peptide has been found in tomatoes to act as a systemin-independent local wound signaling molecule, promoting callus regeneration. However, research on the application of alfalfa elicitor peptide MsPep in alfalfa genetic transformation is almost nonexistent. Summary of the Invention

[0004] The main objective of this invention is to apply the alfalfa elicitor peptide MsPep to all stages and steps of alfalfa genetic transformation, overcoming the shortcomings of existing technologies such as low alfalfa transformation efficiency and long regeneration cycle, and providing efficient and reliable technical support for cultivating new alfalfa varieties with strong stress resistance and excellent quality.

[0005] To achieve the above-mentioned technical objectives, the technical solution adopted by the present invention is as follows:

[0006] The application of elicitor peptide MsPep in improving the genetic transformation efficiency of alfalfa, which takes the leaves of alfalfa as explants, introduces exogenous genes through the way of Agrobacterium tumefaciens mediation, and adds and applies the elicitor peptide MsPep with the amino acid sequence shown in SEQ ID NO: 2, specifically: NISSMGRGGPRRTPLTQGPPPQHN, in the culture medium in multiple culture stages of genetic transformation, and the application comprises the following steps:

[0007] S1, preparing and pretreating the explants;

[0008] S2, activating the Agrobacterium strain EHA105 or GV3101 containing the target vector and preparing the infection solution;

[0009] S3, using a physical enhancement method to infect the explants to introduce the Agrobacterium tumefaciens into the inside of the explants;

[0010] S4, transferring the infected explants to the co-culture medium added with the first preset concentration of elicitor peptide MsPep for co-culture;

[0011] S5, transferring the co-cultured explants to the selection medium added with the second preset concentration of elicitor peptide MsPep for resistance dedifferentiation screening to obtain resistance dedifferentiated explants;

[0012] S6, transferring the resistance dedifferentiated explants to the callus culture medium added with the third preset concentration of elicitor peptide MsPep for culture to induce the resistance dedifferentiated explants to differentiate into resistance callus;

[0013] S7, transferring the resistance callus to the differentiation culture medium added with the fourth preset concentration of elicitor peptide MsPep for culture to induce the resistance callus to differentiate into resistance bud points;

[0014] S8, transferring the explants with resistance bud points to the bud culture medium added with the fifth preset concentration of elicitor peptide MsPep and the rooting culture medium added with the sixth preset concentration of elicitor peptide MsPep for culture to obtain complete regenerated plants;

[0015] S9, identifying the positive seedlings;

[0016] Wherein, the preset concentration of the elicitor peptide MsPep is 1.0-10 nanomole per liter.

[0017] Further, the step of preparing and pretreating the explants comprises:

[0018] (1) Take the fresh leaves of Zhongmiao No. 1 growing healthily in the soil basin, wash them with distilled water for three times, and then move them to the sterilized tissue culture bottle;

[0019] (2) Perform disinfection and sterilization treatment in the super-clean bench: after treating the leaves with 1% sodium hypochlorite solution containing 0.1% Tween 20 for 2 minutes, wash the leaves once with sterile water, continue to treat the leaves with 75% alcohol for 5 minutes, and then wash the leaves 6-8 times with sterile water, each time for no less than 2 minutes.

[0020] Further, the step of preparing the infection solution comprises:

[0021] (1) Select Agrobacterium strain EHA105 or GV3101 containing the target vector, inoculate it into a 500 ml conical flask containing 100 ml of liquid YEB medium containing 50 μg / ml kanamycin (Kan) and 20 μg / ml rifampicin (Rif), and place it in a 28°C, 200 rpm shaker for 16-20 hours of vibration culture, until the optical density value (OD 600 ) of the bacterial solution reaches 0.6-0.8;

[0022] (2) Centrifuge the cultured bacterial solution at 8000 rpm for 10 minutes at 4°C, discard the supernatant to collect the bacterial body, resuspend the bacterial body precipitate with sterile liquid MS basic medium (without any plant hormone), and accurately adjust the volume of the bacterial solution by spectrophotometer, so that the final OD 600 value is 0.3-0.4.

