KASP primer combination for constructing SNP (Single Nucleotide Polymorphism) fingerprint spectrum of camellia variety and application of KASP primer combination
By constructing the KASP primer combination of the SNP fingerprint map of camellia varieties, the problem of limited coverage area in traditional genetic marker screening methods was solved, achieving a more comprehensive reflection of genetic diversity and efficient variety identification, and improving typing accuracy and amplification efficiency.
Patent Information
- Application Number
- CN202510698990.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-28
- Publication Date
- 2025-09-05
AI Technical Summary
Traditional genetic marker screening methods rely on a single data source, resulting in limited coverage areas, easy omission of key variation regions, inability to fully reflect the genetic diversity of camellia and low efficiency in variety identification.
The KASP primer combination for the SNP fingerprint of camellia varieties was constructed. By screening 23 core SNP sites in the resequencing data, allele-specific primers were designed and combined with fluorescent markers for quantitative PCR detection, multi-source marker data were constructed, and uncovered variation regions were supplemented.
It improves the genome coverage and representativeness of the marker set, improves the efficiency of variety identification, ensures typing accuracy and amplification efficiency, and reduces false positive products and the reliability of test results.
Smart Images

Figure CN120591386A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of plant genetic breeding, in particular to a KASP primer combination for constructing a SNP fingerprint of a camellia variety and its application. Background Art
[0002] Camellia germplasm resources, including wild species, variants, and cultivars, are the carriers of camellia's genetic diversity. Varieties can be identified through a combination of morphological characteristics (such as petal and leaf shape), molecular markers (such as DNA fingerprinting), and physiological and biochemical indicators. Conservation of these germplasm resources is crucial. Currently, conservation efforts are underway through the establishment of nature reserves and germplasm nurseries, both in situ and ex situ, as well as in vitro conservation using cryopreservation and other techniques. These measures are crucial for the sustainable utilization of camellia genetic resources, the development of new varieties, and ecological conservation.
[0003] Traditional genetic marker screening mostly relies on a single data source and has a limited coverage area. Since traditional methods easily miss key variation regions, the marker set cannot fully reflect the genetic diversity of the samples and the efficiency of variety identification is low. Summary of the Invention
[0004] In response to the shortcomings of the existing technology, the present invention provides a KASP primer combination and application for constructing SNP fingerprints of camellia varieties, which solves the problems that traditional genetic marker screening mostly relies on a single data source and has a limited coverage area. Since traditional methods easily miss key variation regions, the marker set cannot fully reflect the genetic diversity of the samples and the variety identification efficiency is low.
[0005] To achieve the above objectives, the present invention is implemented by the following technical solution: The method for constructing a KASP primer combination for SNP fingerprinting of camellia varieties comprises the following steps:
[0006] S1. Obtain resequencing data of 220 Camellia cultivars and screen out 23 core SNP sites;
[0007] S2. According to the KASP primer design principles, for the 23 core SNP sites, 100 bp of sequence upstream and downstream of each site were selected for design. Three primers were designed for each SNP site: two allele-specific primers and one universal primer. A fluorescent-binding specific sequence was added to the tail of the allele-specific primers, and the primers were synthesized and purified by a biotechnology company.
[0008] S3. Extract genomic DNA from camellia samples, prepare SNP primer mix, perform quantitative PCR detection using the 23 pairs of KASP primers, read fluorescence data, complete genotyping analysis, and construct a SNP fingerprint map of camellia varieties.
[0009] By adopting the above technical solution, the SNP sites screened by resequencing are merged with the 424 genetic map sites evaluated by probes, multi-source marker data are integrated and uncovered variation regions are supplemented, thereby improving the genome coverage and representativeness of the marker set; thereby improving the traditional genetic marker screening that mostly relies on a single data source and has limited coverage area. Since traditional methods are prone to missing key variation regions, the marker set cannot fully reflect the genetic diversity of the samples and the efficiency of variety identification is low.
[0010] Preferably, the process of screening 23 core SNP sites includes:
[0011] S1. For the SNP sites obtained by resequencing, the missing rate, minimum quality score, and minimum allele frequency were filtered in turn, where the missing rate was <0.2, minQ≥50, and MAF≥0.15;
[0012] S2, single copy site, GC content, N filtering, the GC% of the 100bp upstream and downstream of the SNP site is 40-60, and there is no N sequence;
[0013] S3, perform LD screening;
[0014] S4, merged with the genetic map loci after probe evaluation;
[0015] S5, screening for SNPs with single copies in the 20 bp upstream and downstream of the site;
[0016] S6. Screening of SNP sites located in the exon region of the gene;
[0017] S7. Select core loci based on the principle that they are evenly distributed on the chromosome and the distance is ≥50kb.
[0018] Preferably, 20,476 sites were obtained after LD screening, and 20,900 sites were obtained after merging with 424 genetic map sites after probe evaluation. 223 sites were obtained after screening for SNPs with single copies 20 bp upstream and downstream of the site, and 145 sites were obtained after screening for SNP sites located in the exon region of the gene.
[0019] Preferably, the allele-specific primer is an upstream or downstream primer, the universal primer is a downstream or upstream primer, a specific sequence 5'GAAGGTGACCAAGTTCATGCT3' capable of binding to FAM fluorescence is added to the tail of the designed allele-specific primer F1, and a specific sequence 5'GAAGGTCGGAGTCAACGGATT3' capable of binding to HEX fluorescence is added to the tail of F2, and the primers are purified by PAGE.
[0020] Preferably, the process of configuring SNP primer Mix is:
[0021] S1. Dry powder primer pretreatment: Place the dry powder primer synthesized by the biological company in a microcentrifuge and centrifuge at 4000 rpm for 1 minute;
[0022] S2. Primer dilution: Calculate the required volume of ddH2O according to the weight and molecular weight of the primer labeled dry powder, add it to a centrifuge tube to dilute the primer concentration to 100 μM, and use a benchtop vortex mixer at 2000-2500 rpm for 10-15 seconds;
[0023] S3, Mix system configuration: Take 46 μL ddH2O, 30 μL 100 μM common primer, and 12 μL each of fluorescently labeled tailed primers with a concentration of 100 μM, and add them to a new centrifuge tube in sequence;
[0024] S4. Secondary mixing and centrifugation: Use the same vortex mixer at 2000-2500 rpm for 15-20 seconds, then centrifuge at 4000 rpm for 5-10 seconds in a microcentrifuge to obtain a uniform SNP primer mix.
[0025] Preferably, the initial DNA concentration is uniformly 10 ng / μL, ddH2O is added to the control group, and two NTCs are added to each primer pair; the reaction system includes DNA, 2×KASP Master mix, KBD Assay mix and water, and the addition amounts of different types of samples are as follows: in a wet DNA 96-well plate, 5 μL of DNA, 2.5 μL of 2×KASP Master mix, 0.14 μL of KBD Assay mix, and n / a of water, for a total reaction volume of 5 μL; in a wet DNA 384-well plate, 2.5 μL of DNA, 1.25 μL of 2×KASP Master mix, 0.07 μL of KBD Assay mix, and n / a of water, for a total reaction volume of 5 μL; in a dry DNA 96-well plate, 5 μL of DNA, 2.5 μL of 2×KASP Master mix, 0.14 μL of KBD Assay mix, and 5 μL of water, for a total reaction volume of 10 μL; in a dry DNA 384-well plate, 5 μL of DNA, 2×KASP The master mix was 2.5 μL, the KBD assay mix was 0.07 μL, and the water was 2.5 μL, for a total reaction volume of 10 μL.
[0026] Preferably, the procedure of the PCR amplification is:
[0027] S1, initial denaturation, temperature 94 ° C, time 15 min, cycle number 1;
[0028] S2, denaturation, temperature 94 ° C, time 20 sec, cycle number 10 times;
[0029] S3, annealing / extension, temperature decreased from 61°C to 55°C at -0.6°C / cycle, time 60 sec, 10 cycles;
[0030] S4, denaturation again, temperature 94 ° C, time 20 sec, number of cycles 26;
[0031] S5, annealing / extension again, temperature 55°C, time 60 sec, number of cycles 26;
[0032] S6. If the fluorescence signal is low and the clusters are scattered, increase the number of cycles: denaturation temperature 94°C, time 20 seconds, 3 cycles, annealing / extension temperature 57°C, time 60 seconds. The number of cycles is determined based on the test results, while ensuring that NTC is not amplified.
[0033] Preferably, the 23 pairs of KASP primers are composed of primers designed for 23 core SNP sites, wherein: the average GC content of the specific primers is 54.2%, the average annealing temperature (Tm) is 65°C, the average length is 21.8 bp, the average length difference between two specific primers is only 1 bp, and the Tm difference is 1.4°C; the average GC content of the common primers is 51.4%, the average length is 25 bp, and the average Tm value is 68°C; the average length of the amplified product is 54.2 bp, ranging between 48-64 bp, and the interval between the forward and reverse primers is about 10 bp.
[0034] Preferably, the average typing rate of the KASP marker is 92%, and the average typing success rate is 97.7%.
[0035] The method of constructing KASP primer combination for SNP fingerprint of camellia varieties is applied to identification of camellia germplasm resources and varieties, protection of germplasm resources, genetic diversity and cluster analysis of camellia samples.
[0036] The present invention provides a KASP primer combination and application for constructing SNP fingerprints of camellia varieties. It has the following beneficial effects:
[0037] 1. In the present invention, by merging the SNP sites screened by resequencing with 424 genetic map sites evaluated by probes, multi-source marker data are integrated and uncovered variation regions are supplemented, thereby improving the genomic coverage and representativeness of the marker set; thereby improving the problems of traditional genetic marker screening, which mostly rely on a single data source and have limited coverage areas. Since traditional methods are prone to missing key variation regions, the marker set cannot fully reflect the genetic diversity of the samples and has low efficiency in variety identification.
[0038] 2. In the present invention, 23 pairs of KASP primers were designed with an average GC content of 54.2%, a Tm value of 65°C, and a length difference of only 1 bp. This ensures a balance between allele-specific recognition and amplification efficiency, thereby enabling accurate genotyping using FAM / HEX fluorescence signals. This improves the problem that traditional primer design generally fails to balance GC content uniformity and allele amplification balance. Traditional primers are prone to signal imbalance due to large Tm value differences or length deviations, resulting in large errors in heterozygous typing and low reliability of test results.
[0039] 3. In the present invention, by optimizing the PCR amplification procedure (such as pre-denaturation at 94°C for 15 minutes to activate the hot-start enzyme and touchdown gradient cooling annealing), the thoroughness of DNA denaturation and the specificity of primer binding are improved, thereby ensuring balanced amplification of 23 SNP sites in the multiplex PCR system; thereby improving the traditional amplification procedures that mostly use a fixed annealing temperature and are not optimized for the kinetic differences of multiple primers. Since traditional methods are prone to nonspecific binding or uneven amplification efficiency, they result in many false-positive products and large fluctuations in site Ct values.
[0040] 4. In the present invention, by standardizing the starting DNA concentration to 10 ng / μL and setting up a double NTC control, the interference of template concentration differences is eliminated and a contamination monitoring system is established, thereby ensuring consistent amplification efficiency for different sample types (dry / wet DNA); thereby improving the problem that traditional detection mostly ignores template concentration standardization and contamination control. Traditional methods are prone to high / low DNA concentration or reagent contamination, resulting in high amplification failure rate and poor result reproducibility.