[0023] Further, the specific operation of the physical enhancement method for infecting the explant is:

[0024] (1) Submerge the explant in the infection solution containing Agrobacterium tumefaciens, and perform the first vacuum infiltration treatment on the mixed system of the explant and the infection solution, the vacuum infiltration treatment is: maintaining 10 minutes under the condition of vacuum degree of 620 mm Hg;

[0025] (2) Immediately after the first vacuum infiltration treatment, the mixed system is subjected to ice water bath ultrasonic oscillation for 2-3 minutes, the frequency of the ultrasonic treatment is 40 kHz, and the power is 110 W;

[0026] (3) Immediately after the ultrasonic treatment, the mixed system is subjected to the second vacuum infiltration treatment, the vacuum infiltration treatment is: maintaining 10 minutes under the condition of vacuum degree of 620 mm Hg;

[0027] (4) After standing for 5 minutes, use sterile filter paper to absorb the excess bacterial solution attached to the surface of the explant.

[0028] Further, the formula of the co-culture medium comprises 4.43 g / L MS, 30 g / L sucrose, 4.0 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 0.4 mg / L 6-benzyladenine (6-BA), 1.0 nM / L of the elicitor peptide MsPep, and 3.5 g / L phytagel;

[0029] The condition of the co-culture is that the infection-completed explant is contacted with the co-culture medium with the leaf back facing down, and is dark cultured for 2 days in an artificial intelligent climate box with a temperature of 24°C and a humidity of 60%.

[0030] Further, the formula of the screening medium comprises 4.43 g / L MS, 30 g / L sucrose, 4.0 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 0.2 mg / L 6-benzyladenine (6-BA), 200 mg / L cefotaxime (Cef), 200 mg / L timentin (Tim), 1.0 nM / L of the elicitor peptide MsPep, and 3.5 g / L phytagel;

[0031] The condition of the screening culture is that it is dark cultured for 14 days in an artificial intelligent climate box with a temperature of 24°C and a humidity of 60%.

[0032] Further, the formula of the callus culture medium comprises 4.43 g / L MS, 30 g / L sucrose, 2.0 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 0.2 mg / L 6-benzyladenine (6-BA), 200 mg / L cefotaxime (Cef), 200 mg / L timentin (Tim), 1.0 nM / L of the elicitor peptide MsPep, and 3.5 g / L phytagel;

[0033] The condition of the callus culture is that it is normally cultured for 13 days in an artificial intelligent climate box with a temperature of 24°C, a humidity of 60%, and a light cycle of 8 h light / 16 h dark.

[0034] Further, the formula of the differentiation medium comprises 4.43 g / L MS, 30 g / L sucrose, 1.0 mg / L kinetin (KT), 200 mg / L cefotaxime (Cef), 200 mg / L timentin (Tim), 1.0 nM / L of the elicitor peptide MsPep, and 3.5 g / L phytagel;

[0035] The condition of the differentiation culture is that it is normally cultured for 13 days in an artificial intelligent climate box with a temperature of 24°C, a humidity of 60%, and a light cycle of 8 h light / 16 h dark.

[0036] Further, the step of obtaining the complete regenerated plant comprises:

[0037] (1) bud culture: the explant with the resistant bud spot is transferred to the bud culture medium, and the formula of the bud culture medium comprises 4.43 g / L of MS, 30 g / L of sucrose, 200 mg / L of cefotaxime (Cef), 200 mg / L of timentin (Tim), 1.0 nmol / L of elicitor peptide MsPep, and 3.5 g / L of phytagel;

[0038] (2) rooting culture: when the resistant bud spot is elongated to form a regenerated seedling with a height of 2-3 cm, the regenerated seedling is cut off and transferred to the rooting culture medium, and the formula of the rooting culture medium comprises 4.43 g / L of MS, 30 g / L of sucrose, 0.5 mg / L of indole-3-acetic acid (IAA), 200 mg / L of cefotaxime (Cef), 1.0 nmol / L of elicitor peptide MsPep, and 3.5 g / L of phytagel.