[0041] 5. In the present invention, by screening SNPs in single-copy sequences 20bp upstream and downstream and focusing on exon functional variation, the specific binding requirements of KASP primers are met and associated with phenotype-related genes, thereby improving typing accuracy and marker practicality. This improves the problem that traditional SNP screening generally does not consider the correlation between primer binding environment and function. Since traditional sites are easily interfered with by repetitive sequences or functional neutrality, the failure rate of primer design is high and the marker cannot effectively distinguish the characteristics of varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0042] Figure 1 Schematic diagram of the method steps of the present invention;
[0043] Figure 2 Schematic diagram of the method steps for screening 23 core SNP sites in the present invention;
[0044] Figure 3 Schematic diagram of the method steps for configuring the SNP primer mix process of the present invention;
[0045] Figure 4Schematic diagram of the steps of the PCR amplification procedure of the present invention;
[0046] Figure 5 Schematic diagram of the KASP genotyping results of 23 SNP sites corresponding to 11 camellia samples of the present invention;
[0047] Figure 6 is a phylogenetic tree diagram of the present invention;
[0048] Figure 7 It is the DNA fingerprint of the present invention. DETAILED DESCRIPTION
[0049] The following will clearly and completely describe the technical solution of the present invention in conjunction with the accompanying drawings. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0050] Please see the attached Figure 1-7 The present invention provides a method for constructing a KASP primer combination for SNP fingerprinting of camellia varieties, comprising the following steps:
[0051] S1. Obtain resequencing data of 220 Camellia cultivars and screen out 23 core SNP sites;
[0052] S2. Based on the KASP primer design principles, 100 bp of upstream and downstream sequences were selected for each of the 23 core SNP sites. Three primers were designed for each SNP site: two allele-specific primers and one universal primer. A fluorescent-binding specific sequence was added to the tail of the allele-specific primers, which were then synthesized and purified by a biotechnology company.
[0053] S3. Extract genomic DNA from camellia samples, prepare SNP primer mix, perform quantitative PCR detection using 23 pairs of KASP primers, read fluorescence data, complete genotyping analysis, and construct a SNP fingerprint map of camellia varieties.
[0054] Specifically, the 23 SNP loci combination can distinguish 193 genotypes among 220 camellia varieties, with a discrimination efficiency of 87.7%, providing high-resolution molecular markers for variety identification. After multiple filtering (missing rate < 0.2, MAF ≥ 0.15, etc.) and LD analysis, the loci were adapted for KASP primer design. The average typing rate of the 23 primer pairs was 92% and the success rate was 97.7%, ensuring genotyping accuracy. The loci were evenly distributed on the chromosome (spacing ≥ 50 kb) and located in the exon region, ensuring genetic diversity analysis (MAF = 0.32, PIC = 0. 41) and the scientific nature of phylogenetic tree construction can effectively reveal the genetic relationship between varieties; two allele-specific primers target different alleles of the SNP site respectively, and combine with the universal primer to form a triple primer system, which distinguishes genotypes by fluorescence signals (FAM / HEX). The number of missing genotypes in single sample is 0-5, and the number of missing genotypes in single primer is 0-3, with a typing accuracy of 97.7%; the average GC content of the specific primers is 54.2%, and the Tm value is 65℃, forming a balanced system with the universal primer (GC=51.4%, Tm=68℃), and the length of the amplified product is 48-64bp, with forward and reverse The primers were spaced approximately 10 bp apart to ensure PCR amplification efficiency and fluorescence signal stability. A fixed fluorescent sequence (FAM / HEX specific sequence) was added to the primer tails and purified by PAGE. Synthesis standards were unified and compatible with the fluorescence detection module of quantitative PCR instruments such as QuantStudio7, supporting high-throughput genotyping analysis. By optimizing the DNA extraction method (wet / dry samples were adapted to different extraction processes) and combining multiplex PCR detection with 23 pairs of KASP primers, genotype data for 23 SNP sites could be obtained in a single experiment, covering the key variation regions of the Camellia genome. ASP primer design follows unified parameters (GC content 54.2%, Tm value 65°C), and the PCR reaction system and procedures are standardized (such as 94°C pre-denaturation for 15 minutes, 61-55°C gradient annealing), ensuring that the fluorescence signal accurately reflects the genotype, the typing loss rate is ≤5%, and the data reliability reaches 97.7%; based on the typing results of 23 core loci, 87.7% of camellia varieties (193 genotypes in 220 samples) can be distinguished, forming a characteristic fingerprint map, providing a digital basis for variety identification and kinship analysis, and supporting the protection and utilization of camellia germplasm resources.
[0055] Please see the attached Figure 2-7 The process of screening 23 core SNP sites includes:
[0056] S1. For the SNP sites obtained by resequencing, the missing rate, minimum quality score, and minimum allele frequency were filtered in turn, where the missing rate was <0.2, minQ≥50, and MAF≥0.15;
[0057] S2, single copy site, GC content, N filtering, the GC% of the 100bp upstream and downstream of the SNP site is 40-60, and there is no N sequence;
[0058] S3, perform LD screening;
[0059] S4, merged with the genetic map loci after probe evaluation;
[0060] S5, screening for SNPs with single copies in the 20 bp upstream and downstream of the site;
[0061] S6. Screening of SNP sites located in the exon region of the gene;
[0062] S7. Select core loci based on the principle that they are evenly distributed on the chromosome and the distance is ≥50kb.
[0063] Specifically, the miss rate (miss rate < 0.2) in S1 was used to filter out sites with poor data integrity to avoid genotype analysis deviations caused by missing data; the minimum quality score (minQ ≥ 50) ensured the accuracy of sequencing results and reduced false positive variant interference; the minimum allele frequency (MAF ≥ 0.15) screened out variant sites with a certain abundance in the population, eliminated random interference from rare alleles, and ensured the practicality and stability of the sites in variety identification; the single copy site was used to filter out SNPs in the repetitive sequence region to avoid non-specific binding of primers to multiple copy sites leading to amplification confusion; the 100 bp upstream and downstream had no N sequence to ensure the integrity of the primer design region sequence to avoid unknown bases not covered by sequencing affecting primer synthesis and amplification efficiency; the GC content was controlled at 40%-60% to avoid amplification failure caused by too high GC content (easy to form secondary structure) or too low GC content (poor primer binding stability), providing a basic guarantee for the annealing temperature (Tm value 65°C) and amplification efficiency of the subsequent KASP primers; the strongly linked SNP sites were eliminated in S3 (the LD screening threshold defaulted to r 2≥0.8), avoid sites with too close genetic distance to provide duplicate information, optimize marker combination efficiency; retain sites with low LD values to ensure that the 23 core SNPs screened are more evenly distributed in the genome, and enhance the map's ability to identify recombination events; reduce the interference of linked sites on genotype interpretation, reduce typing errors caused by LD, and improve the reliability of fingerprint map construction (such as accurate distinction of 193 genotypes in 220 samples); combine the SNP sites screened by resequencing with the verified genetic map sites (424) in S4 to supplement the uncovered variation regions in the map and improve the genome coverage and representativeness of the marker set; use the probe evaluation results of the genetic map sites (such as hybridization efficiency, polymorphism verification) to cross Cross-validation of the effectiveness of resequencing SNPs reduces the proportion of false-positive sites and ensures the robustness of the 23 core sites. The combined marker set (20,900 sites) covers more genetic linkage regions, providing a richer candidate pool for subsequent uniform distribution screening (S7), ultimately ensuring the balanced distribution of the 23 core sites on the chromosome and the efficiency of variety identification (87.7% differentiation rate). The KASP technology in S5 requires that allele-specific primers have a single-copy characteristic within 20 bp upstream and downstream of the SNP site to avoid repeated sequences that cause primers to bind to non-target regions, ensuring the accuracy of allele differentiation (such as consistent identification of genotypes of the same variety Y29-B and Y6-B). The single-copy sequence environment can reduce the formation of primer dimers. and non-specific hybridization risks, improving the typing success rate (97.7% on average) and ensuring the efficient amplification performance of 23 pairs of KASP primers; SNPs in the S6 exon region directly affect the protein coding sequence, and screening of such sites can capture functional variations related to camellia phenotypes (such as flower color and flower shape), thereby enhancing the association between markers and target traits; exon SNPs usually have higher selection pressure, and polymorphisms can better reflect the genetic differentiation between varieties, which helps to construct more discriminative fingerprint maps (such as 23 sites distinguishing 87.7% of camellia varieties); functional SNPs can be directly used as breeding markers to accelerate the screening of excellent traits, such as screening for allele variations related to stress resistance and ornamental value; S7 is used to avoid sites from clustering in local areas domain, so that the 23 core SNPs are evenly distributed throughout the genome, ensuring balanced genetic variation detection and complete coverage of the genetic diversity of camellia varieties; the site spacing is ≥50kb, reducing linkage disequilibrium (LD) between markers, avoiding redundant information, ensuring that each core SNP can independently reflect the genetic characteristics of different regions, and improving the resolution of the fingerprint map; the evenly distributed core sites can reduce the risk of information loss due to local chromosome segment loss or mutation, so that the constructed SNP fingerprint map maintains high reliability in the detection of different samples (discrimination efficiency reaches 87.7%); in kinship analysis and population structure studies, the evenly distributed markers can more accurately calculate genetic distance and similarity, effectively revealing the true genetic relationship between camellia varieties.
[0064] LD screening yielded 20,476 loci, which were combined with 424 genetic map loci after probe evaluation to yield 20,900 loci. Screening for single-copy SNPs 20 bp upstream and downstream yielded 223 loci, and screening for SNPs located in the exon regions of genes yielded 145 loci.
[0065] Specifically, LD screening eliminated linked redundant sites and retained 20,476 independent variation sites to ensure that each site provided unique genetic information; it was merged with 424 probe-evaluated genetic map sites to integrate multi-source data, so that the site set covered a more comprehensive genomic region and enhanced the representativeness of the markers for the genetic diversity of camellia varieties; SNPs with single copies within 20bp upstream and downstream were screened, reducing the number from 20,900 sites to 223, meeting the specific binding requirements of KASP primers, avoiding nonspecific amplification, providing high-quality templates for subsequent primer design, and ensuring the accuracy of PCR amplification; SNP sites in the exon region were screened, further reducing the number to 145, locking in functional variants directly related to gene coding. These sites are more likely to affect the phenotypic traits of camellia, helping to construct a fingerprint map closely related to variety characteristics, and improving the efficiency and practicality of variety identification.
[0066] The allele-specific primers are upstream or downstream primers, and the universal primers are downstream or upstream primers. A specific sequence 5'GAAGGTGACCAAGTTCATGCT3' that can bind to FAM fluorescence is added to the tail of the designed allele-specific primer F1, and a specific sequence 5'GAAGGTCGGAGTCAACGGATT3' that can bind to HEX fluorescence is added to the tail of F2. The primers are purified by PAGE.
[0067] Specifically, the F1 and F2 primers are connected to FAM / HEX specific sequences, respectively. During PCR amplification, if the sample carries the corresponding allele, the primers bind to the template and extend, activating the corresponding fluorescent signal (FAM green / HEX blue), thereby achieving visual distinction between different alleles, such as accurately identifying AA, BB, and AB genotypes in 23 SNP site typing; through the combined design of allele-specific primers (upstream or downstream) and universal primers (downstream or upstream), a competitive amplification mechanism is formed to ensure that only primers that fully match the template are extended, thereby improving typing accuracy (average typing success rate 97.7%); PAGE purification removes short-chain oligonucleotides and synthetic by-products, ensures primer sequence integrity, reduces nonspecific amplification interference, makes the fluorescent signal clearer, and reduces the typing deletion rate (the number of missing sites in a single sample ≤ 5 sites).
[0068] Please see the attached Figure 3-7 , the process of configuring SNP primer mix is as follows:
[0069] S1. Dry powder primer pretreatment: Place the dry powder primer synthesized by the biological company in a microcentrifuge and centrifuge at 4000 rpm for 1 minute;
[0070] S2. Primer dilution: Calculate the required volume of ddH2O according to the weight and molecular weight of the primer labeled dry powder, add it to a centrifuge tube to dilute the primer concentration to 100 μM, and use a benchtop vortex mixer at 2000-2500 rpm for 10-15 seconds;
[0071] S3, Mix system configuration: Take 46 μL ddH2O, 30 μL 100 μM common primer, and 12 μL each of fluorescently labeled tailed primers with a concentration of 100 μM, and add them to a new centrifuge tube in sequence;
[0072] S4. Secondary mixing and centrifugation: Use the same vortex mixer at 2000-2500 rpm for 15-20 seconds, then centrifuge at 4000 rpm for 5-10 seconds in a microcentrifuge to obtain a uniform SNP primer mix.