[0039] Further, the step of identifying the positive seedling comprises:

[0040] (1) 0.1 g of tender leaf of the regenerated plant with good rooting is rapidly frozen in liquid nitrogen and ground into powder, and the genomic DNA of the plant is extracted by using a plant genomic DNA extraction kit;

[0041] (2) the extracted genomic DNA is used as a template, and specific primers Bar-F and Bar-R are used for PCR amplification detection, the nucleic acid sequence of the specific primer Bar-F is shown in SEQ ID NO: 3, and is specifically ATGAGCCCAGAACGACGC, and the nucleic acid sequence of the specific primer Bar-R is shown in SEQ ID NO: 4, and is specifically TCACATCTCGGTGACGGGC.

[0042] The beneficial effects of the present application are:

[0043] The application applies MsPep throughout multiple key stages such as co-cultivation, callus induction, differentiation, sprouting and rooting, and forms a complete and coordinated technical solution. This systematic application makes the improvement of transformation efficiency show a superimposed and amplified effect, and finally realizes the overall improvement of transformation efficiency, regeneration rate and plant quality. Through the above-mentioned systematic optimization, the dedifferentiation rate can be significantly improved from 57.08% to 77.43%, the callus formation time can be shortened from 16 days to 13 days, the sprouting rate can be significantly improved from 58.2% to 66.86%, the rooting rate can be significantly improved from 38.20% to 56.78%, and finally the genetic transformation efficiency reaches 47.9%, which is significantly improved by 59.7% compared with 30% without adding polypeptide. The application not only provides alfalfa elicitor peptide MsPep, but also provides that the peptide significantly improves the genetic transformation efficiency of Medicago sativa and shortens the cycle. BRIEF DESCRIPTION OF DRAWINGS

[0044] Figure 1 The result graph for purity detection of alfalfa elicitor peptide MsPep in Example 2.

[0045] Figure 2 The result graph for molecular weight verification of alfalfa elicitor peptide MsPep in Example 2.

[0046] Figure 3 The result graph for verifying the influence of different added amounts of elicitor peptides on dedifferentiation rate in Example 3.

[0047] Figure 4 The result graph for verifying the influence of different added amounts of elicitor peptides on callus formation time in Example 4.

[0048] Figure 5 The result graph for verifying the influence of different added amounts of elicitor peptides on differentiation rate in Example 5.

[0049] Figure 6 The result graph for verifying the influence of different added amounts of elicitor peptides on sprouting rate in Example 6.

[0050] Figure 7 The result graph for verifying the influence of different added amounts of elicitor peptides on rooting rate in Example 7.

[0051] Figure 8 Application of MsPep polypeptide for improving genetic transformation efficiency of Medicago sativa. DETAILED DESCRIPTION

[0052] In order to enable personnel in the technical field to better understand the technical solutions in the application, the following will further describe the application in combination with examples.

[0053] Example 1: Isolation and identification of alfalfa elicitor peptide MsPep sequence

[0054] MsPep was isolated and identified from the alfalfa genome through sequence alignment. An upstream primer MsPep-F (as shown in SEQ ID: 5, specifically: AATATAGTTCAATGGGAAG) and a downstream primer MsPep-R (as shown in SEQ ID: 6, specifically: TTATTATGTTGAGGTGGTG) were designed. The MsPep1-F / R primer pair was used to amplify the corresponding sequence of MsPep by PCR with alfalfa cDNA as a template. The high-fidelity enzyme 2xPhanta Flash Master Mix (catalog number: P520) from Novizan Biosciences was selected for the PCR reaction to ensure the fidelity of the amplification product. After PCR electrophoresis, the PCR products were sent to the company for sequencing. The sequencing results of the PCR products are shown in SEQ ID NO:1, specifically: AATATAAGTTCAATGGGAAGGGGTGGTCCTCGAAGGACTCCACTTACACAAGGTCCACCACCTCAACATAATTAA, which is the sequence of MsPep. The amino acid sequence of MsPep is shown in SEQ ID NO:2, specifically: NISSMGRGGPRRTPLTQGPPPQHN.

[0055] Example 2 Synthesis of alfalfa elicitor peptide MsPep

[0056] The synthesis of peptide MsPep can be performed using microorganisms such as prokaryotic Escherichia coli, fungi, and yeasts, or using Fmoc solid-phase synthesis technology, completed using an Applied Biosystems 431 synthesizer. The synthesis consists of the following cycles: Deprotection: The Fmoc-protected column and monomer must have the amino protecting group removed using an alkaline solvent (piperidine); Activation and Crosslinking: The carboxyl group of the next amino acid is activated by an activator. The activated monomer reacts with the free amino group to crosslink, forming a peptide bond. A large amount of ultra-concentrated reagent is used to drive the reaction in this step. Cycling: These two steps are repeated until synthesis is complete; Elution and Deprotection: The peptide is eluted from the column, and its protecting group is eluted and deprotected using a deprotecting agent (TFA). The synthesized peptide is purified and detected by C18 reversed-phase high-performance liquid chromatography, and its molecular weight is verified by direct injection using a Finnigan LCQ mass spectrometer.

[0057] Testing showed that the synthesized MsPep amino acid sequence was correct, with a purity of over 96%, and minor impurities (<4%) did not affect its biological activity, meeting the quality standards for subsequent genetic transformation experiments. Figure 1Secondly, the molecular weight verification of bioactive peptides typically requires an error of <0.1% (high-precision mass spectrometry) or <0.5% (conventional mass spectrometry). This data has an error of only 0.027%, fully meeting the requirements. Figure 2 ).

[0058] Example 3: Verification of the effect of the elicitor peptide MsPep on the dedifferentiation rate of alfalfa leaves

[0059] 1. Explants, processing, and preparation:

[0060] (1) Take fresh leaves of healthy alfalfa No. 1 growing in soil pots, rinse them three times with distilled water and then transfer them to sterilized tissue culture bottles;

[0061] (2) Disinfection and sterilization treatment in a clean bench: After treating the leaves with a 1% sodium hypochlorite solution containing 0.1% Tween 20 for 2 minutes, rinse the leaves with sterile water once. Continue to treat the leaves with 75% alcohol for 5 minutes, and then rinse the leaves with sterile water 6 to 8 times. Each rinse with sterile water should last for no less than 2 minutes.

[0062] 2. Preparation of the inoculum:

[0063] (1) Select Agrobacterium strain EHA105 or GV3101 containing the target vector, inoculate it into a 500 mL Erlenmeyer flask containing 100 mL of liquid YEB medium containing 50 μg / mL kanamycin (Kan) and 20 μg / mL rifampicin (Rif), and incubate in a shaker at 28°C and 200 rpm for 16 to 20 hours until the optical density (OD) of the bacterial solution reaches the specified value. 600 The value reached 0.6 to 0.8.

[0064] (2) Centrifuge the cultured bacterial solution at 8000 rpm for 10 minutes at 4°C, discard the supernatant to collect the bacterial cells, resuspend the bacterial cell pellet in sterile liquid MS basal medium (without any plant hormones), and precisely adjust the volume of the bacterial solution using a spectrophotometer to achieve the final OD600. 00 The value is 0.3-0.4.

[0065] 3. Infection:

[0066] (1) Immerse the explant in an infection solution containing Agrobacterium tumefaciens and perform a first vacuum permeation treatment on the mixture of the explant and the infection solution. The vacuum permeation treatment is performed by maintaining a vacuum of 620 mmHg for 10 minutes.