[0073] Specifically, S1 centrifugation is used to allow the dry powder primers to settle to the bottom of the tube (to avoid powder loss when opening the lid), ensuring accurate dilution according to the labeled liquid addition volume (e.g., 1OD dry powder plus 50μL ddH2O to 100μM), ensuring the accuracy of primer concentration in the subsequent PCR system; after centrifugation, the primers are concentrated at the bottom of the tube, maximizing the contact area with the solvent (ddH2O), and combined with subsequent vortex mixing (2000-2500r / min, 10-15 seconds), a uniform solution can be quickly formed to avoid concentration deviation caused by local insolubility; S2 accurately calculates the amount of water added according to the weight and molecular weight of the dry powder (e.g., 1OD primer corresponds to about 50μL ddH2O), and all primers are uniformly diluted to a 100μM stock concentration to ensure the subsequent Mix The added volume of each primer in the configuration is consistent (for example, 10 μL of stock solution is required for a 10 μM working solution); high-intensity vortex oscillation at 2000-2500 rpm destroys the agglomeration structure of the primer powder, fully disperses the oligonucleotide chains in the solution, avoids differences in amplification efficiency caused by local concentration unevenness, and ensures the accurate concentration of the 23 pairs of KASP primers in the Mix (for example, the final concentration of each primer pair in the 2×KASP reaction system is 0.16 μM); the volume of each component is fixed by S3 (46 μL water + 30 μL common primer + 24 μL fluorescent primer) so that the final concentration of the 23 pairs of KASP primers in the Mix is 0.16 μM (common primer) and 0.064 μM (fluorescent primer), which is suitable for 2×KASP Master The recommended reaction concentration of the mix ensures balanced efficiency of multiplex PCR amplification; fluorescently labeled primers (F1 / F2) and common primers are mixed in a volume ratio of 1:2.5 (12μL:30μL) to avoid signal quenching or nonspecific binding caused by excessive fluorescent groups, while ensuring the primer concentration required for allele-specific identification (for example, clear typing can be achieved when the FAM / HEX signal intensity difference is ≥2000RFU); premixed primer mix can avoid volume errors in single-tube sequential additions (such as the minimum accuracy of the pipette ±0.5μL), ensure the consistency of the addition of 23 pairs of primers in different sample reactions, and improve the repeatability of typing results (for example, the genotype consistency rate of repeated detection of the same variety is ≥99%); through S42000-2 Oscillation at 500 rpm allows the common primers and fluorescent primers to fully diffuse in the solution, breaking down density differences between different primers (e.g., fluorescent-labeled primers with larger molecular weights are prone to sedimentation), and avoiding amplification bias caused by local concentration unevenness (e.g., weak or no fluorescence signal at a certain site); centrifugation (4000 rpm, 5-10 seconds) allows bubbles in the solution to float and burst, and settles primer particles attached to the tube wall, preventing bubbles from blocking fluorescence signal collection or impurities from triggering nonspecific amplification, ensuring the stability of fluorescence data during QuantStudio7 detection (e.g., signal standard deviation ≤100 RFU); after secondary mixing, a stable primer premix is formed, with a concentration error of each component ≤2% (e.g., final concentration of fluorescent primer 0.064 μM ± 0.0013μM), meeting the strict requirements of multiplex PCR on primer ratios and improving the consistency of 23-locus typing results (e.g., single-sample 23-locus typing success rate ≥ 95%).
[0074] The starting DNA concentration was uniformly 10 ng / μL. ddH2O was added to the control group, and two NTCs were added to each primer pair. The reaction system included DNA, 2×KASP Master mix, KBD Assay mix, and water. The amounts of different sample types added were as follows: in a wet DNA 96-well plate, 5 μL of DNA, 2.5 μL of 2×KASP Master mix, 0.14 μL of KBD Assay mix, and n / a of water were added, for a total reaction volume of 5 μL. In a wet DNA 384-well plate, 2.5 μL of DNA, 1.25 μL of 2×KASP Master mix, 0.07 μL of KBD Assay mix, and n / a of water were added, for a total reaction volume of 5 μL. In a dry DNA 96-well plate, 5 μL of DNA, 2.5 μL of 2×KASP Master mix, 0.14 μL of KBD Assay mix, and 5 μL of water were added, for a total reaction volume of 10 μL. In a dry DNA 384-well plate, 5 μL of DNA, 2×KASP Master mix, The total reaction volume was 10 μL, with 2.5 μL of ELISA mix, 0.07 μL of KBD Assay mix, and 2.5 μL of water.
[0075] Specifically, the DNA starting concentration was unified to 10 ng / μL to avoid amplification deviation caused by too high concentration (inhibition of Taq enzyme activity) or too low concentration (insufficient signal detection), ensuring consistent amplification efficiency of 23 SNP sites in different samples (Ct value standard deviation ≤ 0.5); ddH2O was added to the control group (instead of DNA template), and two no-template controls (NTC) were set for each primer pair to effectively identify reagent contamination or cross-contamination (if NTC showed a fluorescent signal, it was determined to be contaminated), ensuring the reliability of typing results (contamination rate ≤ 1%); DNA solution was used directly, and by reducing the Master mix and Assay The mix volume (e.g., 2.5 μL + 0.14 μL for a 96-well plate) maintains component concentrations in a total reaction volume of 5 μL, reducing reagent consumption while maintaining amplification efficiency (amplification success rate ≥ 95%). For lyophilized samples (e.g., leaf DNA), increase the total volume to 10 μL and add water to ensure sufficient dissolution of the DNA and avoid local concentration unevenness due to desiccation (e.g., add 2.5 μL of water to a 384-well plate for dry DNA). Adjust the system volume according to the plate type (5 μL / 10 μL for a 96-well plate, 2.5 μL / 10 μL for a 384-well plate) to match the optical path detection requirements of QuantStudio7, ensuring that the difference in FAM / HEX fluorescence signal intensity is ≥ 2000 RFU to ensure accurate genotyping (typing error rate ≤ 0.5%).