[0067] (2) Immediately after the first vacuum permeation treatment, the mixture is subjected to ice-water bath ultrasonic oscillation for 2-3 minutes. The frequency of the ultrasonic treatment is 40 kHz and the power is 110 W.

[0068] (3) Immediately after ultrasonic treatment, the mixture is subjected to a second vacuum permeation treatment, which is to maintain a vacuum of 620 mmHg for 10 minutes.

[0069] (4) After standing for 5 minutes, use sterile filter paper to absorb the excess bacterial solution attached to the surface of the explant.

[0070] 4. Co-cultivation:

[0071] The infected explants were placed in contact with the co-culture medium with the leaf abaxial surface facing down and cultured in the dark for 2 days in an AI climate chamber at 24°C and 60% humidity. The co-culture medium consisted of: 4.43 g / L MS, 30 g / L sucrose, 4.0 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 0.4 mg / L 6-benzyladenine (6-BA), and 3.5 g / L plant gel. 0 nM, 1 nM, and 10 nM elicitor peptide MsPep were then added, respectively, with no peptide added serving as a control (see Table 1).

[0072] Table 1 Experimental design of co-culture medium

[0073]

[0074] 5. Screening and cultivation:

[0075] The co-cultured explants were transferred to selection medium and cultured in the dark for 14 days in an AI climate chamber at 24°C and 60% humidity. The selection medium consisted of: 4.43 g / L MS, 30 g / L sucrose, 4.0 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 0.2 mg / L 6-benzyladenine (6-BA), 200 mg / L cephalosporin (Cef), 200 mg / L termethin (Tim), and 3.5 g / L plant gel. 0 nM, 1 nM, and 10 nM elicitor peptide MsPep were then added, respectively, with no peptide added serving as a control (see Table 2).

[0076] Table 2 Experimental design for screening culture media

[0077]

[0078] Statistical results showed that the dedifferentiation rates of alfalfa explants with the addition of 1 nM and 10 nM MsPep elicitor peptides were 77.43% and 74.12%, respectively, which were significantly higher than the control (57.08%) by 35.65% and 29.85%. This indicates that the elicitor peptide MsPep significantly improved the dedifferentiation rate of alfalfa explants. Figure 3 ).

[0079] Example 4: Verification of the effect of the elicitor peptide MsPep on the healing rate

[0080] The resistant dedifferentiated explants obtained in Example 3 were transferred to callus medium and cultured normally for 13-20 days in an AI climate chamber with a temperature of 24°C, humidity of 60%, and a photoperiod of 8 h light / 16 h darkness. The callus medium formulation included: 4.43 g / L MS, 30 g / L sucrose, 2.0 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 0.2 mg / L 6-benzyladenine (6-BA), 200 mg / L cephalosporin (Cef), 200 mg / L termethin (Tim), and 3.5 g / L plant gel. 0 nM, 1 nM, and 10 nM elicitor peptides were added, respectively, with no peptides added as a control (Table 3).

[0081] Table 3 Experimental design of callus culture medium

[0082]

[0083] Statistical results showed that the healing rates with 1 nM and 10 nM peptides were 79.13% and 78.82%, respectively, with a healing time of 13 days. The healing rate without peptides was 60.2%, with a healing time of 16 days. The healing rates increased by 31.44% and 30.93%, respectively, and the healing time was shortened by 18.75%. Figure 4 ).

[0084] Example 5: Verification of the effect of the elicitor peptide MsPep on differentiation

[0085] The resistant callus obtained in Example 4 was transferred to differentiation medium and cultured normally for 13-20 days in an AI climate chamber with a temperature of 24°C, humidity of 60%, and a photoperiod of 8 h light / 16 h darkness. The differentiation medium formulation included: 4.43 g / L MS, 30 g / L sucrose, 1.0 mg / L kinetin (KT), 200 mg / L cephalosporin (Cef), 200 mg / L termethin (Tim), and 3.5 g / L plant gel. 0 nM, 1 nM, and 10 nM elicitor peptides were added, respectively, with no peptide added serving as a control (Table 4).