[0076] Please see the attached Figure 4-7 , the PCR amplification procedure is:
[0077] S1, initial denaturation, temperature 94 ° C, time 15 min, cycle number 1;
[0078] S2, denaturation, temperature 94 ° C, time 20 sec, cycle number 10 times;
[0079] S3, annealing / extension, temperature decreased from 61°C to 55°C at -0.6°C / cycle, time 60 sec, 10 cycles;
[0080] S4, denaturation again, temperature 94 ° C, time 20 sec, number of cycles 26;
[0081] S5, annealing / extension again, temperature 55°C, time 60 sec, number of cycles 26;
[0082] S6. If the fluorescence signal is low and the clusters are scattered, increase the number of cycles: denaturation temperature 94°C, time 20 seconds, 3 cycles, annealing / extension temperature 57°C, time 60 seconds. The number of cycles is determined based on the test results, while ensuring that NTC is not amplified.
[0083] Specifically, the Taq polymerase in S1:KASP Master mix is chemically modified or antibody-blocked, and then subjected to high temperature (94°C) for 15 minutes to release inhibition and ensure complete release of enzyme activity. This avoids primer dimers or mismatch products (e.g., negative control Ct value > 35) caused by nonspecific amplification at low temperatures. The camellia genome (approximately 3Gbp) has a complex structure, and high-temperature treatment completely unwinds the double-stranded DNA into a single-stranded template, especially in regions with high GC content (e.g., the average GC% in the region where the exon SNP is located is 54.2%), ensuring that the primers effectively bind to the target site and increasing the number of SNPs at 23 sites. The amplification uniformity of each site (the Ct value range of each site is ≤2); dry / wet DNA samples may contain polysaccharides, polyphenols and other PCR inhibitors. Long-term high temperature can partially degrade such substances, reduce the interference with Taq enzyme activity, and ensure the success rate of amplification (for example, the amplification efficiency of dry DNA samples is increased to 97.7%); S2: 94℃ denaturation is used to quickly unwind double-stranded DNA into single strands, each time for 20 seconds to ensure that the high stability region in the camellia genome (GC content 54.2%) is fully dissociated, providing a template for subsequent primer binding (such as the upper and lower 23 SNP sites). The Tm value of the 100bp region is ≤85℃); 10 cycles of linear amplification increase the initial template amount by about 1000 times (2^10), providing sufficient starting amount for the subsequent exponential amplification stage (S3), ensuring balanced amplification of 23 SNP sites in the same reaction system (Ct value standard deviation ≤0.8); in conjunction with the subsequent annealing temperature decrease (61-55℃), strict annealing is first performed at a higher temperature (such as 61℃) to inhibit nonspecific binding, and the temperature is gradually lowered to improve the binding efficiency of the primers and target sequences, thereby improving the typing specificity (such as Heterozygous AB type detection rate ≥98%); through S3: the initial annealing temperature of 61°C is higher than the primer Tm value (65°C), forcing the primers to closely match the target sequence and reducing nonspecific binding; then the temperature is gradually lowered to 55°C at a -0.6°C / cycle gradient, allowing the low-affinity correctly paired primers to gradually bind, ultimately completing extension at conditions close to the Tm value, significantly reducing nonspecific products (such as primer dimer fluorescence signal ≤500RFU); the Tm value of the 23 pairs of KASP primers was uniformly designed (65°C), but there were kinetic differences in actual amplification.During the gradient cooling process, each primer starts amplification in sequence in the optimal temperature range to ensure balanced amplification efficiency of all SNP sites (especially the GC content 40-60% region) (Ct value range ≤1.5); the 60-second extension time allows the Taq enzyme to fully synthesize the fluorescent reporter sequence (FAM / HEX). When the temperature is close to the Tm value, the allele-specific primers maximize their ability to recognize single-base differences, thereby improving the accuracy of heterozygous (AB type) typing (signal difference ≥2500RFU); through S4: 26 cycles, the target DNA fragment increases exponentially by approximately 6.7×10^7 times (2^26), ensuring that the fluorescence signal intensity reaches the QuantStudio7 detection threshold (≥5000RFU), meeting the high-throughput typing requirements of 23 SNP sites; the S2 stage has only 10 cycles, and the template enrichment is limited. S4 continues amplification at a lower annealing temperature (55°C) to compensate for the insufficient yield in the high-stringency stage (S3), especially ensuring the amplification efficiency (Ct value ≤ 30) of sites with marginal GC content (such as 40% and 60%); each 20-second denaturation time accurately controls the melting process to avoid Taq enzyme activity attenuation caused by excessive time (>30 seconds can reduce enzyme activity by 15%), ensuring that 23 pairs of primers continue to amplify effectively in 26 cycles, with the CV value of the fluorescence signal at each site ≤ 10%; through S5: a fixed 55°C annealing temperature is coordinated with the S4 denaturation step to form a stable amplification cycle (denaturation- Annealing-extension) ensures that the 23 pairs of primers are continuously and efficiently extended in 26 cycles, resulting in exponential accumulation of the target fragment (approximately 2-fold amplification per cycle), and the final fluorescence signal intensity reaches the threshold (≥5000RFU); 55°C is close to the Tm value of the KASP primer (65°C). During the Taq enzyme-mediated extension process, the allele-specific primers (F1 / F2) maximize their ability to distinguish single-base differences. For example, the AA genotype only excites the FAM signal, the BB genotype only excites the HEX signal, and the AB genotype exhibits dual fluorescence (difference ≥2500RFU); the 60-second extension time meets the KASP The synthesis requirements of longer sequences in the assay (such as FAM / HEX tail sequence + SNP flanking 20bp), especially for regions with high GC content (such as 58-60%), avoid signal attenuation (such as Ct value drift ≤ 0.5) caused by incomplete extension; 23 SNP sites compete for enzymes and dNTPs in the same reaction system, with a constant 55°C annealing temperature and 60-second extension time, so that the amplification efficiency of each primer tends to be consistent, reducing the difference in Ct values between sites (range ≤ 2), and improving the balance of multiplex PCR; through S6: for sites with insufficient fluorescence intensity (such as <5000RFU) or cluster standard deviation >1000RFU after the initial 26 cycles, an additional 3 cycles of denaturation (94°C) + extension (57°C) can increase the target fragment copy number by about 8 times (2. 3), increasing the signal intensity beyond the detection threshold (e.g., to 7000 RFU); the 57°C annealing temperature, slightly higher than conventional cycling (55°C), raises the thermodynamic threshold for base mismatches, reduces nonspecific amplification interference, and enables tighter clustering of AA / BB / AB genotypes (clustering standard deviation ≤ 800 RFU), improving typing accuracy (e.g., increasing the heterozygote detection rate from 95% to 98%); the number of additional cycles is strictly limited (≤ 3) and the NTC (no template control) is monitored to ensure the absence of amplification signals (Ct > 35), avoiding false positives caused by primer dimers or environmental DNA contamination due to excessive cycles (e.g., NTC fluorescence value < 500 RFU); for some sites with high GC content (e.g., 58-60%), 57°C extension is more conducive to stable binding of primers to template, selectively enhancing signal intensity in difficult-to-amplify regions without affecting amplification of other sites (Ct value fluctuation ≤ 0.5), thereby maintaining overall detection uniformity across the 23 sites.
[0084] The 23 pairs of KASP primers were designed for 23 core SNP sites. Among them, the average GC content of the specific primers was 54.2%, the average annealing temperature (Tm) was 65°C, and the average length was 21.8 bp. The average length difference between two specific primers was only 1 bp, and the Tm difference was 1.4°C. The average GC content of the common primers was 51.4%, the average length was 25 bp, and the average Tm value was 68°C. The average length of the amplified product was 54.2 bp, ranging from 48 to 64 bp, and the interval between the forward and reverse primers was approximately 10 bp.
[0085] Specifically, the GC content of the specific primer (54.2%) matches the average level of the Camellia genome, avoiding nonspecific binding due to GC bias; the Tm value of 65°C cooperates with the Touchdown PCR strategy (61-55°C) to preferentially amplify the target SNP site under strict annealing conditions, reducing the false positive rate (such as the negative control typing error rate ≤ 0.1%); the lengths (difference of 1bp) and Tm values (difference of 1.4°C) of the two specific primers are highly close, ensuring balanced amplification efficiency for alleles (such as A / B) of the same SNP, making the FAM / HEX fluorescence signal ratio of heterozygotes (AB type) close to 1:1, and improving typing accuracy (signal difference ≥ 2500RFU); the Tm value of the common primer ( 68°C) is higher than that of specific primers, preferentially binding to the template during the extension phase, promoting efficient extension of the polymerase; the amplified products are short (average 54.2bp) and reasonably spaced (10bp), reducing the probability of secondary structure formation and ensuring amplification efficiency (average Ct value ≤ 28); the 23 pairs of primers are designed with uniform parameters (such as GC content fluctuation ±3%, Tm value fluctuation ±2°C), allowing all sites to be amplified simultaneously under the same reaction conditions, reducing competitive inhibition, and ensuring a typing success rate of ≥95% for the 23 SNP sites, with a Ct value range of ≤2.
[0086] The average typing rate of KASP markers was 92%, and the average typing success rate was 97.7%.
[0087] Specifically, the average typing rate of 92% indicates that only 8% of the 23 SNP sites have missing data due to weak signals or no amplification, which meets the requirements of genetic analysis for site integrity (such as population structure analysis requires ≥ 85% of sites to be valid); the average typing success rate of 97.7% means that the probability of incorrect typing is ≤ 2.3%, ensuring that the genotype data (such as AA / AB / BB) accurately reflects the true genetic information of the sample; in the detection of 220 camellia samples, the high typing rate and success rate make 92% × 97.7% ≈ 89.9% of the site data valid and available. , significantly reducing the cost of repeated experiments; only ≤1 site out of 23 sites in a single sample needs to be retested, improving detection efficiency (such as the number of valid samples for a single test on a 96-well plate is ≥87); high-reliability data improves the accuracy of linkage map construction (such as reducing the error rate of marker sequencing), ensuring that the 23 core sites are evenly distributed on 15 chromosomes (spacing ≥50kb); in variety identification, 89.9% of the valid data enables 193 genotypes in 220 samples to be accurately distinguished (identification efficiency 87.7%), supporting the precise identification and protection of camellia varieties.
[0088] The method of constructing KASP primer combination for SNP fingerprint of camellia varieties is applied to identification of camellia germplasm resources and varieties, protection of germplasm resources, genetic diversity and cluster analysis of camellia samples.
[0089] Table 1: 23 core SNP marker information
[0090]
[0091]
[0092] Table 2: Names and sequences of 23 pairs of KASP primers
[0093]
[0094]
[0095]
[0096]
[0097] Table 3: Genetic diversity information of 11 Camellia samples using 23 KASP markers
[0098]
[0099]
[0100] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.
Claims
1. A method for constructing a KASP primer combination for SNP fingerprinting of camellia varieties, characterized in that: The following steps are involved: S1. Obtain resequencing data of 220 Camellia cultivars and screen out 23 core SNP sites; S2. According to the KASP primer design principles, for the 23 core SNP sites, 100 bp of sequence upstream and downstream of each site were selected for design. Three primers were designed for each SNP site: two allele-specific primers and one universal primer. A fluorescent-binding specific sequence was added to the tail of the allele-specific primers, and the primers were synthesized and purified by a biotechnology company. S3. Extract genomic DNA from camellia samples, prepare SNP primer mix, perform quantitative PCR detection using the 23 pairs of KASP primers, read fluorescence data, complete genotyping analysis, and construct a SNP fingerprint map of camellia varieties.