[0086] Table 4 Experimental design for differentiation culture medium

[0087]

[0088] Statistical results showed that the differentiation rates with the addition of 1 nM and 10 nM peptides were 60.42% and 58.62%, respectively, with a differentiation time of 13 days. The differentiation rate without peptide addition was 50.2%, with a differentiation time of 18 days. The differentiation rates increased by 20.36% and 16.77%, respectively, while the differentiation time was shortened by 27.78%. Figure 5 ).

[0089] Example 6: Verification of the effect of the elicitor peptide MsPep on budding.

[0090] The resistant buds obtained in Example 5 were transferred to budding medium and cultured normally for 13-20 days in an AI climate chamber with a temperature of 24°C, humidity of 60%, and a light cycle of 8 h light / 16 h darkness. The budding medium formulation consisted of: 4.43 g / L MS, 30 g / L sucrose, 200 mg / L cephalosporin (Cef), 200 mg / L termethin (Tim), and 3.5 g / L plant gel. 0 nM, 1 nM, and 10 nM elicitor peptides were added, respectively, with no peptide added serving as a control (Table 5).

[0091] Table 5 Experimental design of germination medium

[0092]

[0093] Statistical results showed that the germination rates of adding 1 nM and 10 nM peptides were 66.86% and 64.42%, respectively, with a germination time of 14 days. The germination rate without peptide addition was 58.2%, with a germination time of 18 days. The germination rates increased by 14.88% and 10.69%, respectively, and the germination time was shortened by 22.22%. Figure 6 ).

[0094] Example 7: Verification of the effect of the elicitor peptide MsPep on rooting

[0095] The resistant shoots obtained in Example 6 were transferred to rooting medium and cultured normally for 13-20 days in an AI climate chamber with a temperature of 24°C, humidity of 60%, and a light cycle of 8 h light / 16 h darkness. The rooting medium consisted of 4.43 g / L MS, 30 g / L sucrose, 0.5 mg / L indole-3-acetic acid (IAA), 200 mg / L cephalosporin (Cef), and 3.5 g / L plant gel. 0 nM, 1 nM, and 10 nM elicitor peptides were added, respectively, with no peptide added serving as a control (Table 6).

[0096] Table 6 Experimental design of rooting medium

[0097]

[0098] Statistical results showed that adding 1 nM and 10 nM peptides resulted in rooting rates of 75% and 75% respectively, with a rooting time of 14 days. Without peptides, the germination rate was 70%, and the time was 18 days. The rooting rate increased by 7.14%, and the time was shortened by 22.22%. Figure 7 ).

[0099] Example 8: Verification of the effect of the elicitor peptide MsPep on genetic transformation efficiency

[0100] 0.1 g of tender leaves from well-rooted regenerated plants in Example 7 were rapidly frozen in liquid nitrogen and ground into powder. Genomic DNA was extracted from the plants using a plant genomic DNA extraction kit. Using the extracted genomic DNA as a template, PCR amplification was performed using specific primers Bar-F / R. The specific primer Bar-F nucleic acid sequence is shown in SEQ ID NO:3, specifically: ATGAGCCCAGAACGACGC, and the specific primer Bar-R nucleic acid sequence is shown in SEQ ID NO:4, specifically: TCACATCTCGGTGACGGGC. The PCR reaction system is shown in Table 7, and the PCR amplification program is shown in Table 8.

[0101] Table 7 PCR Reaction System

[0102]

[0103] Table 8 PCR Amplification Procedure

[0104]

[0105] Table 9. Effect of polypeptides on transgenic positivity rate

[0106]

[0107] Statistical results showed that the conversion rates of adding 1 nM and 10 nM peptides were 44.17% and 42.50%, respectively, which were significantly higher than the conversion rate of 34.17% without peptides by 29.27% ​​and 24.38% (Table 9).