2. The method for constructing a KASP primer combination for SNP fingerprinting of camellia varieties according to claim 1, characterized in that: The process of screening 23 core SNP sites includes: S1. For the SNP sites obtained by resequencing, the missing rate, minimum quality score, and minimum allele frequency were filtered in turn, where the missing rate was <0.2, minQ≥50, and MAF≥0.15; S2, single copy site, GC content, N filtering, the GC% of the 100bp upstream and downstream of the SNP site is 40-60, and there is no N sequence; S3, perform LD screening; S4, merged with the genetic map loci after probe evaluation; S5, screening for SNPs with single copies in the 20 bp upstream and downstream of the site; S6. Screening of SNP sites located in the exon region of the gene; S7. Select core loci based on the principle that they are evenly distributed on the chromosome and the distance is ≥50kb.
3. The method for constructing a KASP primer combination for SNP fingerprinting of camellia varieties according to claim 1, characterized in that: After the LD screening, 20,476 sites were obtained, which were combined with the 424 genetic map sites after probe evaluation to obtain 20,900 sites. After screening for SNPs with single copies 20 bp upstream and downstream of the site, 223 sites were obtained. After screening for SNP sites located in the exon region of the gene, 145 sites were obtained.
4. The method for constructing a KASP primer combination for SNP fingerprinting of camellia varieties according to claim 1, characterized in that: The allele-specific primer is an upstream or downstream primer, and the universal primer is a downstream or upstream primer. A specific sequence 5'GAAGGTGACCAAGTTCATGCT3' capable of binding to FAM fluorescence is added to the tail of the designed allele-specific primer F1, and a specific sequence 5'GAAGGTCGGAGTCAACGGATT3' capable of binding to HEX fluorescence is added to the tail of F2. The primers are purified by PAGE.
5. The method for constructing a KASP primer combination for SNP fingerprinting of camellia varieties according to claim 1, characterized in that: The process of configuring the SNP primer Mix is as follows: S1. Dry powder primer pretreatment: Place the dry powder primer synthesized by the biological company in a microcentrifuge and centrifuge at 4000 rpm for 1 minute; S2. Primer dilution: Calculate the required volume of ddH2O according to the weight and molecular weight of the primer labeled dry powder, add it to a centrifuge tube to dilute the primer concentration to 100 μM, and use a benchtop vortex mixer at 2000-2500 rpm for 10-15 seconds; S3, Mix system configuration: Take 46 μL ddH2O, 30 μL 100 μM common primer, and 12 μL each of fluorescently labeled tailed primers with a concentration of 100 μM, and add them to a new centrifuge tube in sequence; S4. Secondary mixing and centrifugation: Use the same vortex mixer at 2000-2500 rpm for 15-20 seconds, then centrifuge at 4000 rpm for 5-10 seconds in a microcentrifuge to obtain a uniform SNP primer mix.
6. The method for constructing a KASP primer combination for SNP fingerprinting of camellia varieties according to claim 1, characterized in that: The starting concentration of the DNA was uniformly set at 10 ng / μL. ddH2O was added to the control group, and two NTCs were added to each primer pair. The reaction system included DNA, 2×KASP Master mix, KBD Assay mix, and water. The amounts of different sample types added were as follows: in a wet DNA 96-well plate, 5 μL of DNA, 2.5 μL of 2×KASP Master mix, 0.14 μL of KBD Assay mix, and n / a of water were added, for a total reaction volume of 5 μL. In a wet DNA 384-well plate, 2.5 μL of DNA, 1.25 μL of 2×KASP Master mix, 0.07 μL of KBD Assay mix, and n / a of water were added, for a total reaction volume of 5 μL. In a dry DNA 96-well plate, 5 μL of DNA, 2.5 μL of 2×KASP Master mix, 0.14 μL of KBD Assay mix, and 5 μL of water were added, for a total reaction volume of 10 μL. In a dry DNA 384-well plate, 5 μL of DNA, 2×KASP Master mix, The total reaction volume was 10 μL, the amount of ELISA mix was 2.5 μL, the amount of KBD Assay mix was 0.07 μL, and the amount of water was 2.5 μL.
7. The method for constructing a KASP primer combination for SNP fingerprinting of camellia varieties according to claim 1, characterized in that: The procedure of the PCR amplification is: S1, initial denaturation, temperature 94 ° C, time 15 min, cycle number 1; S2, denaturation, temperature 94 ° C, time 20 sec, cycle number 10 times; S3, annealing / extension, temperature decreased from 61°C to 55°C at -0.6°C / cycle, time 60 sec, 10 cycles; S4, denaturation again, temperature 94 ° C, time 20 sec, cycle number 26 times; S5, annealing / extension again, temperature 55°C, time 60 sec, number of cycles 26; S6. If the fluorescence signal is low and the clusters are scattered, increase the number of cycles: denaturation temperature 94°C, time 20 seconds, 3 cycles, annealing / extension temperature 57°C, time 60 seconds. The number of cycles is determined based on the test results, while ensuring that NTC is not amplified.
8. The method for constructing a KASP primer combination for SNP fingerprinting of camellia varieties according to claim 1, characterized in that: The 23 pairs of KASP primers are composed of primers designed for 23 core SNP sites, among which: the average GC content of the specific primers is 54.2%, the average annealing temperature (Tm) is 65°C, the average length is 21.8bp, and the average length difference between two specific primers is only 1bp, and the Tm difference is 1.4°C; the average GC content of the common primers is 51.4%, the average length is 25bp, and the average Tm value is 68°C; the average length of the amplified product is 54.2bp, ranging from 48–64bp, and the interval between the forward and reverse primers is approximately 10bp.
9. The method for constructing a KASP primer combination for SNP fingerprinting of camellia varieties according to claim 1, characterized in that: The average typing rate of the KASP marker was 92%, and the average typing success rate was 97.7%.
10. The method for constructing a KASP primer combination for SNP fingerprinting of camellia varieties according to any one of claims 1 to 9, characterized in that: It is used in camellia germplasm resource and variety identification, germplasm resource protection, and genetic diversity and cluster analysis of camellia samples.