[0108] This invention is the first to isolate and identify a novel elicitor peptide, MsPep, from alfalfa. Systematic functional studies revealed that this elicitor peptide significantly improves the efficiency of several key stages in alfalfa genetic transformation. Experiments showed that adding 1 nM or 10 nM of MsPep to the culture medium significantly increased the dedifferentiation rate from 57.08% to 77.43%, shortened callus formation time from 16 days to 13 days, significantly increased the germination rate from 58.2% to 66.86%, and significantly increased the rooting rate from 38.20% to 56.78%, ultimately achieving a genetic transformation efficiency of 44.17%, a significant increase of 29.27% ​​compared to the 30% without peptide addition. This invention not only provides the alfalfa elicitor peptide MsPep but also demonstrates that this peptide significantly improves the efficiency of alfalfa genetic transformation and shortens the transformation cycle.

Claims

1. The application of the elicitor peptide MsPep in improving the genetic transformation efficiency of alfalfa, characterized in that, The application includes adding and applying the elicitor peptide MsPep, with a polypeptide sequence as shown in SEQ ID NO: 2, to the culture medium during the genetic transformation of alfalfa, wherein the culture phase includes: Alfalfa explants infected with Agrobacterium tumefaciens were cultured sequentially in co-medium, selection medium, callus medium, differentiation medium, budding medium and rooting medium supplemented with the elicitor peptide MsPep to obtain regenerated plants. The concentration of the elicitor peptide MsPep in the culture medium is 1.0-10 nanomoles / L.

2. The application of the elicitor peptide MsPep according to claim 1 in improving the genetic transformation efficiency of alfalfa, characterized in that, It also includes the steps of preparing and pretreating the explants before co-culturing, wherein the steps of preparing and pretreating the explants include: (1) Take fresh leaves of healthy alfalfa No. 1 growing in soil pots, rinse them three times with distilled water and then transfer them to sterilized tissue culture bottles; (2) Disinfection and sterilization treatment in a clean bench: After treating the leaves with a 1% sodium hypochlorite solution containing 0.1% Tween 20 for 2 minutes, rinse the leaves with sterile water once. After treating the leaves with 75% alcohol for 5 minutes, rinse the leaves with sterile water 6 to 8 times. Each rinse with sterile water should last for no less than 2 minutes.

3. The application of the elicitor peptide MsPep according to claim 1 in improving the genetic transformation efficiency of alfalfa, characterized in that, The method also includes the step of preparing an Agrobacterium tumefaciens infection solution before infecting the explants, wherein the step of preparing the infection solution includes: (1) Select Agrobacterium strain EHA105 or GV3101 containing the target vector, inoculate it into a 500 ml Erlenmeyer flask containing 100 ml of liquid YEB medium containing 50 μg / ml kanamycin and 20 μg / ml rifampicin, and place it in a shaker at 28°C and 200 rpm for 16 to 20 hours until the optical density value OD600 of the bacterial solution reaches 0.6 to 0.8; (2) Centrifuge the cultured bacterial solution at 8000 rpm for 10 minutes at 4℃, discard the supernatant to collect the bacterial cells, resuspend the bacterial cell pellet in sterile liquid MS basal medium without any plant hormones, and adjust the volume of the bacterial solution with a spectrophotometer so that the final optical density value OD600 is 0.3-0.

4.

4. The application of the elicitor peptide MsPep according to claim 1 in improving the genetic transformation efficiency of alfalfa, characterized in that, The explants are infected using a physical enhancement method. The specific operation of infecting the explants using the physical enhancement method is as follows: (1) Immerse the explant in an infection solution containing Agrobacterium tumefaciens and perform a first vacuum permeation treatment on the mixture of the explant and the infection solution. The vacuum permeation treatment is performed by maintaining a vacuum of 620 mmHg for 10 minutes. (2) Immediately after the first vacuum permeation treatment, the mixture is subjected to ice-water bath ultrasonic oscillation for 2-3 minutes. The frequency of the ultrasonic treatment is 40 kHz and the power is 110 W. (3) Immediately after ultrasonic treatment, the mixture is subjected to a second vacuum permeation treatment, which is to maintain a vacuum of 620 mmHg for 10 minutes. (4) After standing for 5 minutes, use sterile filter paper to absorb the excess bacterial solution attached to the surface of the explant.

5. The application of the elicitor peptide MsPep according to claim 1 in improving the genetic transformation efficiency of alfalfa, characterized in that, The co-culture medium formulation comprises: 4.43 g / L MS, 30 g / L sucrose, 4.0 mg / L 2,4-dichlorophenoxyacetic acid, 0.4 mg / L 6-benzyladenine, and 3.5 g / L plant gel. The co-culture conditions are as follows: the infected explants are placed in contact with the co-culture medium with the leaf underside facing down, and then cultured in the dark for 2 days in an AI climate chamber with a temperature of 24°C and a humidity of 60%.

6. The application of the elicitor peptide MsPep according to claim 1 in improving the genetic transformation efficiency of alfalfa, characterized in that, The screening medium formulation includes: 4.43 g / L MS, 30 g / L sucrose, 4.0 mg / L 2,4-dichlorophenoxyacetic acid, 0.2 mg / L 6-benzyladenine, 200 mg / L cephalosporin, 200 mg / L termethin, and 3.5 g / L plant gel. The screening and culture conditions were as follows: dark culture for 14 days in an artificial intelligence climate chamber with a temperature of 24℃ and a humidity of 60%.

7. The application of the elicitor peptide MsPep according to claim 1 in improving the genetic transformation efficiency of alfalfa, characterized in that, The callus culture medium formulation includes: 4.43 g / L MS, 30 g / L sucrose, 2.0 mg / L 2,4-dichlorophenoxyacetic acid, 0.2 mg / L 6-benzyladenine, 200 mg / L cephalosporin, 200 mg / L termethin, and 3.5 g / L plant gel. The callus culture conditions were as follows: normal culture for 13 days in an AI climate chamber with a temperature of 24℃, humidity of 60%, and a light cycle of 8 h light / 16 h darkness.

8. The application of the elicitor peptide MsPep according to claim 1 in improving the genetic transformation efficiency of alfalfa, characterized in that, The differentiation medium formulation includes: 4.43 g / L MS, 30 g / L sucrose, 1.0 mg / L kinetin, 200 mg / L cephalosporin, 200 mg / L termethin, and 3.5 g / L plant gel. The differentiation culture conditions were as follows: normal culture for 13 days in an AI climate chamber with a temperature of 24℃, humidity of 60%, and a light cycle of 8 h light / 16 h darkness.

9. The application of the elicitor peptide MsPep according to claim 1 in improving the genetic transformation efficiency of alfalfa, characterized in that, The budding medium formulation includes: 4.43 g / L MS, 30 g / L sucrose, 200 mg / L cephalosporin, 200 mg / L termethin, and 3.5 g / L plant gel. The rooting medium formulation comprises: 4.43 g / L MS, 30 g / L sucrose, 0.5 mg / L indole-3-acetic acid, 200 mg / L cephalosporin, and 3.5 g / L plant gel.

10. The application of the elicitor peptide MsPep according to claim 1 in improving the genetic transformation efficiency of alfalfa, characterized in that, It also includes a step of positive identification of the regenerated plants, wherein the positive seedling identification step includes: (1) Take 0.1 g of tender leaves from a well-rooted regenerated plant, freeze them quickly in liquid nitrogen and grind them into powder, and use a plant genomic DNA extraction kit to extract the plant's genomic DNA. (2) Using the extracted genomic DNA as a template, PCR amplification and detection were performed on Bar-F / R using specific primers. The specific primer Bar-F nucleic acid sequence is shown in SEQ ID NO: 3, and the specific primer Bar-R nucleic acid sequence is shown in SEQ ID NO: 4.

Images